ID: 1102362507

View in Genome Browser
Species Human (GRCh38)
Location 12:112300558-112300580
Sequence GACTGAAGGACGTTGGTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 48}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102362507_1102362511 20 Left 1102362507 12:112300558-112300580 CCAGATACCAACGTCCTTCAGTC 0: 1
1: 0
2: 1
3: 1
4: 48
Right 1102362511 12:112300601-112300623 TTCTTTTTTCTTTCCGAGACAGG 0: 1
1: 5
2: 207
3: 2265
4: 22396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102362507 Original CRISPR GACTGAAGGACGTTGGTATC TGG (reversed) Intronic
900526746 1:3133128-3133150 GCCCGAAGGACGGTGGTAACCGG + Intronic
904393237 1:30199417-30199439 GACTGAAGGTCCTTAGGATCAGG + Intergenic
909160068 1:72135474-72135496 GACTGAAGGACAGTGATCTCTGG + Intronic
909496477 1:76284827-76284849 GACTGAAGGACAATGGCATATGG - Intronic
921296913 1:213712709-213712731 CAGTGAGGGACGGTGGTATCCGG - Intergenic
1063292401 10:4762787-4762809 GAATGAAGGAAGTTGATAGCAGG + Intergenic
1069066467 10:63947122-63947144 GACTGCCAGACTTTGGTATCAGG + Intergenic
1069417567 10:68214491-68214513 GACTCAAGGAACTTGGTATAAGG - Intergenic
1075461536 10:122619755-122619777 GAGTGAGGGACGGAGGTATCAGG - Intronic
1078911317 11:15735041-15735063 GACAGAAGGACTTTGGCAGCAGG + Intergenic
1079916588 11:26375375-26375397 GAGTTAAGGACCTTGGTATAAGG + Intronic
1080807913 11:35672622-35672644 GACTGAGGAACATTGGTGTCTGG + Intronic
1085230310 11:74962056-74962078 ATCTGAAGGACATTGGTTTCTGG + Intronic
1089479550 11:118792979-118793001 GATTGGAGGATGTTGGCATCGGG - Intergenic
1099745033 12:86690509-86690531 CCTTGAAGGACGTTGCTATCTGG - Intronic
1102362507 12:112300558-112300580 GACTGAAGGACGTTGGTATCTGG - Intronic
1115359874 14:32488727-32488749 GAGTGAAGGACCGTGCTATCTGG - Intronic
1116758569 14:48980948-48980970 CCCTTAAGGACTTTGGTATCAGG - Intergenic
1123875421 15:24618984-24619006 AACTGAAGGAAGTTGGGATGTGG - Intergenic
1125519318 15:40339373-40339395 GACTGCAGGAGGTTGGGAGCTGG + Intronic
1125884382 15:43217752-43217774 GTCTAAAGGACCTTGCTATCAGG - Intronic
1140666119 16:77229149-77229171 GACTAAAGGAGGTGGGTATATGG + Intergenic
1146482173 17:33213586-33213608 GACCGCAGGACGATGGTAACAGG - Intronic
1160554887 18:79718517-79718539 GACTGGAAGGCGTTGGTAGCCGG + Intronic
945748068 2:213743398-213743420 GACAGAAGGAAGTTGATCTCAGG - Intronic
945985317 2:216348962-216348984 GACTGAAGGACTGTGATATATGG - Intronic
947949918 2:234138212-234138234 GACTGAATGACGGAGGGATCGGG - Intergenic
1183470759 22:38005216-38005238 GAGTGAAGGACGTTGGAAATAGG - Intronic
960925424 3:122791341-122791363 AACTGAAAGAAGTTGGTGTCAGG - Intronic
963506762 3:146195716-146195738 AACTGAAGCTCGTTGGTATCTGG - Intronic
964153963 3:153562860-153562882 GAATGGAGGAGGTTGGTATAGGG + Intergenic
966736407 3:183190388-183190410 GACTGAAGACCGTTAGTAGCAGG - Intronic
969174993 4:5391683-5391705 GCCTGAAGGCCTTTGGAATCTGG + Intronic
976618685 4:87105288-87105310 GAGTGAAGGACTTTAGTCTCAGG + Intronic
979821980 4:125186222-125186244 GACTGAAGGTAGATGGTTTCAGG + Intergenic
985162643 4:187060656-187060678 AACTCTAGGACGTTGGTAACAGG - Intergenic
985972421 5:3388879-3388901 GACTGAAGGAAGGTGGGACCTGG - Intergenic
1013633191 6:112005064-112005086 GACTGGAGGAGGGTGGTGTCAGG - Intergenic
1018385769 6:163301535-163301557 GACAGCAGGACATTGTTATCTGG - Intronic
1020671778 7:11124073-11124095 TTCTGAAGAAAGTTGGTATCAGG + Intronic
1020968487 7:14902922-14902944 GGCTGAAAGACGTAGGTTTCCGG + Intronic
1021000447 7:15324277-15324299 GACTTTTAGACGTTGGTATCAGG + Intronic
1023565833 7:41522866-41522888 GAGTGATGGAGGGTGGTATCAGG + Intergenic
1026424521 7:70276887-70276909 GAGTAAAGAACGTTGGTAACTGG + Intronic
1026522172 7:71127076-71127098 GACTGAAGGCCGCTGGTCTGGGG - Intergenic
1026661181 7:72304113-72304135 GTCTGAAAGACGGTGGTTTCGGG - Intronic
1036590712 8:10165536-10165558 GACAGCAGCACGTTGGTACCTGG + Intronic
1038351225 8:26777898-26777920 GACTGAGGCACGTTGGTCTATGG + Intronic
1038843909 8:31211373-31211395 GATTGAAGGACGTTGGTATGGGG - Intergenic
1061919131 9:133772518-133772540 GACAGAAGGAGGTTAGTGTCTGG - Intronic
1197290561 X:124651971-124651993 GGATCAAGGACCTTGGTATCTGG - Exonic