ID: 1102363897

View in Genome Browser
Species Human (GRCh38)
Location 12:112314487-112314509
Sequence TTACAGAAACAGACGGATCT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102363897_1102363901 28 Left 1102363897 12:112314487-112314509 CCTAGATCCGTCTGTTTCTGTAA 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1102363901 12:112314538-112314560 AATGATCCCCTAAAAATAAAAGG 0: 1
1: 0
2: 1
3: 36
4: 408
1102363897_1102363900 -7 Left 1102363897 12:112314487-112314509 CCTAGATCCGTCTGTTTCTGTAA 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1102363900 12:112314503-112314525 TCTGTAATAGATGGACTGTGTGG 0: 1
1: 0
2: 0
3: 10
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102363897 Original CRISPR TTACAGAAACAGACGGATCT AGG (reversed) Exonic
901672564 1:10864797-10864819 TTACAGAAACACAAGGAGCTAGG + Intergenic
906763385 1:48402034-48402056 TTCTAGAAACAGACAGATCTGGG - Intronic
907396636 1:54195279-54195301 TAACAGAAGCAAACAGATCTAGG - Intronic
907956594 1:59233973-59233995 CTTCAGAATCAGACTGATCTGGG - Intergenic
908042649 1:60131440-60131462 TCACAGAAAGAGAATGATCTAGG - Intergenic
908224581 1:62043147-62043169 TTACAGAAAAAGACAGACTTTGG - Intronic
911899314 1:103482052-103482074 TTACAGATACAGAAAGAACTGGG - Intergenic
916945665 1:169724493-169724515 TTACAGAAACAGGTGCATCTGGG - Exonic
918662721 1:187108893-187108915 TTAAGGAATCAGACAGATCTTGG + Intergenic
1064432756 10:15285413-15285435 TTACAGAAACATGTGGCTCTGGG + Intronic
1064459409 10:15519590-15519612 TTACAGAACCAAGCAGATCTAGG - Intronic
1065752938 10:28904960-28904982 TTACTGAAACAGATGCATGTTGG - Intergenic
1068144957 10:53057239-53057261 TTTCAGAACCTGACTGATCTAGG - Intergenic
1069359172 10:67622406-67622428 TAACAGAAACAGAGTGAACTGGG + Intronic
1070633954 10:78109000-78109022 TTTGAAAAACAGACAGATCTGGG - Intergenic
1074179959 10:111051506-111051528 TTAGAGAAACAGCTGAATCTAGG + Intergenic
1074249131 10:111726222-111726244 GTTCAGAATCAGACAGATCTGGG + Intergenic
1074634954 10:115304528-115304550 TTACAGAGACAGAGGGATGGGGG + Intronic
1075590465 10:123687552-123687574 TTTCAGAGTCAGACGGACCTAGG + Intronic
1076249250 10:128972284-128972306 TTACATATAAAGAAGGATCTTGG - Intergenic
1076509149 10:130999823-130999845 AAACAGAAGCAGAGGGATCTAGG - Intergenic
1078176083 11:8972070-8972092 TGACAGGAACAGAAGGAACTTGG + Intergenic
1079397881 11:20081590-20081612 TCACAGAAACAGAAGGATTAGGG - Intronic
1080271245 11:30452862-30452884 TTACAGCAAAAGAGGGATCTGGG + Intronic
1081654192 11:44846547-44846569 TAACAGAAACAGTCTGCTCTGGG + Intronic
1084521879 11:69668312-69668334 ATGCAGAAACAGACAGAACTGGG + Intronic
1085515824 11:77111312-77111334 TTTCAGAGGCAGACAGATCTGGG + Intronic
1087964982 11:104401389-104401411 TTTCAGAGTCAGACTGATCTGGG - Intergenic
1088973929 11:114798042-114798064 CTAAAGAAATAGAAGGATCTGGG - Intergenic
1090880037 11:130825235-130825257 TTACAGAAAGAGAGAGAGCTGGG - Intergenic
1090901903 11:131039358-131039380 TTACAGACACAGATACATCTGGG - Intergenic
1093493293 12:19727841-19727863 TCACAGCAACAGAAGTATCTGGG - Intergenic
1094163779 12:27421192-27421214 TTACAGAAAAGGAAGGATCTTGG + Intronic
1102363897 12:112314487-112314509 TTACAGAAACAGACGGATCTAGG - Exonic
1102721518 12:115020721-115020743 TTATAGAACCTGACAGATCTGGG - Intergenic
1103533737 12:121620491-121620513 TTAGAGGAACAAAAGGATCTGGG - Intergenic
1109094655 13:58097407-58097429 TTACTGAAACTGAGGGAACTAGG - Intergenic
1109731112 13:66415347-66415369 TTTCAGGAACAGATGGATTTTGG - Intronic
1110357484 13:74584613-74584635 TTACAGATGCAGACAGAGCTAGG + Intergenic
1112828661 13:103421661-103421683 TTTTAGAATCAGACAGATCTAGG - Intergenic
1115758230 14:36551124-36551146 TTACAAAAACAGACAGAGGTTGG - Intergenic
1122653764 14:103243009-103243031 GTACAGAAACAGAGGGATGGGGG + Intergenic
1124236224 15:27991525-27991547 TTAGAGAAACAGAAAGATCAGGG + Intronic
1131460468 15:92614176-92614198 TTATAGAAAAGGAAGGATCTGGG + Intergenic
1132704018 16:1234007-1234029 CTACAGTAACAGAAGGATCCGGG + Intergenic
1132707503 16:1252413-1252435 CTACAGTAACAGAAGGATCCGGG - Intergenic
1136514500 16:30759810-30759832 CTTCAGAAGCAGACAGATCTGGG + Exonic
1140739988 16:77932917-77932939 CTACAGAAACAGAGGGACATTGG + Intronic
1147535826 17:41322877-41322899 CTTCAGAAACAGACAGATCTGGG - Intergenic
1148481122 17:47960124-47960146 TTATAGAAAGTGACAGATCTAGG - Intergenic
1155231538 18:23779471-23779493 TTAGAGAAAGAGAGGGCTCTGGG + Intronic
1155572166 18:27206692-27206714 TTATAGAATCAGAAGGATCTTGG + Intergenic
1157904272 18:51554328-51554350 TTACAAAATCAAACGCATCTTGG - Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1159272501 18:66170464-66170486 GTGCAGAAACAAATGGATCTTGG - Intergenic
1160985252 19:1835684-1835706 TCCCAGAAACAGACTGACCTGGG - Intronic
1164550479 19:29207110-29207132 TGACAGAAACAGTAGTATCTAGG - Exonic
1164817000 19:31211847-31211869 TGACAGCAACAGAAGGATCAAGG + Intergenic
1167160271 19:47763061-47763083 CTACAGAAACAGCCGGAAGTTGG + Intergenic
1168470738 19:56638673-56638695 TGACAGAAAGAGACGAATCAAGG - Intergenic
926577163 2:14595037-14595059 TTACAGAAACTGTGGGCTCTAGG - Intergenic
928400656 2:30976371-30976393 TTAGAAAAACAGAAGGATCCTGG - Intronic
933184050 2:79259367-79259389 TTACAGAAACCGAGTGAGCTAGG + Intronic
934105859 2:88693864-88693886 CCACAGAAACAGACAGAGCTGGG - Intronic
935014635 2:99168993-99169015 TTAAAGAGACAGATGGAGCTTGG - Intronic
935038633 2:99404189-99404211 AGACAGAAACACACTGATCTGGG - Intronic
945982127 2:216320971-216320993 TTAAAGAAAAAGAGGCATCTGGG - Intronic
946056707 2:216909369-216909391 TTACAGATCCAGAGGGATCATGG - Intergenic
946797209 2:223368177-223368199 CTACAGAGTCAGACAGATCTGGG - Intergenic
947196963 2:227577737-227577759 TTACAGAAACAGTGGGTTCCTGG - Intergenic
1170997822 20:21381350-21381372 CTACATAAACTGACGGATATAGG - Intronic
1173265742 20:41478404-41478426 TAACAAAAGCAGACAGATCTTGG + Intronic
1179470210 21:41605372-41605394 TCCCAGAAAGAGACGGAGCTGGG + Intergenic
958725591 3:97902049-97902071 TTACTTAAACAAACAGATCTTGG + Intronic
967619540 3:191616312-191616334 TTAGAAAAACAGCTGGATCTCGG + Intergenic
967823533 3:193860376-193860398 TTACAGAAGCAGACGCATACTGG - Intergenic
967823625 3:193861097-193861119 TTACAGAAGCAGACGCATACTGG - Intergenic
971579846 4:28322263-28322285 ATATAGAAACAGATGGATATTGG + Intergenic
975283432 4:72589760-72589782 TTTGAGAAACAGTTGGATCTGGG + Intergenic
975391189 4:73819466-73819488 TTAAAGAAACAGATGGATATGGG + Intergenic
976048789 4:80985278-80985300 TTACAAATACAAACAGATCTTGG - Intergenic
979582923 4:122380652-122380674 ATACAGAAAGACACAGATCTGGG - Intronic
983223101 4:165061645-165061667 TAACATAACCAGAAGGATCTGGG + Intergenic
983384259 4:167037957-167037979 TCACAGAAACAGAAAGCTCTGGG + Intronic
986965928 5:13270930-13270952 TTTCAAAAAGAGATGGATCTAGG + Intergenic
992289067 5:75266186-75266208 TTTCAGAAACAGAAGTCTCTAGG + Intergenic
993849950 5:92995257-92995279 TTTAAGAAACAGACAGCTCTTGG + Intergenic
995075285 5:107976212-107976234 TTACAAAAACAGAAGAATCTAGG + Intronic
998345097 5:141455397-141455419 TTACAGAGACAGAGGGAGCGGGG + Intronic
998979987 5:147691359-147691381 TCACAGTAACAGAAGGAGCTGGG - Intronic
999503285 5:152168232-152168254 TTACACAGGCAGACGGATCTGGG - Intergenic
1002979763 6:2125007-2125029 TTCCAGAATCAGATGGATTTGGG + Intronic
1003584323 6:7372944-7372966 TTAAAGAAAGAAACAGATCTCGG - Intronic
1005572423 6:27158058-27158080 TGACAAAAACAGACGTTTCTGGG + Intergenic
1007800562 6:44388421-44388443 TGACAGAAAGAGACAGACCTTGG - Intronic
1007867873 6:44993350-44993372 CTACAGAAAAATAGGGATCTAGG + Intronic
1010512006 6:76731149-76731171 AGACAGAAACAAAAGGATCTGGG + Intergenic
1010563392 6:77379090-77379112 TTACAGAGACAGGCAGATCCAGG - Intergenic
1010932662 6:81820991-81821013 TTACAGAAAGAGACTGATGAAGG - Intergenic
1011196488 6:84785118-84785140 TTACAGAAACAAAGAGATTTGGG + Intergenic
1014109651 6:117606196-117606218 TTATATAAACAAAGGGATCTGGG + Intergenic
1020883178 7:13789166-13789188 TTAGAGAAATAGACTTATCTGGG + Intergenic
1021127194 7:16865055-16865077 TAACAGAATCAGACTCATCTTGG - Intronic
1022218428 7:28288592-28288614 CTATAGAAACAGACAGATCAAGG + Intergenic
1022512224 7:30946103-30946125 TTTCAGAAACATATGAATCTGGG - Intronic
1031908862 7:127492135-127492157 TTACAGAAACAGAAAAACCTAGG + Intergenic
1032695105 7:134329009-134329031 TTTGAGAATCAGACAGATCTGGG - Intergenic
1035973425 8:4279168-4279190 TTACAGAGACAGACGAAGCTTGG - Intronic
1036623724 8:10446884-10446906 GAACAGAAAAAAACGGATCTAGG - Intergenic
1037538977 8:19854158-19854180 TTGCAGAAAAAGAAGGAGCTGGG + Intergenic
1042985931 8:74582882-74582904 TTACAAAAACAGATGGAGGTGGG + Intergenic
1046922904 8:119752488-119752510 GTACAGAAACTGAGGGCTCTTGG - Intronic
1053319761 9:37086007-37086029 TGACAGAAACAAAATGATCTAGG + Intergenic
1053324279 9:37128849-37128871 TGACAGAAACAAAATGATCTTGG + Intronic
1058249361 9:102671861-102671883 TGAAAGAATCAGACGTATCTAGG + Intergenic
1058650988 9:107175714-107175736 TTACAGAAACAAAAGCAGCTAGG + Intergenic
1058866290 9:109165138-109165160 TTTCAGAAACAGACGGGCTTCGG + Intronic
1058897007 9:109409178-109409200 TTACAGAAACAGATGGGATTTGG + Intronic
1185728061 X:2438697-2438719 TTTCAGGAACAGAATGATCTAGG + Intronic
1186355611 X:8786558-8786580 TTACAGAACCAATCAGATCTTGG + Intergenic
1186405911 X:9302569-9302591 TTAGAGAAACATATGAATCTAGG - Intergenic
1191158549 X:57302186-57302208 TTACAGAATCACACAGACCTGGG + Intronic
1193581623 X:83271558-83271580 TTTCAGAGACAGACCGAACTTGG + Intergenic
1199246751 X:145613903-145613925 TAACAGAGGCAGACAGATCTGGG - Intergenic
1201257055 Y:12118279-12118301 TTACAGCATCAGATGGAACTAGG - Intergenic
1201553600 Y:15245146-15245168 TTACAGAAACAACAGTATCTTGG - Intergenic