ID: 1102361137

View in Genome Browser
Species Human (GRCh38)
Location 12:112288666-112288688
Sequence GAGCTTTTCAAGAGGACAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102361137 Original CRISPR GAGCTTTTCAAGAGGACAAG TGG (reversed) Intronic
902497235 1:16881472-16881494 GAGCTTTTTAAGACTACTAGTGG + Intronic
902568457 1:17331249-17331271 GAGCTCTTCCACAGGGCAAGAGG - Intronic
904916912 1:33976928-33976950 GAGCTTTTCCAGAAAAGAAGTGG + Intronic
904992090 1:34601329-34601351 GGGCATTCCAAGAGGCCAAGGGG - Intergenic
906177019 1:43783382-43783404 GACATTTTCAGGAGGACAAGGGG - Intronic
906323638 1:44831228-44831250 GAGCTGTAGAAGAGTACAAGGGG + Intronic
908487390 1:64608323-64608345 GAGCTGTACAGGAGGAAAAGGGG - Intronic
910681975 1:89876026-89876048 GAGCTTTTCAAAAGGACCTCAGG - Intronic
911196235 1:94998006-94998028 GAGCCTTTTAAGGGGAAAAGAGG + Intronic
914522502 1:148430455-148430477 GAGCTTTTTAAGACTACTAGTGG - Intergenic
915266637 1:154723076-154723098 GACCATTTCAAGAGGACAGAAGG + Intronic
915609262 1:156978151-156978173 GAGCTTTTCAACAGGACATTAGG + Intronic
918308389 1:183267742-183267764 GAGCTCTTCATGAAGACAGGAGG - Intronic
923031266 1:230250702-230250724 GAGACTTTCAAGAGCAAAAGGGG - Intronic
923115417 1:230932524-230932546 CCGCTTTTCAGGAGGTCAAGTGG - Intronic
924571835 1:245244058-245244080 TAGCTACTCAACAGGACAAGAGG - Intronic
1069394027 10:67968708-67968730 AAGCATTTCCAGAGGAAAAGGGG + Intronic
1070372228 10:75793237-75793259 GAGTTTTTCTTGAGGACAGGAGG + Intronic
1070618963 10:77991986-77992008 GACCATTTCTAGAGGACAAAAGG + Intronic
1074171100 10:110937574-110937596 GATATTTTTAAGAGGAAAAGAGG + Intronic
1076116369 10:127904554-127904576 GAGGTGTTCAGGAGGGCAAGAGG + Intergenic
1076178079 10:128384148-128384170 AAGATTTTCAAGAGGACTACAGG + Intergenic
1084600773 11:70144215-70144237 GAGCCTCTCAAGGGGACACGTGG + Intronic
1085484949 11:76854926-76854948 GAGCTGTAAAAGAGGACAAGAGG + Intergenic
1087059142 11:93961518-93961540 GATCTTTTCAAGAGGAAAGAGGG + Intergenic
1087638386 11:100728592-100728614 GAGCTTATAATGAGGAAAAGAGG - Intronic
1087959284 11:104327678-104327700 GTGCTTATCAACAGGAGAAGGGG + Intergenic
1087988104 11:104710000-104710022 GAGATTTTAAAGAGTGCAAGTGG + Intergenic
1088509508 11:110560245-110560267 GGTCATTTCAATAGGACAAGAGG + Intergenic
1089203886 11:116742567-116742589 CAGCTACTCAAGAGGTCAAGTGG - Intergenic
1089689593 11:120179062-120179084 GAGCTCTGCAAGAGAACAAAAGG + Intronic
1090353127 11:126120532-126120554 GAGGTTTTCTGGTGGACAAGTGG + Intergenic
1092774407 12:11929801-11929823 AGGCTTCTCAAGAGGAAAAGTGG - Intergenic
1093704839 12:22263216-22263238 TAGCTTTTGAAGACGACAACAGG + Intronic
1095426143 12:42076406-42076428 GAGGACATCAAGAGGACAAGGGG + Intergenic
1096542076 12:52313546-52313568 GAGCTTTCCAAGAGGAGGACAGG + Intergenic
1096879712 12:54657912-54657934 GAGTTTTCCAAGAGGATCAGGGG + Intergenic
1099293124 12:80797194-80797216 GCGATTTTCAAGAGGAAAACAGG + Exonic
1100144177 12:91657088-91657110 GAGATTTTAAAGAGGATCAGAGG - Intergenic
1100220190 12:92496573-92496595 GAGCTGTTTAGGAGGGCAAGAGG + Intergenic
1102361137 12:112288666-112288688 GAGCTTTTCAAGAGGACAAGTGG - Intronic
1102918537 12:116774182-116774204 CAGCTTTGCAAGATGAAAAGAGG + Intronic
1103082997 12:118040295-118040317 GAGCTTTTCAAGGAGAGGAGGGG - Intronic
1103087903 12:118076070-118076092 AAGGATTTCAAGGGGACAAGAGG + Intronic
1104209658 12:126676613-126676635 GAGGTTTTCCAAAGGACAAAGGG - Intergenic
1104392019 12:128398922-128398944 GAGCTTTCCAAGAGGGAATGGGG - Intronic
1106334187 13:28767616-28767638 GAGGATTTTAAGAGGACGAGTGG + Intergenic
1106479331 13:30124837-30124859 CGGCTTCTCAAGAGGACAACCGG - Intergenic
1106498000 13:30299073-30299095 TAACTTTTCAAGAGGAACAGTGG + Intronic
1108773106 13:53729843-53729865 ATGTTTCTCAAGAGGACAAGGGG + Intergenic
1110391112 13:74975329-74975351 GAGCTTTTCAAGCAGAGAGGAGG - Intergenic
1111629963 13:90837861-90837883 GAGATTGGAAAGAGGACAAGAGG - Intergenic
1114599008 14:23939134-23939156 CAGCTTTTCTAGAGGGCAATAGG + Intergenic
1117372567 14:55092166-55092188 CAGCTATTCAAGAGCACAGGAGG - Intergenic
1117628472 14:57664950-57664972 GAGCTTTCCAAGAAGGCAGGTGG + Intronic
1118313136 14:64707250-64707272 GAGCTTGACAAGAGGAAATGAGG - Intronic
1118695428 14:68380260-68380282 TAGCTTTTCAAGATGACCAACGG - Intronic
1119964839 14:78902935-78902957 GAGATTTGCAGGAGGATAAGAGG - Intronic
1120102229 14:80458483-80458505 TAGAACTTCAAGAGGACAAGAGG - Intergenic
1121035053 14:90696311-90696333 CAGCTTTCAGAGAGGACAAGTGG - Intronic
1121670240 14:95704052-95704074 AAGCTTTTCATTAGGACTAGTGG + Intergenic
1125133964 15:36319655-36319677 GAGGTTTACAAGAGAAAAAGAGG - Intergenic
1128879654 15:71231485-71231507 GAGCTCTTCCAGAAGTCAAGAGG - Intronic
1130889471 15:88121057-88121079 GAGGTGGTCAAGAGGAAAAGAGG + Intronic
1133533370 16:6676005-6676027 GAGGTTCTCAAAAGGAAAAGAGG + Intronic
1134617111 16:15660069-15660091 GAGCTTGTCAAAAGGGCATGAGG - Intronic
1134873954 16:17678572-17678594 GTGTTGTTCAAGAGGAGAAGAGG - Intergenic
1136776162 16:32872956-32872978 GAGCTATTCAAGTGAGCAAGGGG - Intergenic
1136894453 16:33988556-33988578 GAGCTATTCAAGTGAGCAAGGGG + Intergenic
1139054916 16:63171178-63171200 GATCTTTTAAAGAGGAAAATTGG - Intergenic
1139318920 16:66097185-66097207 GAATTTTTTAAGGGGACAAGGGG + Intergenic
1203078578 16_KI270728v1_random:1135065-1135087 GAGCTATTCAAGTGAGCAAGGGG - Intergenic
1145276038 17:21431370-21431392 TAGATTTAGAAGAGGACAAGTGG + Intergenic
1145313884 17:21717284-21717306 TAGATTTAGAAGAGGACAAGTGG + Intergenic
1145712326 17:26989258-26989280 CAGATTTAGAAGAGGACAAGTGG + Intergenic
1146885151 17:36465389-36465411 GAGCTTCTCAACAAAACAAGGGG + Intergenic
1153776322 18:8457219-8457241 GAGTTTTTCAAGAGGAGACATGG + Intergenic
1153809564 18:8740034-8740056 GAGATTGTAAAGAGGAAAAGAGG + Intronic
1157651513 18:49337334-49337356 GAGGTTCTCAGGAGGACAAAAGG - Intronic
1158307627 18:56124352-56124374 GAGCTAATCAAGAGAACCAGGGG + Intergenic
1158310059 18:56148605-56148627 GAGCATTCCAAGAGGGCAAGTGG - Intergenic
1159269369 18:66129220-66129242 TTGTGTTTCAAGAGGACAAGAGG + Intergenic
925543627 2:4993668-4993690 GAGCTTTTGAAGAGGAACACGGG - Intergenic
927082764 2:19647016-19647038 GAGTTTTCCAAAAGGACTAGGGG + Intergenic
929874942 2:45788656-45788678 AAGCTTTTCATGAGGACCAGAGG + Intronic
930928071 2:56846005-56846027 GACATTTTCCAGAAGACAAGTGG + Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
934810764 2:97275103-97275125 TAATTTTTCAAAAGGACAAGGGG + Intergenic
934826928 2:97432836-97432858 TAATTTTTCAAAAGGACAAGGGG - Intergenic
934976941 2:98809351-98809373 GAGCCAGCCAAGAGGACAAGGGG - Intronic
937445328 2:121952671-121952693 GAGCATTCCAAAAGGACATGAGG - Intergenic
940631619 2:156246924-156246946 GAGGTTTTCTAGAGATCAAGAGG - Intergenic
941983656 2:171488411-171488433 GTGCTTTTCAAAAACACAAGTGG - Intergenic
945563850 2:211371479-211371501 GAGCTTTTTAAGTTGAAAAGTGG - Intergenic
946416416 2:219542209-219542231 AAGCTTATCAAAAGGACAACGGG + Intronic
947038795 2:225891427-225891449 GAGAGTTACAAGAGGAAAAGAGG + Intergenic
948678626 2:239614826-239614848 CAGCTACTCAAGAGGCCAAGTGG + Intergenic
1169299703 20:4431476-4431498 GTGCTCTTCAAGGTGACAAGGGG - Intergenic
1170016990 20:11792411-11792433 GAGCTTTCAAAGAGAAAAAGAGG - Intergenic
1170938141 20:20827384-20827406 TAGCTTTGCAAAAGGAAAAGTGG - Intergenic
1171170075 20:23007948-23007970 GAGGTTTTCAGTAGAACAAGAGG - Intergenic
1174543690 20:51309048-51309070 GAGCTGGACAATAGGACAAGGGG - Intergenic
1174674713 20:52342556-52342578 CATCATCTCAAGAGGACAAGAGG - Intergenic
1175349936 20:58310171-58310193 GACCTTTTCGAGAGTGCAAGAGG - Intronic
1175619503 20:60431475-60431497 GAGCTTTTTCTGAGGACAACTGG + Intergenic
1176587903 21:8607540-8607562 GAGCTTTTCAACATTACAATAGG - Intergenic
1180139028 21:45880237-45880259 GAGCTTTCCAGGAGGGCAACTGG - Intronic
1180270735 22:10584539-10584561 GAGCTTTTCAACATTACAATAGG - Intergenic
1182718393 22:32378028-32378050 GAGCTTTTCAACAGTCCAGGTGG + Intronic
1183006397 22:34906166-34906188 GAGGATAGCAAGAGGACAAGAGG - Intergenic
1183254600 22:36754215-36754237 GAGCCATGGAAGAGGACAAGAGG + Intergenic
1183439533 22:37815528-37815550 GGGCCCTTCAAAAGGACAAGGGG - Intronic
1185403101 22:50628406-50628428 GAGCTTCTCCAGAGGAGGAGCGG + Intergenic
949139453 3:614201-614223 GAGCTTTTCAACATTACAATAGG + Intergenic
951259550 3:20490737-20490759 GAGATTTCAAAGAAGACAAGAGG - Intergenic
953590936 3:44253158-44253180 AAGCTTTTGAAAAGGACATGAGG + Intronic
955708561 3:61754567-61754589 ATGTTTTTCAAGTGGACAAGTGG + Intronic
956329413 3:68089037-68089059 GAGGTTTTCATGAGGATGAGTGG + Intronic
958470475 3:94511267-94511289 GAGCTTTTTAAGGGGACACTTGG + Intergenic
961848735 3:129793530-129793552 GAGCTTTTAAAGAACACAATGGG + Intronic
962264035 3:133933172-133933194 CAGCTGTTCCAGAGGACATGGGG + Exonic
966050531 3:175612649-175612671 AAGCTTTTCAAGAGGCTAACAGG + Intronic
966668683 3:182502138-182502160 GGGCTTCTAAAGGGGACAAGGGG + Intergenic
966689450 3:182727988-182728010 GAGTTTTTCAGGAAGAAAAGGGG - Intergenic
968875769 4:3267085-3267107 GAGCTCTTCTAGAGGAAACGTGG + Intronic
974328565 4:60446426-60446448 GAGCACTTCAAGAAGACAAAAGG - Intergenic
975139760 4:70907024-70907046 GAGCTCTCTAAGAAGACAAGGGG + Intronic
975847286 4:78538424-78538446 GTCCTTTTCAAAAGGACATGTGG - Intronic
977569484 4:98614527-98614549 GGGCCTTCCAAGAGGTCAAGAGG + Intronic
978136200 4:105263737-105263759 GAGATTATAAAGAGGACAAAGGG + Intronic
978738799 4:112114433-112114455 GAGCTTTTGAAGAAGAGAATCGG - Intergenic
981204872 4:142028443-142028465 GATCATTTCAATAGGACTAGGGG - Exonic
986207347 5:5637582-5637604 GACATTTTCAAGAAGAAAAGAGG + Intergenic
990468285 5:56089622-56089644 GAGCTTTTCTAGAAAAAAAGAGG + Intergenic
993379890 5:87194716-87194738 GATTTTGTCAAGTGGACAAGAGG + Intergenic
993725141 5:91358531-91358553 GAGTCTTTCAAGAGGAAAAAGGG - Intergenic
995399315 5:111722279-111722301 GAGGTTGTTAAAAGGACAAGGGG + Intronic
996379406 5:122848214-122848236 GTGCTACTCAAGAGGCCAAGGGG - Intronic
996820817 5:127625115-127625137 TAGCATGTCAGGAGGACAAGTGG + Intergenic
997689130 5:135813797-135813819 GAACTTTCCCAGAGGGCAAGAGG + Intergenic
999887004 5:155935644-155935666 TAGCTTAGCATGAGGACAAGAGG + Intronic
1000772610 5:165375278-165375300 GAGCTTTTCAAGCTGCCAGGAGG - Intergenic
1001920286 5:175594390-175594412 GGGCTTTGCAAGAGGAGAACTGG - Intergenic
1004333020 6:14738722-14738744 GAGAATTTCAGGAGGAGAAGGGG - Intergenic
1007365466 6:41388823-41388845 GTGATATTCAAGAGGAGAAGGGG - Intergenic
1007935141 6:45726295-45726317 GAGTTCTTCAGGAGGAGAAGTGG + Intergenic
1008068950 6:47079878-47079900 GAGCATTTCGAGAGAACAAGGGG + Intergenic
1010290048 6:74125150-74125172 GTTCTTTTCAAGTGAACAAGGGG + Intergenic
1010696897 6:78986657-78986679 TAACTTTTAAAGAGGACAATGGG + Intronic
1011144431 6:84196942-84196964 GAGATTTTCAAGAGGACATGAGG + Intronic
1011742352 6:90374925-90374947 GAGTTTTGCCAGAGGAAAAGAGG - Intergenic
1012178735 6:96123848-96123870 GGGCTTTTCATGAGGAAGAGGGG + Intronic
1012864217 6:104598053-104598075 GAGCTTTGGAAAAGGAAAAGGGG - Intergenic
1013007861 6:106091087-106091109 GATTATTTCAGGAGGACAAGGGG - Intronic
1015385781 6:132621466-132621488 GAGCTTAACAAGAGTACACGTGG - Intronic
1015886173 6:137920978-137921000 GAGCTTTTCAAGAGCAGTTGAGG + Intergenic
1016845362 6:148563529-148563551 GAGCTATTCCAGAGGACAAAGGG - Intergenic
1017014514 6:150089185-150089207 GAGCTTATCAAGATGACGGGAGG - Intergenic
1019200295 6:170308258-170308280 GTGCTTTTCAAGAATACAACTGG - Intronic
1020822954 7:12993092-12993114 TAGATTTTCAAAATGACAAGTGG + Intergenic
1025994775 7:66521054-66521076 GAGCTTTTCAATAAGACATATGG + Intergenic
1026439930 7:70435279-70435301 GTGCTTTTCTACAGGAAAAGAGG - Intronic
1026852049 7:73730686-73730708 GGGCTTGTCAAAATGACAAGAGG + Intergenic
1031439269 7:121773049-121773071 GAGCCTTCAAAGAGGACCAGAGG + Intergenic
1031696628 7:124864190-124864212 GAGCATTTCATAAGGACAAAGGG - Intronic
1034784090 7:153909549-153909571 GAGATTTTTAAGAGGAAATGAGG - Intronic
1034860364 7:154589974-154589996 CAGCTTATAAAGAAGACAAGAGG - Intronic
1035016487 7:155770802-155770824 GAACTTTTCATGGGGAAAAGAGG + Intronic
1040443864 8:47473487-47473509 GAGCTTTTCAGGCAGACCAGGGG - Intronic
1041647841 8:60271920-60271942 TAGCTTCTCAGCAGGACAAGTGG - Intronic
1041713740 8:60915060-60915082 GCGCTTTTCAACAGGCCAAAGGG - Intergenic
1043888614 8:85631393-85631415 CAGCTTTTCAAGGTGACATGTGG + Intergenic
1044592986 8:93931892-93931914 GAGATTTTAAAGGGGAAAAGGGG + Intergenic
1045200770 8:99978518-99978540 GAGCTTTTCCAGAGGCAAAATGG - Intronic
1045624230 8:104023769-104023791 CTGGTTATCAAGAGGACAAGTGG + Intronic
1048972576 8:139653526-139653548 GAGCTGTTGGAGAGAACAAGAGG - Intronic
1050915820 9:11130708-11130730 GAGCATTTTAAGATGACAAATGG + Intergenic
1052184031 9:25567675-25567697 GAACTTGCCAAGGGGACAAGGGG + Intergenic
1054898465 9:70341111-70341133 GAGCTTTTTAAGGGTAGAAGTGG - Intronic
1054933929 9:70666643-70666665 GAGCTTCTAAAGAGAAAAAGTGG - Intronic
1058404051 9:104651693-104651715 AAGTATTTCAGGAGGACAAGAGG - Intergenic
1059307400 9:113365468-113365490 GAACTTTTCAAAAGGACACAGGG - Intronic
1059330407 9:113531973-113531995 GGGATTTTAAAGAGGCCAAGAGG + Intronic
1203617908 Un_KI270749v1:86128-86150 GAGCTTTTCAACATTACAATAGG - Intergenic
1186906099 X:14112362-14112384 GAGCTTTATAAAAAGACAAGAGG + Intergenic
1187416398 X:19097003-19097025 GTGCTTTTCTAGAAGAGAAGAGG + Intronic
1187607999 X:20907042-20907064 GAACATTCCAAGAGGAAAAGTGG - Intergenic
1189260915 X:39678262-39678284 GGGCTACTCAAGAGGAAAAGAGG + Intergenic
1191141372 X:57119644-57119666 GATCTTTTCAACAAGACAAAGGG + Intronic
1191143017 X:57135612-57135634 GAACTTTTCAACAAGACAAAGGG + Exonic
1196374683 X:115019952-115019974 GAGTTTTTCACAAGGACCAGGGG + Intronic
1196477397 X:116104623-116104645 GTGCTTATAAAGAGGAAAAGTGG + Intergenic
1196603621 X:117629963-117629985 GAGCTTTTCAAGAGTGTAATGGG - Intergenic
1198240460 X:134779886-134779908 AAGCTTGTCAAGAGGACTATTGG - Intronic
1199089962 X:143680225-143680247 GAGTTTTCCAAGAGGGCCAGAGG + Intergenic
1200103715 X:153701087-153701109 CAGCTATTCAAGTGAACAAGGGG + Intronic