ID: 1102367016

View in Genome Browser
Species Human (GRCh38)
Location 12:112346321-112346343
Sequence TGGGAATCTGCATGTTTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 2, 2: 4, 3: 57, 4: 331}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102367009_1102367016 1 Left 1102367009 12:112346297-112346319 CCCTATGCCTTCTGCCAGAGATC 0: 1
1: 0
2: 1
3: 17
4: 168
Right 1102367016 12:112346321-112346343 TGGGAATCTGCATGTTTAACAGG 0: 1
1: 2
2: 4
3: 57
4: 331
1102367010_1102367016 0 Left 1102367010 12:112346298-112346320 CCTATGCCTTCTGCCAGAGATCC 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1102367016 12:112346321-112346343 TGGGAATCTGCATGTTTAACAGG 0: 1
1: 2
2: 4
3: 57
4: 331
1102367008_1102367016 2 Left 1102367008 12:112346296-112346318 CCCCTATGCCTTCTGCCAGAGAT 0: 1
1: 0
2: 2
3: 36
4: 417
Right 1102367016 12:112346321-112346343 TGGGAATCTGCATGTTTAACAGG 0: 1
1: 2
2: 4
3: 57
4: 331
1102367007_1102367016 3 Left 1102367007 12:112346295-112346317 CCCCCTATGCCTTCTGCCAGAGA 0: 1
1: 0
2: 0
3: 31
4: 281
Right 1102367016 12:112346321-112346343 TGGGAATCTGCATGTTTAACAGG 0: 1
1: 2
2: 4
3: 57
4: 331
1102367013_1102367016 -6 Left 1102367013 12:112346304-112346326 CCTTCTGCCAGAGATCCTGGGAA 0: 1
1: 0
2: 2
3: 24
4: 287
Right 1102367016 12:112346321-112346343 TGGGAATCTGCATGTTTAACAGG 0: 1
1: 2
2: 4
3: 57
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102367016 Original CRISPR TGGGAATCTGCATGTTTAAC AGG Intronic
900999141 1:6139111-6139133 TGGGGATGTTCATGTTTAATGGG + Intronic
901442294 1:9285747-9285769 TGGGAGTCTGTAGGTCTAACGGG - Intergenic
902135757 1:14303542-14303564 CGGGAATCTGCACTTTTAAGAGG + Intergenic
902836090 1:19047652-19047674 TGGGAATCTGTATTTGTAATAGG - Intergenic
903314790 1:22494503-22494525 TGAGAATCTACATATTTAACAGG + Intronic
903995304 1:27301676-27301698 TGAGGATCAGCATGTTTAAATGG + Intronic
904109275 1:28112722-28112744 CGGGAATCTGTATTTCTAACAGG + Intergenic
904587476 1:31588241-31588263 TGGCAGTCTGCATGTGTACCGGG - Intergenic
908157079 1:61364781-61364803 TGGAAATCTGAATTTTTCACAGG - Intronic
908672092 1:66559212-66559234 TGTGATTCTGCATTTCTAACAGG + Intronic
909337645 1:74494157-74494179 TGTGAGTGTGCATGTGTAACTGG - Intronic
909459815 1:75897284-75897306 CAAGAATTTGCATGTTTAACAGG + Intronic
909615465 1:77603665-77603687 TAGGAATCTACATTTTTAACAGG + Intronic
911427734 1:97741456-97741478 TGGGAATCCGCATTTTGAAAAGG + Intronic
911506234 1:98755873-98755895 TGGCAATCTGCATCTTTTAATGG + Intronic
911625594 1:100120551-100120573 TAAGAATCTGCATTTCTAACAGG - Intronic
912913982 1:113793155-113793177 TCAGAATCTGCATTTTTAAAAGG - Intronic
914339367 1:146745890-146745912 TGAGGATCTGCATGTTTAATAGG + Intergenic
914413543 1:147455944-147455966 TGGGAATCTGCATGTACTCCTGG - Intergenic
917581642 1:176384513-176384535 TGGGATTTTGCATGTTGACCAGG + Intergenic
917599989 1:176564179-176564201 TGAGATTCTGCATTTCTAACAGG + Intronic
918839766 1:189519269-189519291 TTGGTATCTCGATGTTTAACAGG + Intergenic
919436217 1:197564785-197564807 CAAGAATATGCATGTTTAACAGG + Intronic
919682487 1:200449737-200449759 CAGGAACCTGCATTTTTAACAGG + Intergenic
920009395 1:202856913-202856935 TGGTAATCTGTATGTTCAACAGG - Intergenic
920454838 1:206092796-206092818 TTGGAAACTGCATATTAAACTGG + Intronic
921155761 1:212437284-212437306 TGTGAATGTTCATGTTTCACTGG + Intronic
922168203 1:223133449-223133471 TGAGAGTCTGCATTTCTAACGGG + Intronic
922354764 1:224765228-224765250 CAGGAATCTGAATTTTTAACAGG + Intergenic
923417981 1:233783663-233783685 TGAGATTCTCCATGTTTAAAAGG + Intergenic
923550914 1:234962378-234962400 TGAGAGTCGGCATGTTTCACTGG + Intergenic
923746010 1:236700846-236700868 TGGGAATTCACATCTTTAACAGG - Intronic
924678839 1:246210057-246210079 TAGGAATATGCATTTTAAACAGG - Intronic
1062897487 10:1115550-1115572 TGGAAATCGACATTTTTAACTGG + Intronic
1063511552 10:6649320-6649342 TGGGATTCTGCATTTCCAACAGG + Intergenic
1063713636 10:8505759-8505781 TGGGAATTTTCTTGTTCAACTGG - Intergenic
1063820118 10:9825094-9825116 TGGGACTAGGCATGTTTAAATGG - Intergenic
1064285424 10:13986972-13986994 TGGGAATTTGCATTTCAAACAGG + Intronic
1066109037 10:32180130-32180152 TGGATATCTGCCTGTGTAACTGG - Intergenic
1069603636 10:69725941-69725963 TGGGAGTGTTCATGTTTAATGGG - Intergenic
1072236634 10:93459443-93459465 TGGGAATGACCATGTTTACCTGG - Intronic
1072635802 10:97177076-97177098 TGGGAATCCGCATTTTGTACCGG + Intronic
1074450589 10:113556308-113556330 TGGGAATCTGTATCTTTAATGGG - Intronic
1074585458 10:114764042-114764064 TGGGAATCTATATTTTTAAAAGG + Intergenic
1075307390 10:121380202-121380224 TGAGATTCTGCTTGTCTAACAGG - Intergenic
1078466926 11:11557192-11557214 TGGCAATCTTCCTGTTAAACAGG - Intronic
1079428931 11:20370072-20370094 TTGGAATCTGTATTTTTAGCAGG + Intronic
1079670805 11:23168588-23168610 TGGGACTTTGCAGGTTTAAAAGG + Intergenic
1084681934 11:70671453-70671475 TGGGAAGCTCCTTGTTTAAAAGG + Intronic
1085158697 11:74321045-74321067 AGGAAATCTGCATTTATAACAGG + Intergenic
1087586194 11:100125011-100125033 TGGAAATTTGCATTTCTAACAGG + Intronic
1088630551 11:111770189-111770211 CAGAAATCTGCATTTTTAACAGG - Intergenic
1089693366 11:120200242-120200264 TGGGACTCTGCATTTTAAACAGG - Intergenic
1090142097 11:124276257-124276279 TGGGAAACTTCATGGTTAGCAGG + Intergenic
1091545667 12:1500048-1500070 TGGGAATCTGCATCTTGACTTGG + Intergenic
1092760972 12:11810915-11810937 TGGGAATCTCACTGTTTCACAGG + Intronic
1092896243 12:13013403-13013425 AAGGAATCTGCATGATTAACAGG - Intergenic
1093101444 12:15034416-15034438 TGGAAATCTGTCTGTGTAACTGG + Intergenic
1095290357 12:40472546-40472568 AGGGAATTTGCATTTTTAATAGG + Intronic
1095434687 12:42174607-42174629 TGAGAATTTGCATTTTTAAGAGG - Intronic
1095840564 12:46687228-46687250 TAGGAATCTGCACATTCAACAGG + Intergenic
1096002349 12:48140368-48140390 CAGGAATATGCAGGTTTAACAGG + Intronic
1096446998 12:51702467-51702489 TATGAATCTGCATTTTTAAGAGG - Intronic
1097177999 12:57154453-57154475 TGGGAAGATGCATGTTAAATGGG - Intronic
1097359562 12:58643941-58643963 TGAGAATCTGCATTTTAAAAAGG - Intronic
1097678756 12:62629989-62630011 TGTGAAACTACATGTTTATCAGG - Intergenic
1098240492 12:68462430-68462452 TGGGAATCTGCCTGTTACCCAGG - Intergenic
1098384117 12:69900511-69900533 TGAGAATATGCATTTCTAACAGG + Intronic
1098950234 12:76633026-76633048 CCAGAATCTGCATTTTTAACAGG + Intergenic
1101224528 12:102674768-102674790 TGGGAATCTGAATTTTTATTTGG + Intergenic
1101500023 12:105294985-105295007 TAGGAATCTGAATATTGAACTGG + Intronic
1102367016 12:112346321-112346343 TGGGAATCTGCATGTTTAACAGG + Intronic
1103023791 12:117557451-117557473 TGAGAATCTGCTTTTTAAACAGG - Intronic
1104372017 12:128231829-128231851 TGGGAATCTACATGTTCACATGG + Intergenic
1104623160 12:130333340-130333362 TGGGAATCTGCATTTCTATCAGG + Intergenic
1104738480 12:131154658-131154680 TGGGATTCTGCATTTCTTACAGG + Intergenic
1104794305 12:131506472-131506494 TGGGACTCTGCATTTCTGACAGG - Intergenic
1104921999 12:132295390-132295412 TGGGACTCTGCCTGTTTTTCTGG - Intronic
1105641453 13:22269199-22269221 TTGGGCTCTGCATGTTTAATAGG + Intergenic
1106530694 13:30588517-30588539 TGGGAAACTGCATGGTTAAAAGG + Intronic
1107651049 13:42545652-42545674 TGGGAAACAGGCTGTTTAACTGG - Intergenic
1108190456 13:47933105-47933127 TAGGAATCTGTATGCTTAACAGG + Intergenic
1108705023 13:52977544-52977566 TGAGACTCTGCATTTTTAACTGG - Intergenic
1109575965 13:64259034-64259056 TGCAAATGTTCATGTTTAACTGG + Intergenic
1111132068 13:83990075-83990097 TGATAATCTGCATTTTCAACAGG + Intergenic
1111868270 13:93797206-93797228 TGAGATTCTGCATTTCTAACAGG + Intronic
1112555554 13:100465131-100465153 TGGGAATCTGTATTTTCACCAGG - Intronic
1115885042 14:37961917-37961939 TAGAAATCTACATTTTTAACCGG - Intronic
1115984518 14:39090047-39090069 GGGGAATTTGCAGGTTTAAATGG - Intronic
1116373896 14:44172668-44172690 TGGCTATCAGCATCTTTAACTGG + Intergenic
1117405348 14:55396818-55396840 TGGGAATCTGAGTTATTAACAGG - Intronic
1117696277 14:58367691-58367713 TGGACATGTTCATGTTTAACTGG - Intronic
1117823801 14:59678881-59678903 TGAGAATGTACATTTTTAACAGG + Intronic
1117850736 14:59966065-59966087 TGTCCATCTGCATGTTAAACAGG - Intronic
1118161737 14:63297614-63297636 TCAGAATCTGCATTTTTAACAGG + Intergenic
1118745903 14:68773070-68773092 TGGGAAGCTGCAGGGTTAACAGG - Intergenic
1119238502 14:73039560-73039582 TAGGAATCTACATTTTTAAGTGG - Intergenic
1119631840 14:76238874-76238896 TGAGAATTTGCATTTCTAACAGG + Intronic
1119972718 14:78990245-78990267 TGGGAAACTGCCTCTCTAACAGG + Intronic
1120252526 14:82076326-82076348 AGGTAATCTGCATGTTTGAAAGG - Intergenic
1120320989 14:82960515-82960537 TTTTAATCTGCATATTTAACTGG + Intergenic
1120472288 14:84940692-84940714 GGAGAATCTGCATTTCTAACAGG + Intergenic
1121345156 14:93130106-93130128 TGAGACTCTGCATGTCTAGCAGG + Intergenic
1121439048 14:93937260-93937282 TCAGAAGCTGCATTTTTAACAGG + Intronic
1124065635 15:26341118-26341140 TGGGATTCTGCATTTTCAATAGG + Intergenic
1124708480 15:31985110-31985132 TGGGAATCTGCATCTGCAAGAGG - Intergenic
1125451144 15:39808911-39808933 TGGGAACCTGCAACTGTAACAGG + Intronic
1125791879 15:42373263-42373285 TGGGACTCTGCATTTTGAATAGG - Intronic
1125791896 15:42373321-42373343 TGGGAATCTGTATTTTCAACTGG + Intronic
1126014846 15:44340618-44340640 TAAGAATTTGCATGTCTAACAGG - Intronic
1126124552 15:45283692-45283714 TGAGACTCTGCATGTCTAGCAGG - Intergenic
1126969613 15:54095627-54095649 TGGGAATCTGCGTTTTTACCTGG + Intronic
1127095411 15:55507948-55507970 TGGGAATTTGCATTTCTAACAGG - Intronic
1127428582 15:58880460-58880482 TGAGAATTTGCATTTCTAACAGG - Intronic
1127489248 15:59446749-59446771 AGGGAATCAGCATGTTGTACAGG - Intronic
1127549875 15:60026432-60026454 CAGGAACCTGCATTTTTAACAGG + Intronic
1128906918 15:71475537-71475559 TGAGAGTCTGCATTTTTAACAGG + Intronic
1129159554 15:73739739-73739761 TGGGCATCTTCATGTCTAAGAGG + Exonic
1129448371 15:75634701-75634723 TGAGAATTTGCATTTCTAACAGG - Intergenic
1129605741 15:77024194-77024216 TGAGAATCTGTATTTCTAACAGG + Intronic
1129782741 15:78284566-78284588 TGGGATTCTGCATTTCTAACAGG - Intronic
1129880287 15:79002090-79002112 TGAGAGTCTGCATTTCTAACAGG + Intronic
1130234633 15:82122945-82122967 TGAGAATCTGCATGACTCACAGG + Intergenic
1130535065 15:84778532-84778554 TGGGAATCTCCATGTTTGGGTGG + Intronic
1130538891 15:84807215-84807237 AGGGAATTTACATGTTAAACAGG - Intergenic
1131324379 15:91428367-91428389 TGTGAATATGCAAGTTTAAATGG + Intergenic
1131433683 15:92406306-92406328 TGAGAATTTGCATCTCTAACAGG + Intronic
1133307951 16:4822909-4822931 TGAGGATCTGCATCTTTAACAGG + Exonic
1133498005 16:6338443-6338465 TGGAAATCTGAATTTTTAATAGG + Intronic
1135220845 16:20612887-20612909 TGAGAATCTGCATGGTTGAGAGG + Intronic
1137069451 16:35888634-35888656 TGGAAGTCTGCCTGTATAACGGG - Intergenic
1137604644 16:49779442-49779464 TGAGATTCTGCATTTCTAACAGG - Intronic
1138009567 16:53365119-53365141 CAGGAATTTGCATGTCTAACAGG - Intergenic
1138893678 16:61176668-61176690 GGAAAATCTGCATGTTTAATAGG + Intergenic
1139231991 16:65292291-65292313 TAGGAATCTTCCAGTTTAACGGG - Intergenic
1139295483 16:65896888-65896910 TGAGAAGCAGCCTGTTTAACAGG - Intergenic
1139614436 16:68080371-68080393 TAGGACTCTGCATGGTTAATGGG + Intergenic
1139994908 16:70971459-70971481 TGAGGATCTGCATGTTTAATAGG - Intronic
1140966615 16:79972536-79972558 TGTGAATCTGCATTTCTAACAGG - Intergenic
1141066946 16:80921651-80921673 AGAGAATCTGCATCTCTAACAGG + Intergenic
1141807922 16:86354245-86354267 TGGGACTCTGCATTTCTATCAGG - Intergenic
1143417951 17:6763730-6763752 TGAGATTCTGCATTTCTAACAGG - Intronic
1144038820 17:11390478-11390500 TGGGAGTCTGCATTTCTCACTGG - Intronic
1144067889 17:11640798-11640820 CTGGAATGTGCATCTTTAACAGG - Intronic
1144461429 17:15461607-15461629 CAGGAATCTGCATCTCTAACAGG + Intronic
1145191612 17:20845128-20845150 AGTGAATCTGTATTTTTAACTGG - Intronic
1147471556 17:40666815-40666837 TGGCAATCTGCATTTTAAATAGG + Intergenic
1149336565 17:55642033-55642055 TGGGAAGCTTCAAGTTCAACAGG + Intergenic
1149455537 17:56785234-56785256 TGAGAGTTTGCATGTCTAACAGG + Intergenic
1149772769 17:59333818-59333840 CAGGAATCTGCATTTTTACCAGG + Intronic
1150849756 17:68693350-68693372 TGGGAATCTGCATTTGAATCAGG + Intergenic
1153517311 18:5916201-5916223 TGAGATTCTGCAGGTCTAACAGG - Intergenic
1156140008 18:34097375-34097397 TGGGGATATGAATTTTTAACAGG - Intronic
1156360802 18:36382933-36382955 TGGAAATCTGTCTGTGTAACTGG + Intronic
1156864351 18:41872495-41872517 TGAGAATTTGCATTTCTAACAGG + Intergenic
1157119981 18:44900184-44900206 TGAGAACCTGCATTTCTAACAGG - Intronic
1158876402 18:61738425-61738447 TAGGAATCTGTATTTTTAAAAGG + Intergenic
1159113805 18:64090390-64090412 TGTGTGTCTGCATGCTTAACAGG - Intergenic
1160362200 18:78293517-78293539 TGGGAGTCTGCATTTCTGACAGG - Intergenic
1160783547 19:889305-889327 TAGGTAGCTGCATGTATAACTGG - Intronic
1161504930 19:4638940-4638962 TTGGAATCTGCATTTTAAAATGG + Intergenic
1164409635 19:27990082-27990104 TGGGAATCTAAATTTTTAAGAGG + Intergenic
1164702387 19:30295123-30295145 TGAGATTCTGCATACTTAACAGG + Intronic
1167572922 19:50301206-50301228 TGGGAATCTGCACTTATAACGGG - Intronic
925800424 2:7593361-7593383 TGAGAATTTGCCTTTTTAACTGG + Intergenic
926580300 2:14627434-14627456 TGGGAATCTGCATTTTTATCAGG + Intergenic
928211056 2:29324016-29324038 TCAGAATCTGCATTTTTAAGAGG + Intronic
928483341 2:31705824-31705846 TGGGAATCTGAATATTTAACTGG + Intergenic
931287927 2:60848229-60848251 TGGAAATCTGTCTGTGTAACGGG - Intergenic
931936748 2:67206681-67206703 TGAGATTCTGCATTTCTAACAGG + Intergenic
933839749 2:86276815-86276837 TGAGATTCTGCATTTCTAACAGG - Intronic
934131427 2:88952810-88952832 TGGGAATCTCCATGTTTGGCTGG - Intergenic
934133885 2:88976169-88976191 TGGAGTTCTGCATGTTTAGCTGG + Intergenic
934138945 2:89026544-89026566 TGGAGTTCTGCATGTTTAGCTGG + Intergenic
934230301 2:90174016-90174038 TGGAGTTCTGCATGTTTAGCTGG - Intergenic
934907540 2:98218427-98218449 TAGGAATCTGTGTTTTTAACAGG + Intronic
935758453 2:106296698-106296720 TGAGAATTTGCATTTTGAACAGG + Intergenic
937301216 2:120843605-120843627 TGGGACTCTGCAGGTTCCACGGG + Intronic
940364069 2:152826505-152826527 GGGGGATCTGAATTTTTAACAGG + Intergenic
941601927 2:167553512-167553534 TGGGATTCTGCATGTTTTCTTGG - Intergenic
941658531 2:168170563-168170585 TGAGAATCTGCATTTCTAGCAGG + Intronic
942724989 2:178996453-178996475 TGGGAAGTTACATGTTTACCTGG - Intronic
943075844 2:183193599-183193621 TGGGAATCAGCATTTTTAGAAGG + Intergenic
944748101 2:202678533-202678555 TGGGAATCTCCATGTTTGAGTGG + Intronic
945281939 2:208043828-208043850 TTGGAAACTGAATGTATAACTGG - Intergenic
945588740 2:211701389-211701411 TGGGCATTTACATGTTTAATCGG - Intronic
945631418 2:212282732-212282754 TGGGAATTTGTATTTTTAAGTGG + Intronic
946217056 2:218192548-218192570 TGGGAACCTATATGATTAACAGG + Intergenic
946835232 2:223765906-223765928 TGAGAATCTGCACTTTTAACAGG + Intronic
947799939 2:232922765-232922787 TTGGAAACTGCATTTTTAAAAGG - Intronic
948064449 2:235066777-235066799 TTGGAAGCTGCATTTTTAGCAGG - Intergenic
1168875612 20:1170167-1170189 TGAGATTCTGCATGTGTAACAGG - Intronic
1169122876 20:3107808-3107830 TGGGGATCTGCATTTCTAACAGG - Exonic
1169907363 20:10617332-10617354 TGGGAATCTCCATTTTCAAAAGG + Intronic
1170283076 20:14673480-14673502 TGGGAATCTGCATTTTTACTAGG + Intronic
1170609712 20:17902565-17902587 TGAGAATGTGCATTTCTAACAGG - Intergenic
1171383842 20:24753614-24753636 TGGGATTCTGCATTTCTAACCGG - Intergenic
1172516582 20:35538481-35538503 TGGGATTCTGCATTTCTAACAGG + Intergenic
1173199145 20:40941566-40941588 CAGGAATTTGCATGTCTAACAGG - Intergenic
1173258929 20:41415836-41415858 TGAGAATCTGCTTTTTTAACAGG + Intronic
1173563146 20:44020647-44020669 TGAGAATCTGCATCTCTAACAGG - Intronic
1173749586 20:45466938-45466960 TGAGAATTTGCATTTCTAACAGG - Intergenic
1174332305 20:49830057-49830079 TGAGGATCTGCATCTTTAACAGG - Intronic
1174339257 20:49885901-49885923 TGGGAATCTGCAGATCTAACAGG - Intronic
1174511972 20:51060225-51060247 TGGGCATCTGCCTGGTGAACAGG + Intergenic
1176846883 21:13883735-13883757 AGGAAATCTGCTTGTATAACAGG - Intergenic
1178790439 21:35694708-35694730 CAGGAATGTGCAAGTTTAACAGG + Intronic
1180868030 22:19130828-19130850 TGGAAATCTGTCTGTGTAACTGG + Exonic
1182409418 22:30170506-30170528 GGGGAATTTACATTTTTAACAGG + Intronic
1182605928 22:31503525-31503547 GGTCAATCTACATGTTTAACTGG + Intronic
1182734167 22:32519206-32519228 TGCGATTCTGCATTTCTAACGGG + Intronic
1182919039 22:34062613-34062635 TGGGTATCTGCATTTTCAGCAGG + Intergenic
1185165452 22:49259566-49259588 TGGAATTGTGCATGATTAACTGG - Intergenic
949841190 3:8321852-8321874 TGGGAATCTGTATTTCTAACAGG - Intergenic
950158454 3:10741537-10741559 TGAGAATATGCATTTCTAACAGG + Intergenic
950888367 3:16380618-16380640 TGAGAATTTGCATTTCTAACAGG - Intronic
950900361 3:16492097-16492119 TAGGTATCTGCACGTTTAAGAGG + Intronic
951218698 3:20047261-20047283 TGGGTTTCGCCATGTTTAACAGG + Intronic
951612797 3:24510600-24510622 TAAGAGTCTGCATTTTTAACAGG - Intergenic
951624231 3:24642604-24642626 TGATAATCTGCATGTCTAACAGG + Intergenic
952156670 3:30650760-30650782 TGAGAATCTGCATTTATAACAGG - Intronic
953308482 3:41853211-41853233 TGAGAATTTGCATTTCTAACAGG + Intronic
953935157 3:47035219-47035241 TGAGACTCTGCATTTTTAACAGG + Intronic
954956826 3:54528772-54528794 TCTGAATTTGCATGTTTAAGGGG - Intronic
955488549 3:59459626-59459648 TGAGATTCTGCATTTCTAACAGG - Intergenic
955615597 3:60803674-60803696 TAGGAATCTGGATGATTAAAGGG - Intronic
955965284 3:64382781-64382803 TAGGAATCTGCATGTTCATCAGG + Intronic
956200775 3:66703204-66703226 TGAGATTCTGCATCTCTAACAGG + Intergenic
956203511 3:66732071-66732093 TCTGATTCTGCATGTTTAATTGG + Intergenic
956422973 3:69103814-69103836 TGGGAATCTGTATTTTAAACAGG - Intronic
958085879 3:88805768-88805790 TGGGGAGCTGCATGTTTTAAAGG + Intergenic
959249757 3:103926836-103926858 TGGTAATATTAATGTTTAACCGG + Intergenic
960100298 3:113735298-113735320 TGAGAATCTGAATTTTTAACTGG - Intronic
961628508 3:128279833-128279855 TGGGCAACTGCATGTTGAATAGG - Intronic
961632821 3:128313636-128313658 TTGGCATCTCCATTTTTAACAGG + Intronic
963138534 3:141929430-141929452 TCAGAATCTGCATTTTAAACAGG - Intergenic
963785780 3:149533085-149533107 TGTGAATATACATGTTTAACTGG - Intronic
964396731 3:156253745-156253767 TAAGAATCTGCATTTTTAACAGG - Intronic
965409231 3:168308889-168308911 TTTCAATCTGCATGTTTAATTGG - Intergenic
965515514 3:169617426-169617448 TGAGAGTCTGCATTTTTAACAGG + Intronic
965806009 3:172542618-172542640 TGAGAACCTGCATTTATAACAGG - Intergenic
966060873 3:175753711-175753733 TGGGAATCTGCATTTTCATAAGG + Intronic
966845438 3:184125477-184125499 TGGGCGTCTGCATTTCTAACAGG + Intergenic
969598423 4:8161742-8161764 TGAGAATCTGCCTGCTTCACTGG + Intergenic
970005576 4:11407778-11407800 TTAGAATCTGCATTTGTAACTGG - Intronic
970116465 4:12702232-12702254 TAGGACCCTGTATGTTTAACAGG - Intergenic
970551792 4:17189052-17189074 TGAAAATGTGCATTTTTAACAGG + Intergenic
972344344 4:38180274-38180296 TGAGATTCTGCATCTTTAAATGG + Intergenic
972420744 4:38883945-38883967 CAGGAATCTGAATTTTTAACAGG - Intronic
973796753 4:54434903-54434925 GGGGAATCTGCATTTTTAGGTGG + Intergenic
975119432 4:70712575-70712597 TAGAAATCTACATGTTTAAGAGG + Intronic
975579464 4:75893574-75893596 TAGCAACCTGCATGTTTACCAGG - Intronic
976109884 4:81660857-81660879 CAGGAATCTACATATTTAACAGG - Intronic
978945923 4:114495831-114495853 TGGGAATCAACATGTTTAGATGG + Intergenic
979533740 4:121796362-121796384 TGGAAATTTGCATTTTTAACTGG - Intergenic
979882944 4:125985992-125986014 TGGGAATCCGCATGTTTGGGTGG - Intergenic
981008365 4:139898988-139899010 AAGAAATCTGCATTTTTAACAGG - Intronic
981144732 4:141311314-141311336 AGGGAATCAGTATTTTTAACAGG - Intergenic
982190569 4:152850676-152850698 GAGCAATCTGCATTTTTAACAGG + Intronic
982420846 4:155195423-155195445 TGGGAATCTACATTATTGACAGG + Intergenic
982617378 4:157656645-157656667 TGGAAATATTGATGTTTAACTGG - Intergenic
982639790 4:157944222-157944244 TGGGAATCTGTATGTCAAAAGGG - Intergenic
984457805 4:179993098-179993120 TGGGTATCTTTATCTTTAACTGG - Intergenic
985055744 4:186034313-186034335 TGGGAATCTGTGTGTGTATCAGG - Intergenic
985055836 4:186034853-186034875 TGGGAATCTGAGTGTGTATCAGG - Intergenic
985055859 4:186034988-186035010 TGGGAATCTGTGTGTGTATCAGG - Intergenic
988977060 5:36526173-36526195 TGGGAATTTGTATCTTTAGCAGG - Intergenic
989341975 5:40386353-40386375 TGGGACTATGCATTTTTTACAGG + Intergenic
990734607 5:58846306-58846328 TCAGAATATGCATTTTTAACAGG - Intronic
991229816 5:64320035-64320057 TGAGAATTTGCATTTTTAATAGG - Intronic
991592228 5:68265140-68265162 TGGGATTCTGCATTTCCAACAGG - Intronic
991721220 5:69495386-69495408 TGGGATTCTGCCTTTCTAACAGG + Intronic
992103172 5:73426813-73426835 TGGAAATCTGCAGTTCTAACAGG - Intergenic
992597109 5:78358426-78358448 TGGGTGTCTGCATCTTCAACAGG + Intergenic
994269156 5:97756326-97756348 TGGTAACCTGGATGTTCAACTGG + Intergenic
996238511 5:121165322-121165344 TGAAATTCTGCATTTTTAACAGG - Intergenic
998187708 5:139995474-139995496 TGGGAACCTGCATATTTCTCAGG - Intronic
998244023 5:140479656-140479678 TGGGAATATACATGTATAACAGG - Intronic
998481039 5:142463175-142463197 TGGAAATCTGCCTTTTTAGCAGG + Intergenic
998967843 5:147559939-147559961 TCAGAATCTGCATGTTAAGCAGG - Intergenic
999527064 5:152418462-152418484 TGAGATTCTGCAAGTCTAACAGG - Intronic
1000629885 5:163580411-163580433 TTGAAAGCTGCATTTTTAACAGG + Intergenic
1000681239 5:164187627-164187649 TGAGAATTTGCATTTCTAACAGG - Intergenic
1000912274 5:167036805-167036827 TGAGAAGGTGAATGTTTAACAGG - Intergenic
1001716579 5:173821275-173821297 TGAGAATTTGCATTTCTAACAGG + Intergenic
1003638347 6:7855306-7855328 TGAGAATCTGCATTTCTAACAGG - Intronic
1003929542 6:10910580-10910602 TGGGAATCTGGCTGAGTAACTGG + Intronic
1004685920 6:17943581-17943603 TGAGAATGTGCATTTTTAACAGG + Intronic
1006178769 6:32140821-32140843 TGGAAATCTGTCTGTGTAACTGG + Intergenic
1006304237 6:33209260-33209282 TCAGAATCTGAATTTTTAACAGG + Intronic
1006904811 6:37526081-37526103 TGAGAATTTGCATTTTTAGCAGG - Intergenic
1007176395 6:39900692-39900714 TGAGATTCTGCATTTCTAACAGG + Intronic
1007349277 6:41256888-41256910 TGGAAATCTGTCTGTGTAACTGG - Intergenic
1007394964 6:41572405-41572427 GGGGACTCAGCATCTTTAACGGG - Intronic
1007623221 6:43227460-43227482 TCAGAACCTGCATTTTTAACAGG + Intronic
1007796245 6:44350278-44350300 TGGGAATCTGGAAGTGGAACTGG + Intronic
1007796267 6:44350461-44350483 TGAGAATCTGTATTTTTAACAGG + Intronic
1007820056 6:44554527-44554549 TGAGAATGTGCATTTCTAACAGG + Intergenic
1008937590 6:57008428-57008450 TGGAAATCTGTCTGTGTAACTGG + Intronic
1010907161 6:81504959-81504981 TGATAATCTCCATGTTTTACCGG - Intronic
1011054966 6:83194141-83194163 GGGGAATCTGCACTTTCAACAGG - Intronic
1011938424 6:92812098-92812120 TGAGATTCTGCATTTCTAACAGG + Intergenic
1012446518 6:99312530-99312552 TGGGAGTCTGAGGGTTTAACGGG - Intronic
1013167326 6:107605811-107605833 TGGGATTCTCCATGCTTAACAGG - Intronic
1013233983 6:108181109-108181131 TGGGAACCTGCATGTTCTGCTGG + Intronic
1013447915 6:110249983-110250005 TGAGAATTTTCATTTTTAACTGG + Intronic
1014437542 6:121437379-121437401 TGGGATTCAGCAAGTTTAAGAGG - Intronic
1015093816 6:129390269-129390291 TGAGAATCTGCATTTCTAATGGG + Intronic
1015210272 6:130689160-130689182 TTGAAATCTGCATGTTGAAGAGG - Intergenic
1015624848 6:135170203-135170225 TAAGAATATGCATTTTTAACAGG - Intergenic
1015700500 6:136031278-136031300 TGAGACTCTGCATTTTTAACAGG - Intronic
1017817936 6:158028496-158028518 CAGGAATCTGCATGTCTAACAGG + Intronic
1020350191 7:7210775-7210797 TGGGAATCTCCATGTTTGGGTGG + Intronic
1021429414 7:20543210-20543232 TGAGATGCTGCATTTTTAACAGG - Intergenic
1021763481 7:23924040-23924062 TGGGAATTTGCATTTTAAAAAGG - Intergenic
1022130050 7:27396747-27396769 TGAGAGTCTGCATGTCTAATGGG + Intergenic
1023125642 7:36951603-36951625 TGAGAATCTGCATTTCTAGCAGG + Intronic
1023725860 7:43142203-43142225 TCAGAATCTGCAGGTTTAATTGG - Intronic
1024047498 7:45595254-45595276 TGGTAATCTGCATTCCTAACAGG - Intronic
1024090553 7:45936390-45936412 TGGGAATCTGCATCTTCACTAGG - Intergenic
1024376428 7:48643866-48643888 TGTGATTCTGCATGTCTAACAGG - Intronic
1024376436 7:48643906-48643928 TGGGAATCTGCATTTTAACAAGG + Intronic
1026067155 7:67084805-67084827 TGAGAATGTGCATTTCTAACAGG + Intronic
1026343418 7:69453549-69453571 TGGGAATGTGTATGTTTAACTGG - Intergenic
1026709778 7:72727522-72727544 TGAGAATGTGCATTTCTAACAGG - Intronic
1026939328 7:74277802-74277824 GGGGCATCCGCATGTTTCACAGG + Intergenic
1027769293 7:82386241-82386263 TGAGAATCTGCCTGATTAAAAGG - Intronic
1029849548 7:103447600-103447622 TCAGAATCTGCGTTTTTAACGGG - Intergenic
1030464873 7:109888461-109888483 TGGGTGTCTGGATGGTTAACTGG - Intergenic
1030803968 7:113890325-113890347 TGGGAATCTGCATTTTTAACTGG + Intronic
1030803975 7:113890413-113890435 TGGGAATCTGCATTTTTAACTGG + Intronic
1031013838 7:116551112-116551134 TGGGGATCTGTATTTTTACCAGG - Intronic
1031236493 7:119185273-119185295 TGGGACTCTGCAACTTGAACTGG + Intergenic
1033320746 7:140337521-140337543 TTGGACTCTGCATGCTTAAATGG - Intronic
1033357105 7:140608857-140608879 CAGGAATCTGCATGTCTGACAGG - Intronic
1034095037 7:148399973-148399995 TGGGCATCTGTATTTCTAACAGG - Intronic
1034782454 7:153893045-153893067 TGGAAATCTGCATTTTTTAATGG - Intronic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1035970632 8:4244007-4244029 TGGGAAGCTGCATTTTAACCTGG + Intronic
1036566427 8:9942147-9942169 CAGGAATCTGCATTCTTAACAGG - Intergenic
1036648717 8:10628389-10628411 TGGGAATGTGCTTGTTTTTCAGG - Intronic
1040990930 8:53348348-53348370 TGGGAATTTGTCTGTGTAACTGG + Intergenic
1041127204 8:54654946-54654968 TGAAAATCTGCCTTTTTAACAGG + Intergenic
1041290926 8:56307776-56307798 AAGGAATCTGCATGCTAAACTGG + Intronic
1041676547 8:60545579-60545601 AAGGAATCTGCATTTTTAATGGG + Intronic
1041814460 8:61952912-61952934 TGGGAATCTGAATGAATAAGTGG - Intergenic
1042346046 8:67729129-67729151 TGGGACTCTGCATTTCTAATGGG - Intronic
1043524066 8:81077184-81077206 TCAGAATCTGCACATTTAACAGG + Intronic
1044495527 8:92875673-92875695 TGGGAATTTGCAATTTTAAATGG + Intergenic
1044695996 8:94922775-94922797 GCTGAATCTGCATTTTTAACAGG + Intronic
1045209905 8:100086415-100086437 AGGGAATTTGCATTTCTAACAGG - Intronic
1045284617 8:100779641-100779663 TGGGAATCTACATTTTGAACAGG - Intergenic
1045426796 8:102075112-102075134 TGAGAAACTGAATATTTAACGGG + Intronic
1045549300 8:103155855-103155877 TGAGATTCTGCATGTTTGACAGG + Intronic
1047374420 8:124282464-124282486 GGGAGATCTGCATTTTTAACAGG - Intergenic
1047963661 8:130029344-130029366 TGGAAATCTGTATTTTAAACAGG - Intergenic
1048775051 8:137936282-137936304 TGAGAAACAGCATGTTTCACAGG + Intergenic
1049162560 8:141106487-141106509 TGGGGTTCTGCATTTTTGACCGG + Intergenic
1052370375 9:27657216-27657238 TGGGACACTTCAAGTTTAACTGG - Intergenic
1052378999 9:27749880-27749902 TGAGATTCTGCATTTCTAACAGG - Intergenic
1052490434 9:29159933-29159955 TGGGATTCTTCATTTTTAAAAGG - Intergenic
1052955520 9:34250761-34250783 TGGGAATCTTCATGTTTCTTGGG + Intronic
1054784154 9:69194807-69194829 TGAGATTCTGTATTTTTAACAGG + Intronic
1055028171 9:71744505-71744527 TTGGAATCTGCATGTTTGATTGG - Intronic
1055774828 9:79755912-79755934 TGTGAATTTGCATTTCTAACAGG - Intergenic
1056247500 9:84710763-84710785 TGGGTATCTGCAGGTTTGCCAGG - Exonic
1056554462 9:87677187-87677209 TGGCAATCTGCCTGTTTCATGGG - Intronic
1057402363 9:94735519-94735541 CAAGAATCTGCATTTTTAACAGG + Intronic
1057611162 9:96544992-96545014 TGAGAATTTGCATTTCTAACAGG - Intronic
1057976296 9:99609431-99609453 TGGAAACCTGCATATTGAACAGG + Intergenic
1058493733 9:105531225-105531247 TGGTAATTTGCATTTTTAAAAGG + Intronic
1059204965 9:112456000-112456022 TGAGATTCTGCATGTCTGACAGG + Intronic
1059375634 9:113878829-113878851 TGGAAATTTGGATGTTTAAGTGG + Intronic
1060575162 9:124685277-124685299 TAGGAATCTGCACTTTTAGCAGG + Intronic
1060854282 9:126902528-126902550 TGGAAATTTGCCTGTGTAACTGG + Intergenic
1061888355 9:133604727-133604749 TGGGAACCTGCATTTCTCACGGG + Intergenic
1062535714 9:137020302-137020324 TGGGACGCTCCATGTTTGACAGG - Intronic
1062726860 9:138079122-138079144 TGGGAATCTGTATGTCTAACAGG - Intronic
1186708933 X:12172572-12172594 TGAGAATTTGCATTTTTAAGAGG + Intronic
1187011680 X:15286100-15286122 TGTGACTCTGCATGTCTAGCAGG - Intronic
1187305826 X:18094446-18094468 TCATAATCTGCATTTTTAACTGG - Intergenic
1187356568 X:18578776-18578798 TTGGAATCTGCATGATAAAATGG - Intronic
1187714643 X:22090955-22090977 TGAGAATCTATATTTTTAACAGG + Intronic
1188519950 X:31027380-31027402 TGAGAATTTGCATCTTAAACAGG + Intergenic
1188968045 X:36579209-36579231 TGGGAAGCTCCATTATTAACAGG + Intergenic
1189366558 X:40393506-40393528 TGGTTATCTGCAGGTTTGACTGG - Intergenic
1189466870 X:41284186-41284208 TGAGAATCTGCATTTCTATCAGG + Intergenic
1192404509 X:70870870-70870892 TGGGCATCTGTATTTTTCACAGG + Intronic
1192922920 X:75726386-75726408 TGGCAATCTCCATTTTTAATTGG + Intergenic
1196712594 X:118778567-118778589 TAGGACTCTGCATATTTAATAGG + Intronic
1197182887 X:123555624-123555646 CCAGAATCTGCATGTCTAACGGG - Intergenic
1197362984 X:125530586-125530608 TGGGTTTCTGCATGTTGACCAGG + Intergenic
1198032389 X:132766035-132766057 TCAGAATCTGCACTTTTAACAGG - Intronic
1198849868 X:140954821-140954843 CAGGAATCTGCATCTTTAACAGG - Intergenic
1200836054 Y:7732459-7732481 TGAGAATTTGCATTTCTAACAGG - Intergenic