ID: 1102366533

View in Genome Browser
Species Human (GRCh38)
Location 12:112341334-112341356
Sequence TCTGATCTTAAAAAAGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 293}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102366533_1102366536 6 Left 1102366533 12:112341334-112341356 CCTTCACCTTTTTTAAGATCAGA 0: 1
1: 0
2: 0
3: 23
4: 293
Right 1102366536 12:112341363-112341385 AACCTGTGCCTCTAAACCTGTGG 0: 1
1: 0
2: 1
3: 11
4: 151
1102366533_1102366539 21 Left 1102366533 12:112341334-112341356 CCTTCACCTTTTTTAAGATCAGA 0: 1
1: 0
2: 0
3: 23
4: 293
Right 1102366539 12:112341378-112341400 ACCTGTGGTTTGTAACTGTTTGG 0: 1
1: 0
2: 0
3: 9
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102366533 Original CRISPR TCTGATCTTAAAAAAGGTGA AGG (reversed) Intronic
902765163 1:18609496-18609518 TCTCATCTTTAAAAAGGAAATGG - Intergenic
902819614 1:18936005-18936027 CCTGATCTTGAAAGAGATGAGGG - Intronic
904154077 1:28467741-28467763 TCTTATGTTAAAATAAGTGATGG + Intronic
904346515 1:29875509-29875531 TCTAGTTTTAAAAAGGGTGAAGG + Intergenic
908663050 1:66458619-66458641 ACTGATCAAAAGAAAGGTGAAGG - Intergenic
909627877 1:77738947-77738969 TCTGATTTCAAGAAAGGTGGTGG - Intronic
909753739 1:79196523-79196545 TCAGACCTTTAAAAAGTTGAAGG - Intergenic
910422650 1:87083713-87083735 AATGATTTTTAAAAAGGTGATGG - Intronic
911273973 1:95838942-95838964 TCTGATTATAACAAAGGAGAAGG + Intergenic
912244852 1:107950691-107950713 TCTCATGTTACAGAAGGTGAAGG + Intronic
913292007 1:117282657-117282679 TCAGATTTTAAAAACTGTGAGGG + Intergenic
914349181 1:146825511-146825533 TCTGATTTTAAAAAATGAAATGG - Intergenic
916290174 1:163157210-163157232 TCTGCTCTTAAAAATGGTTGTGG + Intronic
917544784 1:175952607-175952629 TCTGATCTAAAAAAGGGATAAGG + Intronic
918497281 1:185155400-185155422 TCTGATCTTATATAATGAGAAGG + Intronic
919777556 1:201204184-201204206 TCTGATCTGAAAATAATTGATGG - Intronic
920346355 1:205308225-205308247 TCTGTTCTGAAAGAAGGAGAGGG + Exonic
920523231 1:206644990-206645012 TATGATCTTAAACAAAGTCAAGG - Intronic
920602683 1:207345523-207345545 TGTGATATTAAAAAAGCTCAGGG - Intronic
920816270 1:209335647-209335669 TCATGTCTTAAAAAAGTTGATGG + Intergenic
921687729 1:218109264-218109286 TGTGATGTTAAAAGAGTTGAAGG - Intergenic
921888008 1:220325721-220325743 CTGGATCTGAAAAAAGGTGAGGG - Intergenic
923513010 1:234669568-234669590 TCAAATCTCAAAAAAGGTCATGG + Intergenic
1064165805 10:12984963-12984985 TCTGAAGTTAAAAGTGGTGACGG + Intronic
1066291222 10:34016110-34016132 TCTCATCTTCAAAATGGTAATGG - Intergenic
1066543873 10:36478082-36478104 TATGATGTTAAAAAACTTGAAGG - Intergenic
1067464216 10:46484069-46484091 ACTGATATTGAAAAAGGTTAAGG + Intergenic
1067622978 10:47900585-47900607 ACTGATATTGAAAAAGGTTAAGG - Intergenic
1068785551 10:60968614-60968636 TCTGATTTTCAAAATGGGGAGGG + Intronic
1068796752 10:61091381-61091403 TCAGTTCTTAAATAAAGTGAGGG - Intergenic
1069132925 10:64728617-64728639 TCTGATCTGTAAAATGGGGATGG + Intergenic
1069415483 10:68196819-68196841 GCTGTTCTTAAAAAAGGAGGAGG - Intronic
1069441264 10:68430250-68430272 TCTGATCTGAAATAAGGTTTTGG - Intronic
1070214901 10:74367670-74367692 TCTGAGGTCAAAGAAGGTGATGG + Intronic
1071291435 10:84192131-84192153 TCTGAACCTAAAACAGCTGAAGG + Intergenic
1071528636 10:86372933-86372955 TCTCATCTTAAACAAGGAGCAGG - Intergenic
1072244486 10:93530461-93530483 TCTCATCTGAAAAATGGTGCTGG - Intergenic
1073874800 10:107910088-107910110 CCTGATCATAAAAAAGATGTAGG + Intergenic
1074715970 10:116218899-116218921 TCTAATATGATAAAAGGTGAAGG - Intronic
1075478157 10:122754574-122754596 TCTGATTTTAAAACAAATGAAGG + Intergenic
1075537183 10:123281302-123281324 ACGGATCCTAAAAACGGTGATGG + Intergenic
1077781105 11:5330686-5330708 TCTGATCCTTAAGAAGGTCATGG - Intronic
1077925342 11:6676708-6676730 TCTGATTTGAAAATAGGTAAAGG + Intergenic
1078122584 11:8524439-8524461 TCTGATTTTTAAACAGGTAAAGG + Intronic
1078985930 11:16597417-16597439 TCTAATTTTAAAAATGGGGATGG - Intronic
1079917801 11:26392455-26392477 TCAGATCTAAAAAAAGGTACAGG - Intronic
1081847247 11:46249558-46249580 TCTGTTATTTAAAAAGGGGATGG - Intergenic
1081931153 11:46872355-46872377 TCTGATCCAAAAGAAGGGGAAGG - Intronic
1082925856 11:58546506-58546528 TCTGAGATTGAAAAAGGGGATGG - Intronic
1084337133 11:68465507-68465529 TCTGAAGTTACAAAAGGTCATGG + Intronic
1084394909 11:68903333-68903355 GCTGGTCTGAAAAATGGTGATGG - Intronic
1085623977 11:78057953-78057975 TCTATTTTTAAAAAAGGTGGGGG - Intronic
1086110371 11:83192690-83192712 TGTAATATTACAAAAGGTGATGG + Intergenic
1086196603 11:84147840-84147862 TGTCATCTTTAAAAAGGTGGGGG + Intronic
1086239186 11:84669022-84669044 TCTGGTCTTGAGAAATGTGATGG + Intronic
1087041995 11:93810211-93810233 TCTGATCCTAAAAATAGTAAAGG + Intronic
1087591248 11:100190916-100190938 TCTTATATTCAAAAAGGTTAAGG - Intronic
1088510126 11:110565536-110565558 TCTGAGGTTAAGAAAGATGAAGG - Intergenic
1089011896 11:115138260-115138282 TCAGATTTTAAAACATGTGAGGG + Intergenic
1089765026 11:120756966-120756988 TCTGATCTTGAAGGAGGTGAAGG + Intronic
1093284882 12:17246760-17246782 CATGATCTTCAAAAAGGAGAAGG + Intergenic
1094075365 12:26466692-26466714 TCTCATCTATAAAAATGTGATGG - Intronic
1094215606 12:27938893-27938915 GCTGATTTTAAAAAGGATGAAGG + Intergenic
1094262302 12:28515005-28515027 TCTTTTTTTAAAAAAGTTGAGGG - Intronic
1094266069 12:28561553-28561575 TGTGATACTAAAAAATGTGATGG - Intronic
1096668770 12:53185216-53185238 CCTGGTCTTAAAAGAGTTGAAGG - Intronic
1096814097 12:54190864-54190886 TCTGACCAAAAATAAGGTGAAGG + Intergenic
1098429584 12:70405306-70405328 TCTGATTTAAAAAAAGGCTAAGG + Intronic
1099425299 12:82516564-82516586 TCTGTTGTTAAAAAATATGAGGG - Intergenic
1099664006 12:85602682-85602704 TCTTATAGTAAAAAAGCTGAGGG + Intergenic
1101074811 12:101117841-101117863 CCTCATCTTACAGAAGGTGAAGG + Intronic
1102366533 12:112341334-112341356 TCTGATCTTAAAAAAGGTGAAGG - Intronic
1104096592 12:125563742-125563764 TCTTATCAGAAAAAAGGAGAGGG + Intronic
1105897997 13:24733681-24733703 TCTATTCTTAAAATGGGTGAAGG + Intergenic
1107067773 13:36234094-36234116 TCTGATTTTAAAAAAGGTTTTGG - Intronic
1108036781 13:46298312-46298334 TCTTCTCTTAAAAAATGTGGGGG + Intergenic
1109219109 13:59623495-59623517 TCTAATATTAACAAAGGTGGTGG - Intergenic
1110714539 13:78686053-78686075 GCTGATGAGAAAAAAGGTGAGGG + Intergenic
1115119245 14:29920354-29920376 TTTCACCTTAAACAAGGTGATGG + Intronic
1115507435 14:34105879-34105901 TCTGATCTTAAATAAGAAGTGGG - Intronic
1115513838 14:34165651-34165673 TCTTTTCTGAAACAAGGTGAAGG + Intronic
1116431389 14:44849085-44849107 TCTGATGATCTAAAAGGTGAAGG - Intergenic
1117444333 14:55789113-55789135 TCCGATGTTAAAAAAGATGGAGG + Intergenic
1117681334 14:58205716-58205738 TTTGATGTTCAAAAATGTGATGG + Intronic
1120187804 14:81412699-81412721 TCTACTCTTAAAAATGGTTAAGG + Intronic
1121231340 14:92361010-92361032 TTTAATCTTTAAAAAGGAGAGGG + Intronic
1123715008 15:23021480-23021502 TCTGAACTTAAAAATGCTGAGGG - Intronic
1126423079 15:48496099-48496121 CCTGATCTAAAAACATGTGAAGG - Exonic
1127409603 15:58692633-58692655 TCTGATCTTCTTTAAGGTGAAGG + Intronic
1127755019 15:62083774-62083796 TCAGAGCTTAAAAAGGGAGAGGG + Intergenic
1128926707 15:71662915-71662937 TCTTTCCTTAAAAAAGATGAAGG + Intronic
1130640951 15:85674679-85674701 CCAGATCTTTAAAAAGGTAAAGG + Intronic
1130825732 15:87543967-87543989 ACTGATCTTAAAAAAGGTTTAGG + Intergenic
1132226761 15:100148839-100148861 ACAGAACTCAAAAAAGGTGACGG + Intronic
1134492625 16:14706793-14706815 TCTGACCTTTAAAAGGGTTAAGG - Intergenic
1134498006 16:14745915-14745937 TCTGACCTTTAAAAGGGTTAAGG - Intronic
1134582563 16:15383165-15383187 TCTGACCTTTAAAAGGGTTAAGG + Intergenic
1135186946 16:20323490-20323512 TCTGATCTGAAAAAAAGGGGGGG - Intronic
1135313886 16:21427229-21427251 TCTGACCTTTAAAAGGGTTAGGG + Intronic
1135366810 16:21859509-21859531 TCTGACCTTTAAAAGGGTTAGGG + Intronic
1135445005 16:22511649-22511671 TCTGACCTTTAAAAGGGTTAGGG - Intronic
1135559196 16:23462251-23462273 CCTGATCTTAACAAAGGGTATGG + Intergenic
1136310550 16:29405932-29405954 TCTGACCTTTAAAAGGGTTAAGG + Intergenic
1136323997 16:29507716-29507738 TCTGACCTTTAAAAGGGTTAGGG + Intergenic
1136438682 16:30247699-30247721 TCTGACCTTTAAAAGGGTTAGGG + Intronic
1138999075 16:62487039-62487061 TCTGATCTTGTAAAAGGATAAGG + Intergenic
1139843655 16:69903024-69903046 AATGATATCAAAAAAGGTGATGG + Intronic
1139858232 16:69998318-69998340 TCTGACCTTTAAAAGGGTTAAGG + Intergenic
1139984854 16:70890043-70890065 TCTGATTTTAAAAAATGAAATGG + Intronic
1140640278 16:76964227-76964249 TTCGATCTTAAAAATTGTGAAGG + Intergenic
1140771103 16:78204886-78204908 TCTGATCTTAGAAAATATGGTGG - Intronic
1143176826 17:4960227-4960249 CATGATCTTCAAAAAGGTAAAGG - Exonic
1143319518 17:6059213-6059235 TCTGACCTTACGAAAGGTCAAGG + Intronic
1144138774 17:12324758-12324780 CCTGATTTGCAAAAAGGTGAGGG + Intergenic
1144419725 17:15085181-15085203 TGTGATCTTTCAGAAGGTGAAGG + Intergenic
1149372465 17:56008701-56008723 TCTGCTCTTAAAACTGGTAAAGG + Intergenic
1150039261 17:61841370-61841392 TCTGATTTTAAAATAGGCAAAGG + Intronic
1151117197 17:71750491-71750513 TCTGATTTTAAATAATTTGAAGG - Intergenic
1151922132 17:77164762-77164784 GCTGAGCTTAAAATAGCTGAAGG + Intronic
1153781010 18:8495318-8495340 ACTGAACTGGAAAAAGGTGAGGG - Intergenic
1155186705 18:23393267-23393289 TATGCTCTTAAAAATGGTTAAGG - Intronic
1155410414 18:25538522-25538544 TCTGTACTTAAAAATGATGATGG + Intergenic
1155470676 18:26189158-26189180 TCTGATCAAAAAATGGGTGAAGG + Intronic
1155929757 18:31694085-31694107 ACTTATCTTAAAATAGGTCAAGG + Intergenic
1156249311 18:35336304-35336326 TCTGTCCTTAACAAAGATGAAGG + Exonic
1156848507 18:41698366-41698388 TCTGAACTTAAACAATGTAAGGG - Intergenic
1157138555 18:45082852-45082874 ACTGATCATAAAACAGGTGCTGG + Intergenic
1159026631 18:63188910-63188932 GCTGCTATTAAGAAAGGTGATGG - Intronic
1159246297 18:65809710-65809732 TCTGATGTTGATAAAGGAGATGG + Exonic
1159764055 18:72464984-72465006 TCTAATCTTAAAAAAAATTATGG - Intergenic
1160214791 18:76919072-76919094 TCTGGTTTTAAAAAATCTGATGG + Intronic
1165086478 19:33351608-33351630 TCTGATCACTGAAAAGGTGAAGG - Intergenic
1165397364 19:35572277-35572299 ACTGCTCTTAAAAATGCTGATGG + Intergenic
1166424698 19:42666962-42666984 TCTCATATTAAAAAAGAAGAAGG - Intronic
1167019709 19:46863897-46863919 CCTGGTCTTCAAAATGGTGAGGG + Intergenic
926506856 2:13726823-13726845 TCTTATCTTAGAAATGGTGAAGG + Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
931179821 2:59888144-59888166 TCTGATCTTTAAATCTGTGAAGG - Intergenic
931407282 2:61991256-61991278 TCTTATCTTAAAGAAGTTTATGG + Intronic
932288657 2:70556574-70556596 TCTTCTCTTATAAAAGGGGATGG - Intergenic
933178917 2:79208033-79208055 TCTTATCTTGAAATATGTGAGGG - Intronic
933306133 2:80600978-80601000 TCAGATCTTGAAAAAGCTCAAGG - Intronic
933355083 2:81199583-81199605 GCTGATCTTAGAAACAGTGAAGG - Intergenic
935639687 2:105279097-105279119 TCTTATCTTTAAAAATGAGAGGG - Intronic
936395587 2:112125806-112125828 TCTGACCTCATAAAATGTGATGG - Intergenic
938633905 2:133201829-133201851 TCTGCGCTTAAGAAAGTTGAAGG + Intronic
939935057 2:148280882-148280904 TCTGATCTTCAAATTGCTGAGGG - Intronic
940034348 2:149297801-149297823 TTTGATTTTATAAAAGGGGAGGG - Intergenic
940927692 2:159384783-159384805 TCTGTCCTTAAAAGACGTGAAGG + Intronic
941389655 2:164895954-164895976 TCTTAACTTTAAAAAGGTGGTGG - Intergenic
942237298 2:173923713-173923735 TCAGTGCTTAAAAAAGTTGAAGG - Intronic
943569082 2:189551242-189551264 TCTGATGTTGACAAAGGTGTAGG + Intergenic
944472094 2:200064715-200064737 TCTGATTTTAAAACAAGTGCTGG + Intergenic
944638846 2:201701474-201701496 TCTTATATTAAAGAAGTTGATGG - Exonic
944945055 2:204674436-204674458 TCTGATCTTCAAAAAGGATTGGG - Intronic
945158367 2:206862806-206862828 TCTGATCTTAAAAAATTTATTGG - Intergenic
945399337 2:209361088-209361110 TGTGATGTTAAACAAGGAGATGG + Intergenic
946685924 2:222269692-222269714 TATGGTATTAAAAATGGTGAAGG - Intronic
946989062 2:225307584-225307606 TCTCATCTAACAAAAGGAGATGG - Intergenic
947308664 2:228776283-228776305 TCTGACAATAAAATAGGTGATGG - Intergenic
948555271 2:238805830-238805852 TCTTATCTAAGAAAAGCTGAAGG + Intergenic
948745953 2:240094647-240094669 TCCTATCTTATAAAAAGTGATGG + Intergenic
1168780556 20:485732-485754 TCTTTTCTTAAAAAAGAGGAGGG + Intronic
1168964082 20:1888500-1888522 TCTCATCTGAAAATAGGTGAGGG - Intergenic
1169600183 20:7250025-7250047 TTTCATCTTAAAAAAAGTTAAGG + Intergenic
1169713154 20:8587193-8587215 TATGATCTCAAAAAGGGAGATGG + Intronic
1169743633 20:8920863-8920885 TCTCATCTTTAAAACAGTGATGG + Intronic
1170048201 20:12109892-12109914 TGTTATCTGAAAAGAGGTGATGG - Intergenic
1170884365 20:20327058-20327080 TCTGATTTTAAAAAAGATATTGG + Intronic
1171012112 20:21514487-21514509 TTGCATCTTAAAAAAGGTGGGGG + Intergenic
1171024631 20:21618323-21618345 TCTGATACTAAAAAAGTTGAGGG - Intergenic
1174175946 20:48644964-48644986 TTTAATTTTCAAAAAGGTGAAGG - Intronic
1174798386 20:53541491-53541513 TCTGATATAAAAATAGGTGGGGG + Intergenic
1174905128 20:54541994-54542016 TGTGATTTTAAATAGGGTGAGGG - Intronic
1175407207 20:58743027-58743049 TCTGCTTTTAAGAAAGCTGAGGG + Intergenic
1175692288 20:61074107-61074129 GCTGATGTTGAAAAAGGTGGGGG + Intergenic
1175846552 20:62062674-62062696 ACTGATCTTAAAACAGAAGATGG + Intronic
1178081887 21:29074495-29074517 TCTGATCTTAAAAGAGTAAAAGG - Intergenic
1178185447 21:30214471-30214493 TGTGATCTAAGAAAAAGTGATGG - Exonic
1183574043 22:38675725-38675747 TCTCATCTAAAACATGGTGATGG - Intergenic
1184699115 22:46157719-46157741 ACTGATATTTAACAAGGTGAGGG + Intronic
950808476 3:15628901-15628923 CCTGATTTAAAAAAAGGTGGGGG - Intronic
951820108 3:26798659-26798681 TCTGCTCCAAAATAAGGTGATGG - Intergenic
952262929 3:31758130-31758152 TCTGAGATTAAGAAGGGTGAGGG - Intronic
952856459 3:37774855-37774877 TCTGAAAATAAATAAGGTGAAGG - Intronic
954165411 3:48753219-48753241 TCTTATTTTAAAAAATGGGAGGG - Intronic
956513051 3:70015359-70015381 TCTGATTTTAAAAAAAGTACTGG + Intergenic
957163988 3:76647045-76647067 TCTGACCTTGAAAAAGGGGAGGG + Intronic
958120362 3:89279028-89279050 TCTGCTATTTAAAAATGTGAGGG - Intronic
958120682 3:89284433-89284455 ACTGATAAAAAAAAAGGTGATGG - Intronic
959853525 3:111119726-111119748 TCAGGTAGTAAAAAAGGTGATGG + Intronic
960285153 3:115819869-115819891 TCTGCTCCTACAGAAGGTGATGG - Intronic
963602379 3:147389777-147389799 TCTTATTTTTAAAAAGGTGTAGG - Intronic
964489400 3:157219048-157219070 TATGTTCATAAAGAAGGTGATGG - Intergenic
965370978 3:167862562-167862584 TCTCATCTTACAAAATGTCATGG - Intergenic
965597337 3:170421695-170421717 CCTCCTCTTAAAAAAGGTGGGGG - Intronic
966486147 3:180472600-180472622 TCTGATTTTAAAATGGGTAAAGG + Intergenic
966623667 3:181993543-181993565 TTTGATCCTAAAAGTGGTGAGGG - Intergenic
966629215 3:182053584-182053606 TATGATCATCAAAAATGTGAGGG - Intergenic
967459545 3:189729401-189729423 TCAGATCTTAAGACAGGTCATGG + Intronic
970452638 4:16186087-16186109 TCTAATCCTAAAAAGTGTGAAGG - Intronic
970880058 4:20918372-20918394 TCTGATATTAAAAGAAGTCATGG + Intronic
970951071 4:21756017-21756039 TCTGATTCTAAAAAAGGAGTTGG - Intronic
971029942 4:22625026-22625048 TCTGATTTTAAAGAAGGTTCTGG - Intergenic
971192306 4:24439187-24439209 TCTTCTCTTAAAGAAGGAGAAGG - Intergenic
971496390 4:27270375-27270397 TGTGATCTTAAAATATTTGAGGG - Intergenic
971517339 4:27504074-27504096 TCTGATCTTAAATATGAGGATGG - Intergenic
974077766 4:57183178-57183200 TCTGTGCTTAGAAAAGGTGCAGG + Intergenic
975454096 4:74569104-74569126 TCTGATTTAAAAATACGTGAAGG + Intergenic
975808057 4:78133914-78133936 TATGGTTTTAAGAAAGGTGAGGG + Intronic
976699156 4:87950434-87950456 TTTGATTTTAAAAAGGGTCAGGG + Intergenic
976842774 4:89451272-89451294 TTTGATCTTAAATAAGAGGAAGG + Intergenic
977313534 4:95415992-95416014 TCAGATCATATAAAACGTGATGG + Intronic
977339003 4:95733974-95733996 TTTAACCATAAAAAAGGTGAGGG - Intergenic
979118950 4:116868033-116868055 TCTGGTAATATAAAAGGTGAAGG - Intergenic
979947985 4:126858725-126858747 TCCTATTTTAAAAAAGGTGAGGG + Intergenic
980805118 4:137802657-137802679 TCTGATTTTAAAAAAGGAAGAGG - Intergenic
980966829 4:139529831-139529853 TCTAATTCTAAAAAAGGTGATGG - Intronic
981475802 4:145185465-145185487 TCTCACCTTACAAAAGGTGAAGG - Intergenic
981876132 4:149548274-149548296 TCTGATCTTAATATTTGTGAAGG - Intergenic
982010081 4:151098056-151098078 TCTACACTTAAAAAAGGTTAAGG - Intergenic
982706005 4:158710648-158710670 GCTGATCTTAAGAAAGCTCAGGG - Exonic
983670347 4:170230109-170230131 TCTGATTATTTAAAAGGTGAAGG - Intergenic
983700267 4:170583615-170583637 TGTGATCTAAGAAAAGGAGAAGG + Intergenic
983942186 4:173546281-173546303 ACTGATCTGAAAATAGGGGAAGG + Intergenic
984205561 4:176783786-176783808 TTTGATTTTGAAACAGGTGAAGG - Intronic
986007966 5:3684000-3684022 TCTGCACTTAGAAAATGTGAAGG - Intergenic
986840280 5:11688425-11688447 TATGATCCTAAAAATAGTGATGG + Intronic
987299990 5:16588723-16588745 TCTGATCTTAAATAACCTGTTGG - Intronic
987571366 5:19665593-19665615 TTTGATCTTAAAAATGTTGAAGG + Intronic
988264626 5:28931388-28931410 TTTGAACTTAAAAAATGTCAGGG + Intergenic
988329761 5:29820556-29820578 TCTAATATTAAAAAAGGACAAGG - Intergenic
989806624 5:45615768-45615790 TCTGATCAGAAGAAAGATGAAGG + Intronic
991128617 5:63095515-63095537 TCTCCTCTGAAAAAAGGAGAGGG - Intergenic
991156663 5:63444537-63444559 CCTGATGTTAAAAAAGATGAAGG - Intergenic
991694475 5:69257324-69257346 TCTGATTTTAAAAAAAGAAAAGG + Intronic
992944531 5:81796860-81796882 TCTTATCTTGAAAAAAGTAAAGG - Intergenic
993661863 5:90647433-90647455 TGTGATCTGAAAATATGTGATGG + Intronic
993770772 5:91923344-91923366 TCTGATTTTAAAAATGGCCAAGG + Intergenic
994817810 5:104606916-104606938 TCACATGTTAAAACAGGTGAAGG - Intergenic
995277215 5:110290494-110290516 ACTGAACTTAAAAAAAGTGAAGG - Intronic
995860802 5:116638452-116638474 GCTGATTTTAAAAAATGTGATGG + Intergenic
998828371 5:146130187-146130209 TTTTATTTTAAAGAAGGTGAGGG - Intronic
998969866 5:147579464-147579486 TCTGCTCTTAAAGAAGATGATGG + Intergenic
999342266 5:150782388-150782410 TCTGTTCTTAGAAGAGGTCAGGG - Intronic
1000244089 5:159434605-159434627 TTTGATTTGAAAAATGGTGAAGG + Intergenic
1001264047 5:170259436-170259458 TCTGAAGATAAAAATGGTGAGGG - Intronic
1003375707 6:5575250-5575272 GCTGATGTTGAACAAGGTGATGG - Intronic
1003534410 6:6963767-6963789 TCTTATTTTTAAAAAGGGGAGGG - Intergenic
1003807830 6:9746372-9746394 TCTGATACCTAAAAAGGTGAGGG + Intronic
1003855485 6:10269481-10269503 TTTAATGTTAGAAAAGGTGAAGG - Intergenic
1005189977 6:23210329-23210351 TTTGTTCTTAAAAAAGCTCACGG - Intergenic
1005212184 6:23479360-23479382 AATGATCTTTAAAAGGGTGAAGG + Intergenic
1007885836 6:45229075-45229097 TATGATTTTAAAAAATGTTAGGG - Intronic
1011851965 6:91640080-91640102 TCTAATTTTACAAAGGGTGATGG + Intergenic
1012663863 6:101941845-101941867 TCTAATCTTAAAAAAGGCACTGG - Intronic
1014165015 6:118214473-118214495 TCTGAACATACAAAATGTGATGG + Intronic
1014374645 6:120658253-120658275 TACAATCATAAAAAAGGTGAAGG + Intergenic
1014498625 6:122158481-122158503 TGGGATCCTAACAAAGGTGATGG - Intergenic
1014875340 6:126652167-126652189 TTTCATCTTAAAAAACATGAAGG - Intergenic
1016547808 6:145243918-145243940 TCAGCTATTAAAAAAGTTGAAGG - Intergenic
1017403227 6:154088603-154088625 TCTGATCTTAATTATGGTGGTGG + Intronic
1018975118 6:168558563-168558585 TCTCATCTTTAAAATGGTAATGG + Intronic
1021269335 7:18565956-18565978 TCTGATCCTATGAAATGTGATGG - Intronic
1021488722 7:21195052-21195074 TCTGCACTTAAAAAATGTCATGG - Intergenic
1022076793 7:26979214-26979236 TCTGATCTTGAAAAACATGTAGG - Intronic
1025239886 7:57262459-57262481 TCTATTCTTAAAACAGGTGAAGG - Intergenic
1027003887 7:74675205-74675227 TCTAGTCTTCAAAAAGGTCAAGG - Intronic
1027495811 7:78886853-78886875 TCTCATCTTGAATAAGATGAGGG + Intronic
1029005871 7:97208694-97208716 TCTGATTTAAAAATAGGTAAGGG - Intergenic
1029288909 7:99486681-99486703 TCTGATCTTGAATAAGGTTAAGG - Exonic
1029694407 7:102203465-102203487 CCTGATTTTGCAAAAGGTGAAGG + Intronic
1030518970 7:110573445-110573467 TTTGAGCTTAAAAAAGGTATAGG - Intergenic
1031938832 7:127765816-127765838 TATGATCTTATAATAGGTGTGGG - Intronic
1032120799 7:129154439-129154461 TCTGATGTTAAAAAATGTATAGG + Intronic
1032673645 7:134108303-134108325 TTTGATCTTAAAAAAGAACATGG + Intergenic
1033028886 7:137805836-137805858 ACTGAGGTTAAGAAAGGTGAAGG + Intronic
1034080411 7:148272102-148272124 TGTGATCTTTATAAAGGGGATGG + Intronic
1034628317 7:152511346-152511368 TCTGTCTCTAAAAAAGGTGAGGG - Intergenic
1034696329 7:153057259-153057281 AGTGATCATAAAAAAGATGAAGG + Intergenic
1035014314 7:155751541-155751563 TCTGCTCTTTCAAAAGGTCAAGG - Intronic
1035495476 7:159321670-159321692 TCTGATCTTCATTAAGGTGATGG - Intergenic
1038013089 8:23490295-23490317 CCTGATCGTGAAAAAGGTGCTGG - Intergenic
1038774475 8:30515948-30515970 TTTGAAGTTAAAAAAGGTAAGGG - Intronic
1042771304 8:72385650-72385672 TTTGACCTTACAAAAGGGGATGG + Intergenic
1042826786 8:72987552-72987574 TGTAATCTTAAAGTAGGTGAGGG + Intergenic
1045167553 8:99623831-99623853 TCTGATTTTCAAAAAGCTGAGGG - Intronic
1045830291 8:106451796-106451818 TCTTATTTTAAAAAAAGTCAAGG - Intronic
1046038963 8:108879006-108879028 TGTCAACCTAAAAAAGGTGAAGG + Intergenic
1047521961 8:125601770-125601792 TCTCATCTGCAAAATGGTGATGG + Intergenic
1048441247 8:134460728-134460750 TGTGATATTCAAGAAGGTGAGGG + Intergenic
1048972292 8:139651942-139651964 GCTGGTCTCAAAAATGGTGATGG - Intronic
1051417623 9:16859018-16859040 CCTGATTTAAAAATAGGTGAAGG + Intronic
1051764188 9:20503870-20503892 CCTGATTTTAAAATGGGTGAAGG + Intronic
1052181180 9:25530463-25530485 TCTGTCCTTAAAAATTGTGAAGG + Intergenic
1053395476 9:37769901-37769923 TCTGATGTTAAAACAGCTCACGG - Intronic
1055037607 9:71835165-71835187 TCTGATTTTAAAAAGGGCAAAGG + Intergenic
1055403939 9:75954527-75954549 TTTGATCTTAAAAGAAGTCAAGG - Intronic
1056983832 9:91342514-91342536 AGTGATCTTAAAAAAGTTAATGG - Intronic
1057244379 9:93441844-93441866 TCTGAAGTTAAAAAATGTAATGG + Intergenic
1057326387 9:94068371-94068393 TATAATCTTAAAAAATGTTAAGG - Intronic
1058252840 9:102723194-102723216 TCTGATTTAAAAATGGGTGAAGG + Intergenic
1058803204 9:108565140-108565162 TCTGACCTGAAAGAAGCTGAAGG + Intergenic
1060132683 9:121119793-121119815 TCTGCTCTTAAGAAAGATGAAGG - Intronic
1060714739 9:125914455-125914477 TCTGTTCTTAAAAGAATTGACGG + Intronic
1189059921 X:37742423-37742445 TCTGATTTTAAAAAGGGCAAAGG + Intronic
1189455329 X:41182638-41182660 TTTGATGTTTAAAAAGGTGAGGG + Intronic
1189524579 X:41806398-41806420 TCTGTTCTCTAAAAAGGAGATGG + Intronic
1191944420 X:66516089-66516111 TCTGATTTTTAGAAAGGTCATGG + Intergenic
1192882338 X:75299411-75299433 CCTGATATTAAAAAAGCTCAGGG + Intronic
1192902025 X:75509873-75509895 TCTGATTTTAAAAAATGTTATGG + Intronic
1193148700 X:78103639-78103661 TTTTATTTTAAAAAAGGTGGGGG + Intronic
1193471607 X:81910802-81910824 TCTTATTTCAAAAAATGTGAAGG + Intergenic
1198897305 X:141469834-141469856 TCTGAACTTAGAATTGGTGAAGG + Intergenic
1201249064 Y:12037591-12037613 TCTGATCCTAAAATAGAAGACGG + Intergenic
1201664913 Y:16440053-16440075 TCAGACCCTAAAAAAGGTAAAGG - Intergenic
1201730077 Y:17193185-17193207 ACTGATCTTCAACAAGGTGTAGG + Intergenic