ID: 1102366795

View in Genome Browser
Species Human (GRCh38)
Location 12:112344415-112344437
Sequence TTTAGTTTCTTATAGTGTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 343}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102366795 Original CRISPR TTTAGTTTCTTATAGTGTGG CGG (reversed) Intronic
901156603 1:7144106-7144128 TTTATTTTCTTATGTTCTGGAGG + Intronic
902728193 1:18351183-18351205 TTTAGTTTATTATTGTGTCAGGG - Intronic
903713315 1:25342956-25342978 TTTAGTTTTTTACAGGCTGGTGG + Exonic
904899432 1:33845087-33845109 TTTTGTTTTTTACAGTGGGGTGG + Intronic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
905531357 1:38681437-38681459 CTTAGTTTCTTGTCCTGTGGGGG + Intergenic
906373825 1:45277703-45277725 ATTAGTTTCTTAAATTGTGTAGG - Intronic
907834824 1:58098847-58098869 TTTATTTTCTTACAGTTTTGAGG - Intronic
908677568 1:66622592-66622614 TTTAGCTTCTTTTGGTGTTGTGG - Intronic
910060017 1:83079421-83079443 TTCATTTTCTCACAGTGTGGAGG - Intergenic
910381942 1:86636303-86636325 TTTAGTTTTTTAGAGACTGGGGG - Intergenic
910676047 1:89818049-89818071 TTTTATTTCCTATAGTCTGGGGG - Intronic
910688749 1:89944452-89944474 CTTAGTTTCATATAATGAGGAGG - Intergenic
911026015 1:93435809-93435831 TTTATTATCTTACAGTCTGGAGG + Intergenic
911828300 1:102516318-102516340 TTTAGTTATTTACAGTGTGTAGG - Intergenic
911881369 1:103242848-103242870 ATGGGTTTCTTAGAGTGTGGTGG - Intergenic
912181975 1:107230131-107230153 TGTAGTTTCTTATAATTTGCTGG + Intronic
915922042 1:159983218-159983240 TTTCTTTTCTTCTACTGTGGAGG + Intergenic
916525934 1:165609465-165609487 TTTACTTTTTTATAGAGAGGAGG - Intergenic
918322297 1:183375684-183375706 ATTAGTTTCTTATACCTTGGTGG + Intronic
918893868 1:190314697-190314719 TTTATTATCTTATAGTTTTGGGG - Intronic
919340703 1:196302764-196302786 TTTAGTCTTTTATAGTCTCGTGG - Intronic
919430349 1:197484609-197484631 TTTAGATTCTAATAGTGTTTAGG + Intergenic
919706834 1:200684603-200684625 TTTAGTTTCTTGTAGAGATGAGG - Intergenic
921720822 1:218469205-218469227 TTTAGTTTTTTGTAGAGTCGAGG - Intergenic
921781321 1:219168570-219168592 TTTACTTTCTTATAGATTGATGG - Intergenic
921920032 1:220657952-220657974 TTTAGATTTTTATATTGGGGTGG + Intronic
923249300 1:232165188-232165210 TTTATTTTCTCACAGTTTGGAGG - Intergenic
924010077 1:239654956-239654978 TTTATTTTCTTATAATATTGTGG - Intronic
924782369 1:247163452-247163474 TTTAGTTTCTGTGAGTCTGGTGG - Intronic
1063010403 10:2016276-2016298 CTTAGTTTATTATAATGCGGGGG - Intergenic
1064467075 10:15594396-15594418 TTGAGTTTCTTATTGAGTGAAGG + Intronic
1065038679 10:21667345-21667367 TTGAGGTTCTTAAACTGTGGGGG + Intronic
1065368306 10:24955771-24955793 TTTAATTTTTTATAGTGATGTGG - Intergenic
1066974334 10:42352472-42352494 TATAGTTTCTTATTTTATGGAGG - Intergenic
1067352638 10:45490512-45490534 TTTATTTTCTCATAGTCTGGAGG - Intronic
1067688126 10:48480022-48480044 TTTATTTTCTAATAGTGTCCTGG - Intronic
1069554443 10:69388265-69388287 TTTAATTTCTTATAGAGACGGGG - Intronic
1069654079 10:70074993-70075015 TTTATTTTCTTATAGTTCAGGGG + Intronic
1070963424 10:80515219-80515241 TTTATTTTCTCACAGTTTGGAGG + Intronic
1071386035 10:85122286-85122308 TTTACTTTTTTATAGAGTTGAGG - Intergenic
1072345534 10:94501502-94501524 TTAAGTTTCTTAAACTTTGGTGG + Intronic
1073298613 10:102456805-102456827 TTTATTTTCTTGTTGGGTGGAGG + Intergenic
1074130599 10:110570041-110570063 TTTTTTTTCTCATAGTCTGGAGG + Intronic
1074590577 10:114809061-114809083 TTTATTTTCTCATAGTCTGGAGG - Intergenic
1076240528 10:128902086-128902108 TTTTGTTTCTTATTGTAGGGTGG - Intergenic
1076409972 10:130241893-130241915 TTTCGTTTCTTTAAGAGTGGTGG + Intergenic
1076506464 10:130976804-130976826 TTTAGTTGCTTATGGTTTGGTGG + Intergenic
1076557903 10:131341415-131341437 TTGACTTTCTGATAGTGTAGAGG - Intergenic
1078974735 11:16460412-16460434 TTCATATTCTTATAGTGTGAAGG + Intronic
1080567644 11:33526373-33526395 TGTAGTTTCATTTAGTGTGCTGG - Intergenic
1080852824 11:36085605-36085627 TTTATTTTTTTATATTTTGGGGG + Intronic
1081055191 11:38401338-38401360 TTTACTTTTTTATAGTGTGATGG - Intergenic
1081093198 11:38898433-38898455 TTTTATTTCTAATAGTCTGGTGG - Intergenic
1082138442 11:48577654-48577676 TTTAGTTACTTAAACTGTAGAGG + Intergenic
1084877048 11:72140710-72140732 TTTAGTTTTTTGTAGAGTTGGGG - Intergenic
1085990139 11:81831772-81831794 TTTAGTTTGTTATTGTATAGTGG - Intergenic
1086138653 11:83469520-83469542 TTTAGTTGCTTATGGTGGGAGGG - Intronic
1086444746 11:86860679-86860701 TATAGTTTCTTATATTCAGGAGG + Intronic
1087422461 11:97947648-97947670 ATTAATTTCTTACAGTCTGGAGG + Intergenic
1087517996 11:99190586-99190608 TGTAGTTTTTTTTAGTGTAGAGG + Intronic
1088356958 11:108954304-108954326 TTTATTTTCTTATACTGGGATGG - Intergenic
1090057209 11:123433426-123433448 TTTAGTTTCTTTTACATTGGAGG - Intronic
1090175810 11:124648453-124648475 TTGAGTTTCTCACATTGTGGGGG + Intronic
1092574689 12:9767671-9767693 TTTATTTTATTTTAGTGTGGGGG - Intergenic
1094022495 12:25929228-25929250 TTTAGTTTTTATTAGTGTGTAGG + Intergenic
1094228509 12:28075519-28075541 TTTCTTTTCTTATAGTGTCTTGG - Intergenic
1094551907 12:31460640-31460662 TATATTCTCTTAAAGTGTGGAGG + Intronic
1095384005 12:41628752-41628774 ATTTGTTTCTCATAGTCTGGAGG - Intergenic
1095676557 12:44925887-44925909 TTTAGCTTCTCATATTTTGGAGG + Intergenic
1095809339 12:46355401-46355423 TATAGTTTCTTATAGTATAGTGG - Intergenic
1096726916 12:53571688-53571710 TGTAGTTTCTTTTGTTGTGGTGG - Intronic
1097203282 12:57298175-57298197 TTTAATTTCTTTTGTTGTGGTGG - Intronic
1098947068 12:76600921-76600943 TTTATTTTCTCACAGTCTGGAGG + Intergenic
1099082300 12:78200549-78200571 TTTAGTACCTTATATTCTGGAGG + Exonic
1099498293 12:83379239-83379261 TTTAGTTAATTATATTTTGGGGG + Intergenic
1099614939 12:84922128-84922150 GTTACTTTCTTCTAGTGTAGTGG - Intergenic
1100295908 12:93260713-93260735 TTTGGTTTCTTGGAGGGTGGGGG + Intergenic
1101155297 12:101922230-101922252 TTATATTTCTTATAGTGTTGTGG - Exonic
1101309325 12:103561961-103561983 TTTATTACCTTACAGTGTGGTGG + Intergenic
1101707673 12:107235584-107235606 TTTTGTTTTTTATAGAGTTGAGG - Intergenic
1102366795 12:112344415-112344437 TTTAGTTTCTTATAGTGTGGCGG - Intronic
1103975551 12:124700467-124700489 TTTTGTTTTTTGTAGAGTGGAGG + Intergenic
1104025116 12:125020256-125020278 TTTCATTTCTTACAGTTTGGAGG + Intronic
1104124007 12:125828028-125828050 TTTATTTTCTTATTGTAGGGTGG - Intergenic
1105229943 13:18484262-18484284 TATAGTTTCTTATTTTATGGAGG - Intergenic
1106165684 13:27243995-27244017 TTTAATTTCTTATAGCGAGGGGG - Intergenic
1106561552 13:30850922-30850944 TTAAGTTTCTTATAGTTTCTGGG + Intergenic
1106836170 13:33637328-33637350 TTTTGTTTCCTGTAATGTGGTGG - Intergenic
1108208363 13:48113770-48113792 TTTAGTTTCTTGTAGAGATGAGG - Intergenic
1108997328 13:56750553-56750575 TTTAGTTTCTGATAGTCTTAGGG + Intergenic
1109251422 13:60025068-60025090 TTTGCTTTTTGATAGTGTGGTGG + Intronic
1110409590 13:75189536-75189558 TTTATTTTCTCACAGTCTGGAGG - Intergenic
1110435511 13:75473988-75474010 TTTAGTGTCTTTAAGTATGGCGG - Intronic
1111120080 13:83836323-83836345 TTTAGTTGCTTATACTCTTGAGG - Intergenic
1114014198 14:18411078-18411100 TATAGTTTCTTATTTTATGGAGG - Intergenic
1114895188 14:26980573-26980595 TTTAATTTCTTGTAGAGTTGGGG - Intergenic
1114993993 14:28323906-28323928 TTCAGTTTCTGATAGTTTGCAGG + Intergenic
1114998784 14:28394616-28394638 TTTATTTTCTTATAATGTCTTGG + Intergenic
1115174303 14:30544656-30544678 TTTATTTTCTTATAGTCTGGAGG - Intergenic
1115814239 14:37145709-37145731 TTGAGTTGCTTACAGTTTGGAGG - Intronic
1116375469 14:44193779-44193801 TTTAATTTATGATTGTGTGGAGG - Intergenic
1116962206 14:50978072-50978094 TTTTCTTTCTTAAAGTGTAGAGG + Intronic
1118031859 14:61825876-61825898 AATAGTGGCTTATAGTGTGGTGG + Intergenic
1118074422 14:62282775-62282797 TTTATTTTCTCACAGTCTGGAGG - Intergenic
1118783003 14:69022525-69022547 TTCAGTTTATTCTGGTGTGGGGG + Intergenic
1118927428 14:70205586-70205608 TTTTGTTTTTTATAGTGATGGGG - Intergenic
1119208370 14:72811495-72811517 TTTATTTTATCATAGTCTGGAGG - Intronic
1120310359 14:82819024-82819046 TTTTCTATCTTATAGTGTTGAGG - Intergenic
1120391612 14:83915740-83915762 TTTTGTTTTTTTCAGTGTGGTGG - Intergenic
1120634063 14:86929422-86929444 TTTATTTTCTCAGAGTCTGGAGG + Intergenic
1120897681 14:89548820-89548842 TTCAGTTTTTTATAATGTGCCGG + Intronic
1123970717 15:25505566-25505588 TCTAGTATCTTCTAGTGTAGAGG + Intergenic
1124092557 15:26620002-26620024 TTTAGTTTTTTTGGGTGTGGGGG + Intronic
1125014245 15:34915540-34915562 ATTAGATTCTTATAGTTTTGAGG - Intronic
1125080941 15:35672339-35672361 ATTAGTTTCTTAGAATTTGGTGG - Intergenic
1125526558 15:40379726-40379748 TTTATTTTTTTATTTTGTGGGGG + Intergenic
1125771432 15:42169285-42169307 GTTAGTTTCTTACATTCTGGTGG + Intronic
1125815591 15:42581336-42581358 TTGAGTTTCTCCTGGTGTGGTGG + Intronic
1126455153 15:48853232-48853254 TTTATTTTATTATATTTTGGTGG - Intronic
1127242464 15:57132141-57132163 TTTTGTTTGTTTTAGTGAGGGGG - Intronic
1127267841 15:57376072-57376094 TTAAGTTTCTGACAGTGAGGGGG + Intronic
1128999821 15:72322775-72322797 TTTAGTTTCTAAGTGTTTGGAGG + Intronic
1131016568 15:89062344-89062366 TTTCGTTTGTTTTTGTGTGGGGG + Intergenic
1137872004 16:51959255-51959277 TTTATTTTCTTGCAGTCTGGAGG - Intergenic
1138677029 16:58658841-58658863 TTCAACTTCTCATAGTGTGGTGG - Intergenic
1139345377 16:66299805-66299827 ATTTGTTTCTTACAGTCTGGAGG + Intergenic
1139656829 16:68392987-68393009 TTTAGTTTCTTACAGGTTAGAGG - Intronic
1140937344 16:79685852-79685874 TATAGTTGCTTATAGTGGGAGGG + Intergenic
1140987302 16:80170455-80170477 TTTAATTTATTATATTCTGGAGG + Intergenic
1141269467 16:82525721-82525743 TATAATTTCTTATAGTTGGGGGG + Intergenic
1143040196 17:4029326-4029348 TTTAGTTTCTTAATATTTGGGGG - Intronic
1143450436 17:7033441-7033463 ATTTATTTCTTATAGTATGGAGG + Intergenic
1143933439 17:10456546-10456568 TTTTGTTTTTTAGAGGGTGGTGG - Exonic
1145772861 17:27506028-27506050 TTTACATTCTTATGGTGTGTAGG - Intronic
1147654369 17:42080469-42080491 ATTAGTTTCTCATATTGAGGAGG - Intergenic
1149730340 17:58939158-58939180 TTTAGTTTGTTTTAGTGTCTGGG - Intronic
1149756024 17:59186564-59186586 TTTAGTTTTTTATAGGGATGGGG + Intronic
1150933042 17:69606026-69606048 TTTACTTTCTTATATTCTGAGGG + Intergenic
1153189942 18:2526710-2526732 ATTATTTTCTTACAGTCTGGAGG - Intergenic
1154523463 18:15255579-15255601 TATAGTTTCTTATTTTATGGAGG + Intergenic
1155329164 18:24697459-24697481 TTTAGTTTCCCATTGTGTAGGGG + Intergenic
1155626734 18:27843646-27843668 ATTAGCATCTTAGAGTGTGGAGG - Intergenic
1155886783 18:31217807-31217829 TGTAGTTTCGTTTAGTGTGCTGG - Intergenic
1156274287 18:35567958-35567980 TGTATTTTCTTACAGTCTGGAGG + Intergenic
1157872287 18:51241656-51241678 TTGAGCTTCCTATAGAGTGGTGG + Intergenic
1158310218 18:56150331-56150353 TTTACTATCTTATAGTCTGAAGG + Intergenic
1159647432 18:70935765-70935787 TTTATTCTCTTACAGTCTGGAGG - Intergenic
1161185187 19:2913384-2913406 TTTATTTTCCTATTGTGTCGAGG + Intronic
1162149610 19:8635579-8635601 TTTTGTTTCTTTTACTGTTGAGG + Intergenic
1163386795 19:17004858-17004880 TTTAGGTCGTTATATTGTGGGGG - Intronic
1163386850 19:17005151-17005173 TTTAGGTTGTTATATTGTAGAGG - Intronic
1164493671 19:28737581-28737603 TCTAGTTCCTTATAGTGGGAAGG - Intergenic
1165125099 19:33589155-33589177 TATATTTTTTTATAGTCTGGAGG + Intergenic
1167867746 19:52341979-52342001 TTTGGTTTTTTATAGAGTTGGGG + Intronic
925965253 2:9059543-9059565 TTTAGTTTATTTTAGAGTAGAGG - Intergenic
926408880 2:12581419-12581441 TTTATTCTCTTACAGTTTGGGGG + Intergenic
926562794 2:14435688-14435710 TTTAGTTTATTTTAATGTTGTGG + Intergenic
926862666 2:17325510-17325532 TTGAGTTTCTCTCAGTGTGGTGG - Intergenic
931002931 2:57809489-57809511 TTCAATTTCTTATAGGGTTGAGG + Intergenic
932507619 2:72251313-72251335 TTTAGATCATTATAATGTGGTGG - Intronic
933357960 2:81237901-81237923 TTAAGTTTCTTATAGTATTCAGG + Intergenic
935481943 2:103601192-103601214 TTCAGTTTCTCATAATGTGTTGG + Intergenic
936483460 2:112906747-112906769 TGTAGCTTCACATAGTGTGGTGG - Intergenic
936484717 2:112916182-112916204 TATAGCTTCACATAGTGTGGTGG + Intronic
936895495 2:117423071-117423093 TTTATTTTCTCACAGTCTGGAGG + Intergenic
937015562 2:118602242-118602264 TTTATTGTCTTATAGTTTGGGGG - Intergenic
937496163 2:122422196-122422218 TGTAATTTCTTATAATGTTGAGG + Intergenic
937708357 2:124948609-124948631 TTTATTTTCTTACAGTGAGAAGG - Intergenic
937861292 2:126713014-126713036 TTTATTTTCTTACACTGTTGTGG - Intergenic
938522764 2:132088449-132088471 TATAGTTTCTTATTTTATGGAGG + Intergenic
939293129 2:140220928-140220950 GTTAGTTTCTGCTAGTGTAGAGG + Intergenic
940094022 2:149953154-149953176 TTTATTTTCTTACAGTTCGGGGG + Intergenic
940095639 2:149970877-149970899 TGTAGTTTCTTTTACTGTGCAGG - Intergenic
940549767 2:155139261-155139283 TTTAGTCTATTATATTGTTGCGG - Intergenic
940608843 2:155964350-155964372 TTTAGTTTCTGAGAATTTGGAGG - Intergenic
940970920 2:159895822-159895844 TTTAGCTGCTTCTGGTGTGGTGG - Intronic
941697766 2:168571607-168571629 TTAAGTTTCCTATCATGTGGAGG - Intronic
944166749 2:196730803-196730825 TTTGGTTTCTTATGGTATGTTGG + Intronic
945360673 2:208892689-208892711 TTTATTCTCTTATAATCTGGAGG + Intergenic
946260780 2:218488959-218488981 TTTAGTTTTTTAAAGTTTGGGGG - Intronic
946520169 2:220456067-220456089 TTAGGTTTTTTATAGTCTGGGGG + Intergenic
946789614 2:223286805-223286827 TTTAATTTCTTTCAGTGTAGAGG - Intergenic
947216175 2:227752334-227752356 TTTATTTTCTCACAGTCTGGAGG + Intergenic
947532139 2:230916232-230916254 TTTAGATTAGTAGAGTGTGGTGG + Intronic
948437220 2:237961871-237961893 TTTATTTTCTCACAGTCTGGAGG - Intergenic
1168917529 20:1503113-1503135 CTTAGATTCTCATAGTGTGTAGG + Intergenic
1175363847 20:58437136-58437158 TTTATTTTTTTATAGAGTTGGGG + Intronic
1175387329 20:58605621-58605643 TTCAGTTTCTTATAGAGAGATGG + Intergenic
1176773929 21:13112608-13112630 TATAGTTTCTTATTTTATGGAGG - Intergenic
1176884898 21:14243911-14243933 CTGAGTTTCTTTTAGTGTGCTGG - Intergenic
1177085624 21:16699598-16699620 TTTAATTTCTTCTATTCTGGTGG + Intergenic
1177214334 21:18108901-18108923 TTTTGTATCATGTAGTGTGGTGG + Intronic
1177292530 21:19133349-19133371 TTTATTTTCTCCTAGGGTGGTGG + Intergenic
1177766459 21:25462977-25462999 TTTACTTTCTCACAGTTTGGAGG - Intergenic
1178247539 21:30968443-30968465 TTTAGTTTCTACTAATGGGGTGG - Intergenic
1178458976 21:32783836-32783858 TTTAATTTTTTATAGTGATGGGG - Intergenic
1179284898 21:39968770-39968792 TTTTCTTTTTTTTAGTGTGGTGG - Intergenic
1180438695 22:15341884-15341906 TATAGTTTCTTATTTTATGGAGG - Intergenic
949838941 3:8299687-8299709 TTTAGTTTCTTTAATTTTGGGGG + Intergenic
950691615 3:14662970-14662992 TTTGGTTTCTTATAGCTTGCAGG - Intronic
951650371 3:24945125-24945147 TTTAGTTTTTTATAGTCTTATGG + Intergenic
951934328 3:28004618-28004640 TTTATTTTCTTAATGTCTGGAGG - Intergenic
952802736 3:37311940-37311962 TTTATTTTTTTATACTGTGCTGG + Intronic
952886612 3:38016327-38016349 TTTATTTTCTCACAGTGTGGAGG - Intronic
953511671 3:43547391-43547413 TGTATTTTCTCATAGTCTGGAGG + Intronic
954159249 3:48708638-48708660 GTTAGTTTCTTACAATGTGGTGG - Intronic
954766029 3:52917523-52917545 TTTATTTTCTTACATTCTGGAGG - Intronic
955081901 3:55665604-55665626 TTTAGTTTCTGGTGGTTTGGTGG - Intronic
955579086 3:60399688-60399710 TTTTGTTTATTATAGTCTAGAGG - Intronic
955596845 3:60600435-60600457 ATTAGTTTCTTGCAGGGTGGAGG - Intronic
956339938 3:68211189-68211211 GTTAGTTTCATTCAGTGTGGGGG + Intronic
957523601 3:81352138-81352160 TTCAGTTTCTTTTGCTGTGGTGG - Intergenic
957869970 3:86078834-86078856 TTTAATGTATTACAGTGTGGGGG + Intergenic
957918868 3:86722625-86722647 TTTATTTTCTCAAAGTCTGGAGG - Intergenic
958488437 3:94742270-94742292 TATAGTTTCTTTTACTGTGCAGG + Intergenic
958713787 3:97753049-97753071 TTAAGTATCTTATATTCTGGTGG - Intergenic
959154984 3:102656189-102656211 TTTACTTTCTTATTTTGTGTGGG - Intergenic
959644727 3:108685235-108685257 CATAGTTTCTTATAGAATGGTGG - Intronic
960429970 3:117557319-117557341 ATTATTTTCTGATAGTGTAGTGG - Intergenic
961855831 3:129870254-129870276 TTTAGTTTCTTATTAACTGGAGG - Intronic
962148041 3:132861849-132861871 CTTATTATCTTATAGTGTAGCGG - Intergenic
964026822 3:152084006-152084028 TTTATTTTCAAATAGTGTGGGGG + Intergenic
964112016 3:153097453-153097475 TTTATTTTCTCACAGTCTGGAGG - Intergenic
964532589 3:157684375-157684397 TTTAGTTTCTTTTGTTGTTGTGG + Intergenic
964595039 3:158416455-158416477 TTTGGCTTCTCATAGTGTAGAGG - Intronic
965492854 3:169361172-169361194 TTTATGTTCTTGTAGTGCGGTGG - Intronic
969089028 4:4679125-4679147 TTTAGTTTTTTATAGAGAGAGGG - Intergenic
969210704 4:5685065-5685087 GTTAGTTGCTTACAGTGTGCAGG + Intronic
971243434 4:24908861-24908883 TATAGTTTATCATAGAGTGGTGG + Intronic
971769246 4:30875111-30875133 TTTATTTTCTCACAGTCTGGAGG + Intronic
971968517 4:33593036-33593058 TTTAGTCTCCTATATTTTGGTGG - Intergenic
972509374 4:39753215-39753237 TTTTATTTCTAATAGTGTTGGGG - Intronic
972651815 4:41025151-41025173 TTAAGTTCCTTATAGGGTTGTGG - Intronic
972712810 4:41615093-41615115 TTTAACTTCTAATAGTGTGGGGG - Intronic
973319108 4:48792040-48792062 TTTAGTTTGTTTTAGTATGGTGG - Intergenic
974094638 4:57350265-57350287 TTTATATTTTTATTGTGTGGTGG + Intergenic
975109023 4:70602451-70602473 TTTACTTTCTTTTAGTGTTTTGG - Intronic
975793898 4:77985014-77985036 TTAAGTTTCTCATAATTTGGTGG + Intergenic
975959629 4:79886430-79886452 TTTGATTTCTTTTTGTGTGGTGG - Intergenic
976651652 4:87441095-87441117 TTTACTTTCATATAGTGGGAGGG + Intronic
977192850 4:94022172-94022194 TTTAGTTGCTTTTAGTGGGTGGG - Intergenic
977473283 4:97470345-97470367 TTCTGTGTTTTATAGTGTGGGGG + Intronic
978354167 4:107853000-107853022 TTTATTTTCTTTTATTGTGAAGG + Intronic
979851713 4:125579536-125579558 TTTATTTTCTTACAGTCTGAAGG - Intergenic
980092877 4:128460472-128460494 TTTATTTTCTTCTAATTTGGGGG + Intergenic
980207432 4:129738525-129738547 GTCAGTTTCCTATAGTTTGGGGG - Intergenic
980244294 4:130218567-130218589 TTTTGTTGCTTGTAGTGTAGAGG + Intergenic
981070166 4:140526804-140526826 GTTGGTGTTTTATAGTGTGGGGG + Intronic
981291139 4:143076976-143076998 TTTATTATCTTAGAGTCTGGAGG - Intergenic
981881858 4:149623276-149623298 TTTAGTTTCATATATTGGGTTGG - Intergenic
982280516 4:153679788-153679810 ATTTGTTTCTTATAGTGAGCAGG + Intergenic
982529080 4:156515939-156515961 TTTATTTTATTTTAGTTTGGGGG + Intergenic
983123008 4:163911883-163911905 TTTATTTTCTTATAGTTCTGGGG - Intronic
983178429 4:164618570-164618592 TTTTGTTTGTGAAAGTGTGGAGG + Intergenic
983463843 4:168061416-168061438 TTAAGTATCTCATAGTGTGGAGG + Intergenic
985218989 4:187682704-187682726 TTCAGTTTCTTAAAGTGTTGGGG - Intergenic
986115366 5:4768548-4768570 TTTATTTTCTCCCAGTGTGGAGG - Intergenic
986973561 5:13367770-13367792 TTTAGTTTCTTCTAGTTTTCAGG - Intergenic
988290469 5:29277798-29277820 TGTAGTTTATTACAGTGTGTGGG - Intergenic
988404006 5:30800876-30800898 TTGAGTTTCTTGTAGTGTGGTGG - Intergenic
989115310 5:37946795-37946817 TTTTGTTTCTTGAAGTCTGGTGG + Intergenic
990079459 5:51895295-51895317 TTTATTTTCAAATAGTTTGGTGG + Intergenic
991440478 5:66642344-66642366 TTAAGTTTTTTATAATGTTGAGG - Intronic
992300347 5:75371773-75371795 TTTTTTTTCTTTTAGTTTGGGGG + Exonic
993815114 5:92534018-92534040 TTTAGTTTCTCTTATTTTGGAGG - Intergenic
993943652 5:94093344-94093366 TTTGTTTTCTTACAGTCTGGAGG + Intronic
994750183 5:103727821-103727843 TTTTGTTTCTTATTGTTTGTAGG - Intergenic
995004016 5:107169294-107169316 TTTTTTTTCTTTTGGTGTGGAGG - Intergenic
995234180 5:109807403-109807425 TTTATTATCTTATAGTTTTGGGG + Intronic
996012490 5:118496365-118496387 TTTTGTTCCTTGTAATGTGGAGG + Intergenic
996253736 5:121371975-121371997 TTTATTTTCTTATAGTATTCAGG - Intergenic
996312601 5:122123702-122123724 TTTAGTTTCTTCTATTCTGTTGG - Intergenic
996672156 5:126130739-126130761 TTTATTTGCATATAGTGTTGAGG - Intergenic
997363978 5:133313616-133313638 TTTATTTTATTTTGGTGTGGGGG + Intronic
997710756 5:136001905-136001927 TTGTGTTTCCTAGAGTGTGGGGG + Intergenic
998860007 5:146433366-146433388 TTTAGTTTGTTGTGGGGTGGGGG - Intergenic
999066083 5:148686859-148686881 TTTATTTTCTCAGAGTCTGGAGG - Intergenic
1001595831 5:172898198-172898220 TTTAGTTTCCTATTGTCTTGTGG - Intronic
1003243138 6:4361736-4361758 TTTATTTTCTTACAGTCTGGAGG + Intergenic
1004112532 6:12733394-12733416 TTTAGTTTCTTATAAATTGGGGG - Intronic
1005383736 6:25264506-25264528 TTAATTTTCTTACAGTCTGGAGG - Intergenic
1005499290 6:26416060-26416082 TATAGTTTCTTACAGTGTCCTGG - Intergenic
1006063554 6:31443439-31443461 TTGAGTTTCTTATAGTATTCTGG + Intergenic
1006690661 6:35881741-35881763 TTTTGTTTTATATAGTTTGGTGG - Intronic
1008175195 6:48260046-48260068 TTTATTTTCCTCTAGTGTTGGGG - Intergenic
1008748531 6:54703380-54703402 TTGCTTTTCTTAAAGTGTGGTGG + Intergenic
1009263702 6:61527897-61527919 TTTAGGTTAATAGAGTGTGGGGG - Intergenic
1009365043 6:62851462-62851484 TATTGTTTCTAATACTGTGGCGG + Intergenic
1009412746 6:63385048-63385070 TTTATTTTCTCATAGTCTGCAGG - Intergenic
1009549669 6:65071984-65072006 TTTATTATCTTATAGTCTGGAGG - Intronic
1010318779 6:74482688-74482710 TTTATTTTCTCACAGTCTGGAGG + Intergenic
1010531126 6:76968208-76968230 TTTATTTTCTTATAGCTTTGGGG - Intergenic
1010581178 6:77597495-77597517 TTTAGTATCTTATTATGTGTTGG - Intergenic
1012231473 6:96765413-96765435 CTCAATTTCTTATAGTCTGGAGG - Intergenic
1014069093 6:117160960-117160982 TTTAGTTTCTTGTAGAGCTGAGG + Intergenic
1014170865 6:118277696-118277718 TTTAGTCTCTCAGAGTGTGCAGG - Intronic
1015896412 6:138021334-138021356 TTTATTTTCTCATAGCCTGGAGG + Intergenic
1016660193 6:146569566-146569588 TTCAGTTTCTTTTTGTGAGGAGG - Intergenic
1016769845 6:147837118-147837140 ATTATTTTCTTGTATTGTGGTGG + Intergenic
1017206877 6:151812067-151812089 TTTAGTTTCTTATAGTTTTAAGG + Intronic
1017376786 6:153779808-153779830 TTTAGTATCTAATAGTCTGGAGG + Intergenic
1017642733 6:156510080-156510102 ATTTGTTTCTTTCAGTGTGGAGG - Intergenic
1018705154 6:166458760-166458782 TTTATTTTCTCACAGTCTGGAGG - Intronic
1022664420 7:32397580-32397602 TGTATTTTCATATAGTTTGGAGG - Intergenic
1024288685 7:47783775-47783797 TTTATTCTCTTGTAGTCTGGAGG - Intronic
1024494782 7:50033108-50033130 TTTAGCTACTTATAGTTTGCAGG + Intronic
1027376977 7:77561091-77561113 TTTTGTTTTTTATAGAGTTGAGG + Intronic
1027488864 7:78797242-78797264 TATAGTTTTATATATTGTGGGGG - Intronic
1027733263 7:81902687-81902709 TATAGTTTCGTTTAGTGTGCTGG + Intergenic
1027887964 7:83933705-83933727 TTTATTTTCTTGTAGTGGAGAGG + Intergenic
1027955933 7:84879997-84880019 TATAGTTCGTTATAGTGTGTAGG - Intergenic
1027998349 7:85456767-85456789 TTAAGTTTCTTATCTTTTGGGGG + Intergenic
1028567631 7:92249867-92249889 TTTAGTTTATTCGCGTGTGGGGG - Intronic
1029011588 7:97267648-97267670 CTGAGTTTCTTATAGTGGAGAGG - Intergenic
1030334252 7:108307389-108307411 TTTTGTTTCTTGTAGCATGGTGG - Intronic
1030508411 7:110453809-110453831 TTTAATTTCTCACAGTCTGGAGG + Intergenic
1030703429 7:112666808-112666830 TCTAGGTTCTTATTGGGTGGAGG + Intergenic
1030873899 7:114790007-114790029 TTTAGTTTCTTATTGGCTGTTGG + Intergenic
1034647352 7:152660291-152660313 TTTTTTTTCTTTTAATGTGGCGG - Intronic
1036187682 8:6638439-6638461 ATTAATTTTTTATAGTATGGTGG - Intronic
1037091131 8:14920166-14920188 TTTAGCTTCTGACACTGTGGAGG + Intronic
1038220263 8:25600369-25600391 CTTTGTGTGTTATAGTGTGGGGG + Intergenic
1038272520 8:26087120-26087142 CTTATTTTCTCATAGTCTGGAGG + Intergenic
1040970310 8:53128904-53128926 TTTAATTTCTTATACTCTTGTGG - Intergenic
1041867269 8:62590023-62590045 TTTAGTTTGTTATACTGAAGTGG + Intronic
1042197145 8:66240688-66240710 TTTATTTTCTCACAGTCTGGAGG - Intergenic
1042256564 8:66810216-66810238 TTTTGTTTTTTTTGGTGTGGGGG - Intronic
1043143275 8:76618058-76618080 TTTAGTTTCTTTTAGAGATGGGG - Intergenic
1043291108 8:78602435-78602457 TTTAGTTTTCCATACTGTGGTGG + Exonic
1043638154 8:82412665-82412687 TTTATTTTCTCACAGTCTGGAGG - Intergenic
1044839511 8:96325963-96325985 TGAAGTTTCTTCTTGTGTGGAGG - Intronic
1045610552 8:103836183-103836205 TTTCATTTCTTATACTGTGACGG - Intronic
1045925507 8:107576017-107576039 TATAGTTTCTTATATTCAGGGGG + Intergenic
1046963681 8:120138565-120138587 TTTAGTTCCTATTAGTTTGGTGG - Intronic
1047945508 8:129874340-129874362 ACTAATTTCTTATAGGGTGGAGG + Intronic
1047949634 8:129921271-129921293 TTCAGTTTTTAATAGTGTAGAGG - Intronic
1048461346 8:134623992-134624014 AGTAGTTTCTTAGAGTGTAGTGG - Intronic
1049984018 9:931534-931556 TTTATTTTCTTATAGTCTGGAGG + Intronic
1052108561 9:24549951-24549973 TTTAGTTTTTGACAGTGTGTTGG - Intergenic
1052136242 9:24914319-24914341 TTTTGTTTCTTTTAGTAAGGTGG - Intergenic
1052300830 9:26950530-26950552 TTTTGCTTATTCTAGTGTGGAGG - Intronic
1053701450 9:40695577-40695599 TATAGTTTCTTATTTTATGGAGG + Intergenic
1054411514 9:64819032-64819054 TATAGTTTCTTATTTTATGGAGG + Intergenic
1055234929 9:74109398-74109420 TTTAATTTTTTATAGAGTTGAGG + Intergenic
1055668353 9:78574648-78574670 TTTAGTTTCTTTTGGTTTGACGG + Intergenic
1056791792 9:89630563-89630585 TTTATTTTCTCATAGTTTTGGGG + Intergenic
1058001609 9:99871512-99871534 ATCAGTTTCATAGAGTGTGGTGG - Intergenic
1058532579 9:105921411-105921433 TTGACTTTCTCACAGTGTGGTGG + Intergenic
1060669467 9:125456856-125456878 TTTACTGTCTTACAGTTTGGTGG - Intronic
1186133119 X:6491032-6491054 TTTGATTTCTTATAGGTTGGTGG + Intergenic
1187578048 X:20578817-20578839 TTTAGTTTTCTATGGTGTGTGGG + Intergenic
1187673882 X:21696693-21696715 TTTCTCTTCTTATAGGGTGGTGG + Intergenic
1188760753 X:34026775-34026797 TTTAATTTCTCACAGTCTGGAGG + Intergenic
1190031851 X:46981167-46981189 TTTACTATCTTATAGTTTAGTGG - Intronic
1190253440 X:48744922-48744944 TTTATTTTCTCACAGTCTGGAGG + Intergenic
1191678179 X:63813970-63813992 TTTAATTTCTTATACAGTGAAGG - Intergenic
1193401557 X:81051127-81051149 GCTAGTTTCTTCTAGTATGGTGG + Intergenic
1194516012 X:94854927-94854949 TGTATTTTCTTTTAGTGTGCTGG - Intergenic
1194645869 X:96457379-96457401 CTTATTCTCTTATAGTCTGGAGG - Intergenic
1194759123 X:97773309-97773331 TTTATTTTCTCACAGTCTGGAGG + Intergenic
1196867087 X:120079909-120079931 TGTAGGTTCTCATAGTGTAGTGG + Intergenic
1196876012 X:120156373-120156395 TGTAGGTTCTCATAGTGTAGTGG - Intergenic
1199062064 X:143368746-143368768 TTTTTTTTATTATAGGGTGGGGG - Intergenic
1199444024 X:147900357-147900379 CTTACTTTCTTGTAGAGTGGTGG + Intergenic
1200385449 X:155885773-155885795 TCTAGCTTCTGATAGTTTGGTGG - Intronic
1200848408 Y:7856273-7856295 TTAAGTTTTTTATTGTCTGGGGG - Intergenic
1201368632 Y:13235936-13235958 TTTAGTTTTTTATAGAGTTGAGG + Intergenic
1201693971 Y:16804116-16804138 TTTTTTTTCTTTTAGTATGGAGG + Intergenic