ID: 1102360718

View in Genome Browser
Species Human (GRCh38)
Location 12:112285332-112285354
Sequence TCCCTAGACCTTCCAGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 126}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102360711_1102360718 12 Left 1102360711 12:112285297-112285319 CCCTGGTGTCCAAGACCTCCACC 0: 1
1: 0
2: 0
3: 12
4: 153
Right 1102360718 12:112285332-112285354 TCCCTAGACCTTCCAGAGACTGG 0: 1
1: 0
2: 0
3: 14
4: 126
1102360706_1102360718 29 Left 1102360706 12:112285280-112285302 CCCAAGATTAGACCTACCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1102360718 12:112285332-112285354 TCCCTAGACCTTCCAGAGACTGG 0: 1
1: 0
2: 0
3: 14
4: 126
1102360712_1102360718 11 Left 1102360712 12:112285298-112285320 CCTGGTGTCCAAGACCTCCACCT 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1102360718 12:112285332-112285354 TCCCTAGACCTTCCAGAGACTGG 0: 1
1: 0
2: 0
3: 14
4: 126
1102360709_1102360718 17 Left 1102360709 12:112285292-112285314 CCTACCCCTGGTGTCCAAGACCT 0: 1
1: 0
2: 0
3: 17
4: 185
Right 1102360718 12:112285332-112285354 TCCCTAGACCTTCCAGAGACTGG 0: 1
1: 0
2: 0
3: 14
4: 126
1102360714_1102360718 3 Left 1102360714 12:112285306-112285328 CCAAGACCTCCACCTGGAATGCT 0: 1
1: 0
2: 1
3: 19
4: 189
Right 1102360718 12:112285332-112285354 TCCCTAGACCTTCCAGAGACTGG 0: 1
1: 0
2: 0
3: 14
4: 126
1102360716_1102360718 -6 Left 1102360716 12:112285315-112285337 CCACCTGGAATGCTCTATCCCTA 0: 1
1: 0
2: 6
3: 34
4: 240
Right 1102360718 12:112285332-112285354 TCCCTAGACCTTCCAGAGACTGG 0: 1
1: 0
2: 0
3: 14
4: 126
1102360710_1102360718 13 Left 1102360710 12:112285296-112285318 CCCCTGGTGTCCAAGACCTCCAC 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1102360718 12:112285332-112285354 TCCCTAGACCTTCCAGAGACTGG 0: 1
1: 0
2: 0
3: 14
4: 126
1102360717_1102360718 -9 Left 1102360717 12:112285318-112285340 CCTGGAATGCTCTATCCCTAGAC 0: 1
1: 0
2: 10
3: 62
4: 266
Right 1102360718 12:112285332-112285354 TCCCTAGACCTTCCAGAGACTGG 0: 1
1: 0
2: 0
3: 14
4: 126
1102360715_1102360718 -3 Left 1102360715 12:112285312-112285334 CCTCCACCTGGAATGCTCTATCC 0: 1
1: 1
2: 19
3: 128
4: 614
Right 1102360718 12:112285332-112285354 TCCCTAGACCTTCCAGAGACTGG 0: 1
1: 0
2: 0
3: 14
4: 126
1102360708_1102360718 28 Left 1102360708 12:112285281-112285303 CCAAGATTAGACCTACCCCTGGT 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1102360718 12:112285332-112285354 TCCCTAGACCTTCCAGAGACTGG 0: 1
1: 0
2: 0
3: 14
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102360718 Original CRISPR TCCCTAGACCTTCCAGAGAC TGG Intronic
901218161 1:7566291-7566313 TCCCAACATCCTCCAGAGACAGG - Intronic
904934922 1:34123303-34123325 TCCAGAGAGCTTCCAGAGAGCGG + Intronic
904938305 1:34147439-34147461 CTCCTAGACCTTCCACAGTCTGG - Intronic
905731693 1:40302987-40303009 TCCCAAAACCCTTCAGAGACTGG + Intronic
905960225 1:42036404-42036426 CCCCTAGACCTGGCAGAGCCGGG - Intergenic
906095901 1:43223761-43223783 TCACAAGAGGTTCCAGAGACCGG - Intronic
906242446 1:44250422-44250444 CCCCAAGATCTTCCACAGACTGG + Intronic
907079897 1:51611720-51611742 CCCCTTGACCTTCCAGAGTGTGG - Intronic
915165203 1:153944482-153944504 TTCCTAGTCCTTCCAAAGAAAGG + Intronic
915517277 1:156420864-156420886 GCCCTCGATCTTCCAGAGAAGGG - Intronic
919127153 1:193408907-193408929 TCCCCAAACCATCCAGAGATGGG + Intergenic
922416166 1:225425422-225425444 TCCCTACACCTACCTGAGATTGG + Intronic
923286171 1:232497921-232497943 TCCCTAGACCTTTGTGAGTCAGG - Intronic
923496725 1:234531800-234531822 GCCCGAGACCTTCCAGGGAGGGG + Intergenic
1069564352 10:69453170-69453192 TCCCTAGAGCTTCCACCAACAGG - Intronic
1069994113 10:72332238-72332260 TGCCCAGGCCTCCCAGAGACAGG - Intergenic
1070523359 10:77274326-77274348 TCCCTAAACCTTCCAAAGAAGGG + Intronic
1070700411 10:78597886-78597908 TCCGCAGACCTTCCACAGGCAGG - Intergenic
1071923556 10:90378508-90378530 TCCCTAAATTTTCCAGAGAGAGG + Intergenic
1075581860 10:123624826-123624848 TCCTGAGCCCTTCCAGAGAGGGG + Intergenic
1077894004 11:6440381-6440403 TCCTAAGACCTCCCACAGACAGG + Intronic
1078788491 11:14520262-14520284 GCCCTAAACCTTCCAGAGATCGG + Intronic
1079874409 11:25838793-25838815 TACCAAGACCTTCCAGAAACAGG + Intergenic
1081638464 11:44736627-44736649 TCCCTAGACCCTTCAGGGCCCGG - Intronic
1089657430 11:119960864-119960886 TCCCTAGACCTTCCGCTGTCCGG + Intergenic
1089697834 11:120226737-120226759 TCCCCTGACCCTCCAGAGTCAGG - Intronic
1092979776 12:13783016-13783038 AACCTAGACTTTCCAAAGACTGG + Intronic
1094133182 12:27097022-27097044 TGCCTTGACCTCCCAGAAACTGG - Intergenic
1094183004 12:27612233-27612255 TACCTTGACCTCCCAGAAACTGG - Intronic
1101957989 12:109227550-109227572 TGCCAGGTCCTTCCAGAGACAGG - Intronic
1102360718 12:112285332-112285354 TCCCTAGACCTTCCAGAGACTGG + Intronic
1102739502 12:115194650-115194672 TCCGTAGACCTGCCAGACGCAGG + Intergenic
1102884465 12:116511186-116511208 CCCCTTGACCTTGCAGAGAAAGG + Intergenic
1103764224 12:123270189-123270211 TCCGCAGACCTTACAAAGACGGG - Intronic
1107696778 13:43008021-43008043 TGCTTAGAAGTTCCAGAGACCGG - Intergenic
1108578375 13:51808286-51808308 TCCCTCGTCCTTACAGAGAAGGG - Intergenic
1116451609 14:45072724-45072746 TGCTTAGAAGTTCCAGAGACTGG - Intronic
1119716899 14:76866181-76866203 TTCCTAGAGCTTCCTGGGACAGG + Intronic
1121727960 14:96166678-96166700 TCCCCAGACCTTCAAGAGAGTGG + Intergenic
1124721748 15:32116685-32116707 CCCCTACACCGTGCAGAGACAGG + Intronic
1127390807 15:58503728-58503750 GCCCTGCACCTGCCAGAGACAGG + Intronic
1127646790 15:60966617-60966639 CCCTCTGACCTTCCAGAGACTGG + Intronic
1128685450 15:69681153-69681175 TCTCTAGAGATTCCAGAGTCTGG + Intergenic
1129138222 15:73573377-73573399 TCTAAAGAACTTCCAGAGACTGG - Intronic
1132575809 16:663472-663494 TCCCTGCACCTCCCATAGACTGG + Intronic
1134882747 16:17759942-17759964 TCCCTCAGCCCTCCAGAGACGGG - Intergenic
1134901698 16:17943840-17943862 TCCCTGGACCCACCAGAAACTGG - Intergenic
1141239713 16:82254346-82254368 TCCCCTGACCTTCCTGGGACAGG - Intergenic
1141470884 16:84237462-84237484 TGCCCATGCCTTCCAGAGACGGG - Exonic
1141553673 16:84822705-84822727 TGCTCAGACCTTCCAGGGACAGG + Intronic
1141910785 16:87057064-87057086 TCACCAGACCTTCCTGAGCCTGG + Intergenic
1142742144 17:1937449-1937471 ACCCGAGACCTTCCAGGGCCTGG - Exonic
1146727867 17:35170435-35170457 TCCCAATGCCTTCCAGAGATGGG + Intronic
1148844731 17:50522923-50522945 TCCCTCCTCCTTCCAGAGGCAGG + Exonic
1149146846 17:53504748-53504770 TGCCTAAATCTTCCAGAGCCAGG + Intergenic
1152465559 17:80464328-80464350 TCCCCAGACCTTCCAGGGCTTGG + Intergenic
1152716921 17:81904716-81904738 TCACCAGCCCTTCCAGAGCCAGG + Exonic
1152813691 17:82394606-82394628 ACCCTACACCCTCCAGAGAGAGG + Intronic
1154354493 18:13614757-13614779 TTCCAAGATCCTCCAGAGACCGG - Intronic
1160043596 18:75367451-75367473 TCCCTAGAACCTTCAGAGAGAGG - Intergenic
1161204669 19:3034808-3034830 GCCCTAGGCCTTCCAGGGAGGGG + Intronic
1162660915 19:12168538-12168560 TCACTAGACCCTCCAGGGAAGGG - Intronic
1163849376 19:19654694-19654716 TTCCCCGACCTTGCAGAGACGGG - Exonic
926634808 2:15167545-15167567 TCACTACAGCTTCCAGATACTGG + Intronic
928222516 2:29416262-29416284 TTCATAGACCTTGCAGAGACTGG - Intronic
932321822 2:70828180-70828202 CCCCAAGACCTGCTAGAGACAGG + Intergenic
933345915 2:81085594-81085616 TCCTTAGGCCTTCAAGAGAGGGG + Intergenic
934979444 2:98827837-98827859 TCCCCTCAGCTTCCAGAGACAGG - Intronic
936629319 2:114184131-114184153 TCCCCAGCCCTTGCAGAGAAAGG + Intergenic
937055512 2:118931923-118931945 TCCCTTGATATTCCAGAGATTGG - Intergenic
937605037 2:123789837-123789859 TACCAAGTCCTTTCAGAGACAGG + Intergenic
938558662 2:132450117-132450139 TTCCTTGACCTGCCAGAGCCTGG - Intronic
940281910 2:151997656-151997678 TTCCTTGACCTTCCAGCGTCTGG - Intronic
944434013 2:199667264-199667286 TGCCTAGACCTTTCAAAGAAAGG - Intergenic
946204327 2:218092586-218092608 ACCATAGACCTCCCAGAGCCTGG + Intergenic
946941043 2:224770496-224770518 TTCCTTGAACTTCCTGAGACAGG - Intronic
948990442 2:241551338-241551360 GCCCTAGACCTCCCAGAGAGAGG + Intergenic
1169650746 20:7864629-7864651 TCCCTAGCCCTGCCCAAGACAGG - Intergenic
1171321242 20:24246327-24246349 TCCATAGACCAGCCAGAGCCAGG - Intergenic
1172595502 20:36148528-36148550 TCTCAAGACCTTCCACAGCCTGG - Intronic
1173146935 20:40533059-40533081 CCCCTAGAACTTTCAGAGATTGG - Intergenic
1175806911 20:61834535-61834557 TGACAAGACCTTCCAGAGACAGG + Intronic
1176080540 20:63270629-63270651 GCCCCAGACCTCCCAGAGTCCGG + Intronic
1182332266 22:29559606-29559628 TCCCTAGACCTCCCAGACTCAGG + Intronic
1182905598 22:33933306-33933328 TGTCTAGACCTTTCAGAGTCTGG + Intergenic
1183409965 22:37649049-37649071 CCCCTCCACCTTCCAGAGATGGG + Intronic
1185176300 22:49328896-49328918 TCCCTTGACCTTCCAGCCTCTGG - Intergenic
949101918 3:155862-155884 TACATAGACCTGCCAGTGACTGG - Intergenic
951594369 3:24301120-24301142 TCCCTATCTCTTCCAGAGTCTGG - Intronic
952393150 3:32898147-32898169 GGCCAAGACCTTCCAGAGAAAGG - Intergenic
954760585 3:52870884-52870906 CCCCCAGACCTTCCAGTGAGAGG - Intronic
958726966 3:97917711-97917733 TCCCTTGTTCTTCCAGAGAGGGG - Intronic
962994422 3:140611407-140611429 TCCATTCACCTTCCAAAGACAGG + Intergenic
965596300 3:170414766-170414788 TCCCCAGACCATCCAGACAAAGG - Intergenic
969663406 4:8543486-8543508 ACCCAAGGCCTTCCAGAGAAAGG - Intergenic
970221889 4:13820286-13820308 TCCCTAGAGATTTCAGAGAGAGG + Intergenic
972397464 4:38670321-38670343 TCCACAAGCCTTCCAGAGACTGG - Intronic
976986736 4:91309954-91309976 TCCCTAGAGCCTTCAGAGGCAGG - Intronic
979572385 4:122243417-122243439 CCCAAAGACCTTCCAAAGACAGG - Intronic
980133751 4:128841085-128841107 TCTCTACAGATTCCAGAGACAGG - Intronic
982290203 4:153773375-153773397 GCAGGAGACCTTCCAGAGACAGG + Intergenic
984364032 4:178774929-178774951 CCCCTAGAGCCTCCAGAGAGAGG - Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
986166770 5:5279432-5279454 TCCCTAAAGCTTCCAGAAAGGGG - Intronic
987002773 5:13677209-13677231 CCCCTAGAACTTCCAGAGGGAGG + Intergenic
988787413 5:34577754-34577776 TACTTAGACCTTCAATAGACTGG - Intergenic
989180092 5:38567911-38567933 TCCCTACACCTCACAGAGACTGG + Intronic
992823652 5:80525555-80525577 TCCTGAGACCTTCCTGAGTCTGG - Intronic
997939555 5:138144651-138144673 TGCCTAGGCCTTCCAAAGGCTGG - Intronic
1001389838 5:171369920-171369942 TCCCTAGACCTCACACAGACAGG + Intergenic
1002882156 6:1262838-1262860 TCCCTGGACCTGCCAGGGAACGG + Intergenic
1006129236 6:31859412-31859434 TCACTAGACCTGCCCAAGACAGG + Exonic
1006627002 6:35404666-35404688 TCCCTACTCCTAGCAGAGACGGG + Intronic
1007494119 6:42247748-42247770 TCCCTAGAGCCTCCAGAAATAGG - Intronic
1012579466 6:100848855-100848877 TGCCTTGACCTTCCAGAGTGTGG - Intronic
1014156022 6:118110693-118110715 TCCCTAGACATTCCTTAGATAGG + Intronic
1014325607 6:119988857-119988879 TCCCTAGAACTTCCAGAAAAAGG + Intergenic
1015860480 6:137673403-137673425 TTCCTGGATCTTCCAGAGCCTGG + Intergenic
1019898826 7:4003684-4003706 TTGCTAGACCTTCCAGACACGGG + Intronic
1021840268 7:24716842-24716864 GCCCTTCACCTTCCAGAGACAGG + Intronic
1028109418 7:86921063-86921085 TCCCTAAACTGTCCTGAGACAGG - Intronic
1030587794 7:111442433-111442455 TTTCTAGACCTTCCAAATACTGG + Intronic
1030705399 7:112687962-112687984 TTCCTAGTCTTTCTAGAGACTGG + Intergenic
1036645818 8:10611085-10611107 CCCCCAGGCCTTCCAGAGAATGG + Exonic
1045112254 8:98947243-98947265 TCCCGAGCCCTTCCAGAGGAAGG + Intronic
1046817181 8:118597479-118597501 GACCTAGACATTTCAGAGACAGG + Intronic
1047152840 8:122284180-122284202 TCTTTAGAGCTTCCAGAAACAGG - Intergenic
1048017314 8:130509017-130509039 TCCCATGACCCTCCAGAGGCAGG - Intergenic
1048978612 8:139690537-139690559 TCACTGAACCTTCCAGTGACAGG - Intronic
1049296966 8:141846196-141846218 TCCCAAAACCTTTCAGAGAAGGG + Intergenic
1051727464 9:20102899-20102921 TCCCTTGAGCTTCCAGAGTGAGG - Intergenic
1052108586 9:24550181-24550203 ACCCTAGACCTTCTTGAGCCAGG - Intergenic
1056497113 9:87168517-87168539 TCCCTAGACCTCTCATAGACTGG + Intergenic
1057005778 9:91557450-91557472 TCCCTACATCTGCCAGCGACTGG + Intergenic
1060415183 9:123424981-123425003 TCCCTAGCCCTGGCAGAGCCAGG - Intronic
1203397813 Un_KI270519v1:44058-44080 CCCCTAGTCCTTCCAGAGTGAGG - Intergenic
1187445496 X:19357187-19357209 ACCCTTGACCTTCCAGAATCAGG + Intronic
1190303230 X:49068077-49068099 CCCCCATACCTGCCAGAGACAGG - Exonic
1192249709 X:69401536-69401558 TCCCCTGTCCTTCCAGAGCCAGG - Intergenic
1195146798 X:102026511-102026533 ACCCTAAACCTTCCAGTTACAGG + Intergenic
1198112637 X:133515055-133515077 TACCTAGAGCTTCCAGAGGGAGG - Intergenic