ID: 1102362511

View in Genome Browser
Species Human (GRCh38)
Location 12:112300601-112300623
Sequence TTCTTTTTTCTTTCCGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 24874
Summary {0: 1, 1: 5, 2: 207, 3: 2265, 4: 22396}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102362506_1102362511 29 Left 1102362506 12:112300549-112300571 CCTTTTAATCCAGATACCAACGT 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1102362511 12:112300601-112300623 TTCTTTTTTCTTTCCGAGACAGG 0: 1
1: 5
2: 207
3: 2265
4: 22396
1102362508_1102362511 13 Left 1102362508 12:112300565-112300587 CCAACGTCCTTCAGTCTGAAGTC 0: 1
1: 0
2: 1
3: 8
4: 114
Right 1102362511 12:112300601-112300623 TTCTTTTTTCTTTCCGAGACAGG 0: 1
1: 5
2: 207
3: 2265
4: 22396
1102362509_1102362511 6 Left 1102362509 12:112300572-112300594 CCTTCAGTCTGAAGTCTTTCCTG 0: 1
1: 0
2: 3
3: 35
4: 317
Right 1102362511 12:112300601-112300623 TTCTTTTTTCTTTCCGAGACAGG 0: 1
1: 5
2: 207
3: 2265
4: 22396
1102362507_1102362511 20 Left 1102362507 12:112300558-112300580 CCAGATACCAACGTCCTTCAGTC 0: 1
1: 0
2: 1
3: 1
4: 48
Right 1102362511 12:112300601-112300623 TTCTTTTTTCTTTCCGAGACAGG 0: 1
1: 5
2: 207
3: 2265
4: 22396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102362511 Original CRISPR TTCTTTTTTCTTTCCGAGAC AGG Intronic
Too many off-targets to display for this crispr