ID: 1102367266

View in Genome Browser
Species Human (GRCh38)
Location 12:112348981-112349003
Sequence TTGCCTTTGAATGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 1, 2: 3, 3: 46, 4: 470}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102367262_1102367266 2 Left 1102367262 12:112348956-112348978 CCAAGTTGTTTACAATAAACACA 0: 1
1: 0
2: 4
3: 65
4: 382
Right 1102367266 12:112348981-112349003 TTGCCTTTGAATGAGGAGGAGGG 0: 1
1: 1
2: 3
3: 46
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102367266 Original CRISPR TTGCCTTTGAATGAGGAGGA GGG Intronic
900614176 1:3557073-3557095 CTGCCTTGGAAGGACGAGGAAGG + Intronic
900883313 1:5397852-5397874 GAGCCTTAGAATGAGGAGGAAGG - Intergenic
901090562 1:6638024-6638046 CTGCCTTTTACTGAGCAGGAGGG - Intronic
901126248 1:6930777-6930799 TTGGCTCTGCATGAGGAGTAAGG + Intronic
901670154 1:10851422-10851444 TTGTCTGTGAGTGAGGACGATGG - Intergenic
901685791 1:10942656-10942678 TCCCCTTGGAATGAGGAGGCCGG + Intergenic
902801553 1:18833137-18833159 TTGCCTTGGGAGGTGGAGGAAGG - Intergenic
903655218 1:24944718-24944740 TGGGCTTTGAAGGTGGAGGAAGG + Intronic
903904194 1:26672148-26672170 GGGCCTTTGTGTGAGGAGGAGGG - Intergenic
903907262 1:26696082-26696104 TTGCCTGGGAATGAGGGGGGCGG - Exonic
905340727 1:37275512-37275534 TTGGCTCTGACTGAAGAGGAGGG + Intergenic
905434860 1:37949250-37949272 CTGCCTTTGAGTGGGGAAGAGGG - Intergenic
905905785 1:41617594-41617616 GTGTCTTTGAATGGGGAGCAAGG - Intronic
907473446 1:54689615-54689637 TTGGGTTTGAAGGAGGAGGAGGG + Intronic
908808304 1:67953534-67953556 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
908888146 1:68813693-68813715 CTGACTTTGAAGAAGGAGGAAGG + Intergenic
909072848 1:71017275-71017297 CTGGCTTTGAAGGTGGAGGAAGG + Intronic
909363785 1:74796349-74796371 TTGGCTTTGAAAATGGAGGAAGG + Intergenic
910040605 1:82847066-82847088 CTGGCTTTGAATGAAGGGGATGG + Intergenic
910207800 1:84765205-84765227 TTGACTTTGAAGATGGAGGAAGG - Intergenic
911024850 1:93426025-93426047 TTGCCTATGGCTGAGGAGAATGG + Intergenic
912216569 1:107620230-107620252 TTCCCTGTCAATGAGGAGCATGG + Intronic
912459243 1:109820095-109820117 TTGCCCTTGAAAGAGGAACAGGG + Intergenic
913565586 1:120069501-120069523 GAGCCTTTGAAGCAGGAGGAGGG - Exonic
913632544 1:120724052-120724074 GAGCCTTTGAAGCAGGAGGAGGG + Intergenic
913989007 1:143592376-143592398 CTGCATTTGAAGTAGGAGGATGG + Intergenic
914245937 1:145885901-145885923 TTGCCTCTGATTGAGCAGGGCGG - Intergenic
914286183 1:146228876-146228898 GAGCCTTTGAAGCAGGAGGAGGG - Exonic
914348511 1:146820083-146820105 CTGTCTTTGAATGTGGAGGAAGG - Intergenic
914547211 1:148679620-148679642 GAGCCTTTGAAGCAGGAGGAGGG - Intronic
914619292 1:149390726-149390748 GAGCCTTTGAAGCAGGAGGAGGG + Intergenic
916030209 1:160870223-160870245 TTGCTCTTGACTGAGGTGGATGG - Intergenic
916728605 1:167546034-167546056 TTGCCTTAGAAGGCTGAGGATGG + Intronic
917884677 1:179371771-179371793 CTGGCTTTGAAGAAGGAGGAAGG + Intronic
918058668 1:181044283-181044305 ATGCTTATAAATGAGGAGGAAGG + Intronic
918342634 1:183580178-183580200 TTGGGTTTGAAATAGGAGGATGG + Intronic
918418088 1:184333324-184333346 TTGGCTTTGAATACAGAGGAAGG + Intergenic
918418252 1:184335016-184335038 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
918643682 1:186876530-186876552 TTGCCTATAAATTAGGAGTAGGG + Intronic
919019036 1:192079857-192079879 CTGCCTTTGAAGGTGGAAGAAGG - Intergenic
919945008 1:202312517-202312539 TACCCTTTAAGTGAGGAGGAAGG + Intronic
920164352 1:204025212-204025234 TCCCCTTTGAACGTGGAGGAAGG + Intergenic
920586773 1:207171980-207172002 TTGCCTATGAGTGAGAAGTAGGG - Intergenic
921034710 1:211365665-211365687 TATCTGTTGAATGAGGAGGATGG - Intronic
921521064 1:216154652-216154674 TTGCCTAGGCCTGAGGAGGAGGG - Intronic
921981646 1:221264866-221264888 TTTTCCTTGAAAGAGGAGGAGGG - Intergenic
922800219 1:228361696-228361718 CTGCCTTGGAGTGAGGAGGGTGG + Intronic
923355408 1:233150105-233150127 CTGCCTGTGACTGAGAAGGACGG - Intronic
924381838 1:243472463-243472485 TTGCCTGTGAGAAAGGAGGAAGG - Intronic
924542231 1:244992199-244992221 TAGCTTTAGAATGAGCAGGATGG - Intronic
924697960 1:246419617-246419639 GTCCCTTTAAATGATGAGGAAGG - Intronic
1064080663 10:12305416-12305438 TGGCATTTGGATGAAGAGGAGGG - Intergenic
1064846937 10:19666068-19666090 GTGGCTTTGAAAGAGGAGGGAGG - Intronic
1065672311 10:28133370-28133392 TTCAAGTTGAATGAGGAGGAGGG - Intronic
1066254656 10:33666703-33666725 TTGCCACTGAATGATGAGAAAGG - Intergenic
1066631513 10:37463164-37463186 AGGCATTTGAATGAAGAGGAGGG - Intergenic
1066797051 10:39133933-39133955 TTTCCTTTGAATCAGCAGGTTGG + Intergenic
1066812567 10:39359387-39359409 TTTCTTTTGAATGAGGAGTTTGG - Intergenic
1066933451 10:41797431-41797453 TTTCCTTTGAGTGAGAAGGTTGG + Intergenic
1068114638 10:52723893-52723915 TACCCTTTGAAGGAGGTGGATGG + Intergenic
1070324428 10:75378572-75378594 AGGCCTCTGAATGATGAGGATGG - Intergenic
1070544642 10:77442777-77442799 TTGGGTGTGAAGGAGGAGGAGGG - Intronic
1070695248 10:78558308-78558330 TTGCCTTCTAATGAGTAGAATGG - Intergenic
1070997801 10:80801305-80801327 TGGCCTTTTAATGGGGAAGAGGG + Intergenic
1071214229 10:83380208-83380230 TTCACTCTGAATGAGGATGAAGG + Intergenic
1071424200 10:85531989-85532011 ATGCCCTTGAACTAGGAGGAAGG + Intergenic
1072301661 10:94067812-94067834 TGGCCTTTGGATGAGGATAAGGG + Intronic
1074057081 10:109932254-109932276 TTGCCTGTGACTGGGGAGGATGG - Intergenic
1074281384 10:112054946-112054968 CTGCCCTTGAATGCAGAGGAAGG - Intergenic
1074393899 10:113081021-113081043 TTCCCATTGAAAGGGGAGGAGGG + Intronic
1075173562 10:120138448-120138470 TTGGCTTTGAAGAGGGAGGAAGG + Intergenic
1075508850 10:123052343-123052365 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1075884409 10:125885502-125885524 TGGGCTTTGAAGGTGGAGGAAGG + Intronic
1076145917 10:128121055-128121077 TTTCCTTTGGATGATGAGTATGG - Intronic
1077120466 11:905183-905205 TTGGGTTTGAAGGAGGAGGTGGG - Intronic
1078269374 11:9780773-9780795 TCGTCTTTGACTAAGGAGGAAGG + Intronic
1078918786 11:15807248-15807270 TTGCCTGTGGCTGTGGAGGAGGG - Intergenic
1079333469 11:19552011-19552033 TTCCCTTTGTCTGAGGAGGACGG + Intronic
1082083045 11:48026896-48026918 ATGCCTTTGCATGAGAGGGAAGG + Intronic
1082601189 11:55157574-55157596 TTGCTTTTGATTGAGGAGTTTGG - Intergenic
1084932959 11:72571400-72571422 TGGAGTTTGGATGAGGAGGACGG - Intergenic
1085933491 11:81114743-81114765 TTACCTTTTAATGGGGAAGAGGG - Intergenic
1086594439 11:88554223-88554245 CTGGCTTTGAATGTGGAGGAAGG - Intronic
1086862491 11:91941377-91941399 TTGCTTGTGAATGAAGGGGAAGG - Intergenic
1087225443 11:95593427-95593449 ATGCCTTTGGATGAGGAGAAAGG - Intergenic
1089691761 11:120191260-120191282 TTGTCTTTGAAGCGGGAGGAGGG + Intergenic
1091207580 11:133832310-133832332 CTGCCTTTTAAGGAGGAGGCGGG - Intergenic
1091593890 12:1861897-1861919 TTGCCTGTGAAGGAGTGGGATGG - Intronic
1091985617 12:4908798-4908820 TTGGCTTTGATTAAGGAGGTGGG + Intergenic
1092120547 12:6040716-6040738 TGGCATGGGAATGAGGAGGATGG - Intronic
1092126109 12:6075968-6075990 TTCACTATGAATGAGGGGGATGG + Intronic
1092835031 12:12479256-12479278 TTGCATTTGAATAAGGAACAAGG + Intronic
1092915692 12:13187043-13187065 TTGACTTTGAATGTGGAGAGTGG + Intergenic
1093105885 12:15086583-15086605 CTGACTTTGAAGAAGGAGGAAGG - Intergenic
1093146293 12:15570650-15570672 TTGGAAATGAATGAGGAGGATGG + Intronic
1093171242 12:15863226-15863248 GTGCCATTTAATGAGGAAGAAGG - Intronic
1093222069 12:16433493-16433515 TTGCCTTTGAATTAGGACATAGG - Intronic
1093238987 12:16645443-16645465 TTGCCTTGGAATGGGAAAGAGGG - Intergenic
1094131452 12:27079807-27079829 CTGTGGTTGAATGAGGAGGATGG + Intergenic
1094180861 12:27591310-27591332 CTGTGATTGAATGAGGAGGATGG + Intronic
1094869955 12:34590981-34591003 TTTCTTTTGAATGAGAAGGTTGG - Intergenic
1094875317 12:34634887-34634909 TTTCCTTTGATTGAGGAGTTTGG + Intergenic
1095061333 12:37694784-37694806 TTTCCTTTGAATGAGCAGTTTGG - Intergenic
1095075702 12:37920971-37920993 TTTCTTTTGAATGAGGAGTTTGG - Intergenic
1095719060 12:45380662-45380684 TAGCCCTTGAATTAGGAGGTTGG + Intronic
1096641610 12:52999062-52999084 CTACCTTTGAATACGGAGGAAGG + Intergenic
1097698634 12:62798689-62798711 TGGCAGGTGAATGAGGAGGAAGG - Intronic
1098119532 12:67221442-67221464 ATACCTTTGATTGAAGAGGAAGG - Intergenic
1099023787 12:77440259-77440281 TTGGCTTTGAAAATGGAGGAGGG - Intergenic
1099644969 12:85341436-85341458 CTGCCTTTGAAGAAGGAGGAAGG - Intergenic
1100144149 12:91656723-91656745 TAGCCTGGGAATGAGGAGGAGGG - Intergenic
1100717560 12:97321998-97322020 TTGCCTTAGTATTATGAGGAAGG - Intergenic
1102106876 12:110332694-110332716 GATCCTTTAAATGAGGAGGAGGG - Intronic
1102185821 12:110947868-110947890 CTGCCTTTGAAGATGGAGGAAGG - Intergenic
1102367266 12:112348981-112349003 TTGCCTTTGAATGAGGAGGAGGG + Intronic
1102445757 12:113001601-113001623 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1102778928 12:115546709-115546731 GTGCCTCTGTTTGAGGAGGAGGG + Intergenic
1102814208 12:115849886-115849908 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
1104559227 12:129828919-129828941 TTGCCTGTGAAAGAGGTGGAAGG + Intronic
1105083192 13:16150901-16150923 TTTCCTTTGATTGAGAAGTATGG + Intergenic
1106072581 13:26426640-26426662 ATGCCTTTGAATAAGGAGCTAGG - Intergenic
1106500665 13:30325452-30325474 ATTCCTTTGACTGAAGAGGAAGG - Intergenic
1106805586 13:33303159-33303181 TTTCATGGGAATGAGGAGGAAGG - Intronic
1107216905 13:37932683-37932705 TTGCCTCTGCATGAAGAAGAAGG + Intergenic
1107638473 13:42416925-42416947 TTGGCTTTGAAAATGGAGGAAGG + Intergenic
1107702897 13:43066369-43066391 TTGGCTTTGAAAATGGAGGAAGG - Intronic
1107752779 13:43586574-43586596 CTCCCTCTGAATGAAGAGGAGGG + Intronic
1107998297 13:45883230-45883252 TTGACTTTGAATTTGGAAGATGG - Intergenic
1108857046 13:54806370-54806392 TTGGCTTTGAAAATGGAGGAAGG - Intergenic
1109418944 13:62084457-62084479 TTGCCTTTGACTGAGTAAAATGG + Intergenic
1109440881 13:62371300-62371322 TTTCCTTTCAATGAGAAGGAAGG + Intergenic
1110202151 13:72864228-72864250 TTGCTTGAGAGTGAGGAGGATGG + Intronic
1110442311 13:75539034-75539056 CTGGCTTTGAAGGTGGAGGAAGG - Intronic
1110662275 13:78070859-78070881 TTGATTTTGAATGAGGTGAAAGG + Intergenic
1110733492 13:78908530-78908552 TTTTCTTGGAATGAGGAGGCTGG - Intergenic
1111555128 13:89871071-89871093 TTGGCTTTCAATGGGGAGGAAGG + Intergenic
1112877016 13:104054844-104054866 TTACGTGTGGATGAGGAGGAGGG - Intergenic
1113096284 13:106667219-106667241 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
1113506022 13:110816518-110816540 TTGCCTTTAAAGAAGGAGCAGGG - Intergenic
1113701535 13:112392432-112392454 TTGCTTATGAAGGAGGAGAAAGG + Intronic
1114559447 14:23579523-23579545 TTGCTTCTGAATGGGGAGGAGGG + Intergenic
1114877549 14:26740032-26740054 TTCCCTTGGAATGAGAACGAGGG - Intergenic
1115011258 14:28548080-28548102 TGGCCTTTGAAAAAGAAGGAAGG - Intergenic
1115196489 14:30805863-30805885 TTGCCTCTGGGAGAGGAGGAGGG - Intergenic
1115478656 14:33840577-33840599 TGGCCTTTGTCTGATGAGGAGGG - Intergenic
1116412432 14:44640835-44640857 TTGTATGTGAAGGAGGAGGAAGG + Intergenic
1117380998 14:55162769-55162791 TTGCCTTTGAAGAAAGAGCAAGG - Intronic
1117868696 14:60175525-60175547 TTCCCTTTGCATGAGGAAGGAGG - Intergenic
1118157450 14:63255594-63255616 GTGCATTTGAATCAGGAGCATGG - Intronic
1118350018 14:64967041-64967063 TTGCTTTTGACTGAGGAGGTGGG - Intronic
1118468537 14:66053800-66053822 TTGGCTTTGAAGACGGAGGAAGG - Intergenic
1119423387 14:74521485-74521507 GTGCCTTTGAACGAGGAGCACGG - Intronic
1120059337 14:79963773-79963795 TTGGATTTGGAGGAGGAGGAGGG - Intergenic
1121126496 14:91410399-91410421 TTGGCTTTGAATGAGCCAGATGG - Intronic
1121298196 14:92847322-92847344 TTGGCTTTGAAGGTGGAGGAAGG + Intergenic
1121571228 14:94947970-94947992 CTGGCTTTGAAGAAGGAGGATGG + Intergenic
1121958671 14:98238458-98238480 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1122166445 14:99827955-99827977 TTGCCTGTGAATGAAATGGAGGG + Intronic
1122682726 14:103478371-103478393 TTGCCAGGGAATGAGGGGGAAGG - Intronic
1123735833 15:23181253-23181275 CTGCCTTTTAAGGAGGGGGAAGG + Intergenic
1124286547 15:28404236-28404258 CTGCCTTTTAAGGAGGGGGAAGG + Intergenic
1124296156 15:28507400-28507422 CTGCCTTTTAAGGAGGGGGAAGG - Intergenic
1124477594 15:30048233-30048255 TTGCCTTTGCATGAACAAGAAGG + Intergenic
1126158355 15:45586093-45586115 TTGGCTTTGAATATAGAGGAAGG - Intergenic
1128934263 15:71731972-71731994 CTGGCTTTGAAGGTGGAGGAAGG - Intronic
1128989875 15:72250832-72250854 TTGCCTTCCAGTGAGGAGGCTGG - Exonic
1129709300 15:77812355-77812377 TTGCCTTTGAATGAGATGCCCGG - Intronic
1129822835 15:78616462-78616484 TTGTCTTTGAAAGAGAATGAGGG - Intronic
1130053009 15:80499396-80499418 TGGCCTTTGACAGAAGAGGAAGG - Intronic
1130161095 15:81401113-81401135 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1130260988 15:82354210-82354232 TTGGCTGGGAAGGAGGAGGAGGG - Intergenic
1130280247 15:82514808-82514830 TTGGCTGGGAAGGAGGAGGAGGG + Intergenic
1130471622 15:84230994-84231016 TTGGCTGGGAAGGAGGAGGAGGG + Intergenic
1130479116 15:84345565-84345587 TTGGCTGGGAAGGAGGAGGAGGG + Intergenic
1130492655 15:84442566-84442588 TTGGCTGGGAAGGAGGAGGAGGG - Intergenic
1130593918 15:85235622-85235644 TTGGCTGGGAAGGAGGAGGAGGG + Intergenic
1130613135 15:85379605-85379627 TTGGCTGGGAAGGAGGAGGAGGG - Intergenic
1130711719 15:86289650-86289672 TTGGCTTTGAACGTGGAGGGAGG - Intronic
1130711977 15:86292311-86292333 TTGGCTTTGAAGGTGGAGGGAGG + Intronic
1131122056 15:89828864-89828886 TTGCCTTGGAAGGAAGAGGAAGG + Intergenic
1131532293 15:93204356-93204378 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
1131737193 15:95346431-95346453 TTGGCTTTGAACTTGGAGGAAGG + Intergenic
1132230577 15:100181047-100181069 CTGCCTGTGAAAGAGGAGGGAGG - Intronic
1132414014 15:101607820-101607842 CTGCCTTTGAAGGCGGAGGAAGG + Intergenic
1133388235 16:5387949-5387971 TTGGCTTTGAAGGTGGAGGAGGG + Intergenic
1133444688 16:5849909-5849931 TTCCCTTTGAGTTAGGAGCAGGG - Intergenic
1133526782 16:6613320-6613342 TTTCCTTTGAATGCTCAGGATGG + Intronic
1133923859 16:10179159-10179181 TTGGCTCTGAATGAGAGGGAGGG - Intronic
1134099495 16:11441725-11441747 TTGGCTTTGAAGGTGGAAGAAGG + Intronic
1134119061 16:11570944-11570966 TTGGCTTTGAAGGGGGAGGAAGG + Intronic
1134230019 16:12421720-12421742 ATGCTTCTGATTGAGGAGGAAGG - Intronic
1135264509 16:21011233-21011255 TTGATTTTGAAGGATGAGGAAGG + Intronic
1136713107 16:32256405-32256427 TTCCCTATGAATGTGGATGATGG - Intergenic
1136754805 16:32673022-32673044 TTCCCTATGAATGTGGATGATGG + Intergenic
1136813307 16:33197342-33197364 TTCCCTATGAATGTGGATGATGG - Intronic
1136819783 16:33307422-33307444 TTCCCTATGAATGTGGATGATGG - Intergenic
1136826347 16:33363962-33363984 TTCCCTATGAATGTGGATGATGG - Intergenic
1136831413 16:33462733-33462755 TTCCCTATGAATGTGGATGATGG - Intergenic
1136998035 16:35204226-35204248 TTCCCTATGAATGTGGATGATGG + Intergenic
1137024441 16:35458332-35458354 TTCCCTATGAATGTGGATGATGG + Intergenic
1137028895 16:35503870-35503892 TTCCCTGTGAATGTGGATGATGG + Intergenic
1137076444 16:35969905-35969927 TTTCTTTTGATTGAGGAGTATGG - Intergenic
1137077032 16:35980582-35980604 TTTCCTTTGATTGAGCAGTATGG - Intergenic
1138649027 16:58447080-58447102 TTGCCTGTGAATGGGCATGAAGG + Intergenic
1139023640 16:62784709-62784731 TTGCCTTGGACTGAGGGGAAGGG - Intergenic
1139985524 16:70895465-70895487 CTGTCTTTGAATGTGGAGAAAGG + Intronic
1141035894 16:80625289-80625311 TTGCCTTTGATGATGGAGGAAGG - Intronic
1141191073 16:81824975-81824997 CTGGCTTTGAAGGTGGAGGAAGG + Intronic
1202991884 16_KI270728v1_random:20317-20339 TTCCCTATGAATGTGGATGATGG - Intergenic
1203056949 16_KI270728v1_random:933357-933379 TTCCCTATGAATGTGGATGATGG + Intergenic
1142934038 17:3312083-3312105 CTGCCTTGGATTGAGGAGAAAGG + Intergenic
1143348193 17:6265908-6265930 CTGCCTTTGAAGATGGAGGAAGG - Intergenic
1143813131 17:9488607-9488629 TTGTCTTTGAAGACGGAGGAAGG + Intronic
1145290361 17:21540313-21540335 TTGCCTAGGAATGAGCATGAGGG + Intronic
1145410915 17:22662607-22662629 TTTGCTTTGATTGAGCAGGATGG - Intergenic
1146919581 17:36701561-36701583 ATGCAGTTGAAGGAGGAGGAAGG - Intergenic
1147652852 17:42072051-42072073 ATGACTGTGAATGAGGTGGAGGG + Intergenic
1148070714 17:44907055-44907077 TTGCGTTAGAATGAGGAGGAAGG - Intronic
1150990659 17:70254521-70254543 TTGGCTTTGAAGGTGGAGGAAGG + Intergenic
1153082421 18:1243261-1243283 CTGTCTTTGAAGGTGGAGGAAGG + Intergenic
1153593369 18:6698973-6698995 TTGCCCTTTAATGAGGTAGAGGG + Intergenic
1155341028 18:24814299-24814321 CTGGCTTTGAAGGTGGAGGACGG - Intergenic
1155608681 18:27637385-27637407 TTGTTTTTGAATAAGAAGGAGGG - Intergenic
1155794015 18:30010907-30010929 ATGGCTTTGAAGGGGGAGGAAGG + Intergenic
1156487292 18:37474503-37474525 GTGCCCTAGGATGAGGAGGAAGG + Intronic
1156885938 18:42136024-42136046 AAGTCTGTGAATGAGGAGGAGGG + Intergenic
1157179817 18:45487227-45487249 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1159488562 18:69099105-69099127 ATGGCTTTGTAAGAGGAGGAAGG + Intergenic
1159916745 18:74194747-74194769 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1160015997 18:75141216-75141238 ATGGCTTTGAATATGGAGGAAGG + Intergenic
1160081179 18:75728697-75728719 TTGACTTTGAAAGAGGAAAAAGG - Intergenic
1161066751 19:2242407-2242429 GTGGCTGTGAATGGGGAGGAAGG - Intronic
1161358775 19:3834469-3834491 GTGACTATGAAGGAGGAGGAGGG - Intronic
1161589380 19:5122228-5122250 GTGGCTGTGAAGGAGGAGGAAGG - Intronic
1161845830 19:6711458-6711480 CTGCCTTTAAAGGTGGAGGAAGG + Intronic
1162387663 19:10369639-10369661 TTGCATTTGAAGGTGGTGGATGG - Intronic
1162786690 19:13039494-13039516 TTGCCTGTGAATGGGGCAGAAGG + Intronic
1164356152 19:27433100-27433122 TTTCCTTTGATTGAGCAGTATGG + Intergenic
1164366507 19:27588824-27588846 TTTCCTTTGATTGAGCAGGTTGG + Intergenic
1164368108 19:27610138-27610160 TTTCCTTTGATTGAGGAGTTTGG + Intergenic
1164368307 19:27613471-27613493 TTTCCTTTGAATGAGCAGCTTGG + Intergenic
1165278849 19:34779878-34779900 ATGCCTTTGCATGATGAGAAAGG + Intergenic
1166601753 19:44101859-44101881 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1166603571 19:44119498-44119520 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1166644700 19:44523004-44523026 TAGCCTTTGAGTGGGGAGGAGGG - Intronic
1168206285 19:54852681-54852703 TGGGCTTTGAAGGTGGAGGAAGG + Intronic
1168383382 19:55942992-55943014 CTGCCTTTGAAGAAGGAGGAAGG + Intergenic
925928727 2:8689742-8689764 TAGCTTTTGTATGAGAAGGAAGG + Intergenic
926544776 2:14226072-14226094 TTGGCTTTGAATATGGAGGAAGG - Intergenic
926874627 2:17461505-17461527 TTGCCTTTGATGGAGGAGTGGGG - Intergenic
926888691 2:17620451-17620473 TTCCCTGAGAATGAGGAGGCGGG - Intronic
926889151 2:17624622-17624644 CTGCTTTTGAAGAAGGAGGAAGG + Intronic
927479691 2:23442485-23442507 TTGTCTTTGAAGATGGAGGAAGG + Intronic
928600251 2:32897428-32897450 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
929429778 2:41877423-41877445 TTACCTTTAAATGAGGAAGAAGG + Intergenic
930174806 2:48290833-48290855 TTGCCTCTGAAGGAGAGGGAGGG + Intergenic
930590912 2:53324737-53324759 CTGCCTTTGAAAATGGAGGAAGG + Intergenic
931084069 2:58809367-58809389 TTGGCTTTGAATGAGCAGATAGG + Intergenic
931086175 2:58832947-58832969 TTGTCTTTGAATGTGAAAGATGG - Intergenic
931117925 2:59184523-59184545 TGGCCTTTGCATGAGGGGGAGGG + Intergenic
931168758 2:59779740-59779762 TTTCATCAGAATGAGGAGGAGGG + Intergenic
931899632 2:66773065-66773087 CTGCCTTTGAATAAGGCAGAAGG + Intergenic
932748391 2:74354483-74354505 TTCCCATGGAATGGGGAGGAGGG + Intronic
932750909 2:74371166-74371188 TCTCCTTTGCAGGAGGAGGAGGG - Exonic
932852298 2:75199312-75199334 TTGCCTTTCCCTGCGGAGGAAGG - Exonic
933830860 2:86207306-86207328 TGGCCTTTGGGTGAGGAGAAAGG + Exonic
934694123 2:96386311-96386333 TTGCCTATGTATGAGGAGAAGGG - Intergenic
934948326 2:98558267-98558289 GAGCTTATGAATGAGGAGGAAGG - Intronic
935016304 2:99185678-99185700 TTGCCTAGGAATTAGGAGAATGG + Intronic
935109321 2:100077375-100077397 TTGGCTTTGAAGATGGAGGATGG + Intronic
937469292 2:122161495-122161517 TTGCCTTAGAACGCAGAGGAAGG + Intergenic
938638787 2:133258289-133258311 TTGGATTTGAGTGAGGAGCAAGG - Intronic
941921651 2:170856813-170856835 GTGCCTTTGAAAGAGGAAGCAGG + Intronic
943069400 2:183123067-183123089 TTGGCTTTGAAAAAGCAGGAAGG + Intronic
943426310 2:187739781-187739803 TTGACTTTGAAGATGGAGGAAGG - Intergenic
944203944 2:197137311-197137333 TAGCCTTAGGATGATGAGGAAGG + Intronic
944502081 2:200372269-200372291 TGGCCATTGAATGAGGATAATGG - Intronic
946120524 2:217509035-217509057 TTGTCTATGAATGAGGAGGTAGG + Intronic
946943878 2:224799173-224799195 TTGCCTAGGGATGTGGAGGAAGG - Intronic
1168901314 20:1367503-1367525 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1169307711 20:4507453-4507475 TTGACTTTGAATCAGATGGAGGG + Intergenic
1169713511 20:8590671-8590693 CTGCCTTTGAAGTTGGAGGAAGG - Intronic
1169943652 20:10965296-10965318 TTGCCTATGACAGAGAAGGATGG + Intergenic
1171517389 20:25748325-25748347 TTTCCTATGAATGTGGATGATGG + Intergenic
1171763928 20:29239850-29239872 TTTCTTTTGATTGAGGAGTATGG - Intergenic
1172364294 20:34337123-34337145 TTTCCTTAAAATGAGGATGATGG + Intergenic
1173853029 20:46230940-46230962 CTGCCTTAGAGGGAGGAGGAGGG + Intronic
1173903826 20:46611329-46611351 TTGACTTTGAATAATGAGTAGGG - Intronic
1173937615 20:46880939-46880961 TTGCCTGAGAGTGAGGAGGTGGG + Intergenic
1174047212 20:47741956-47741978 TTCCTCTGGAATGAGGAGGAAGG - Intronic
1174481194 20:50832744-50832766 TGGGCTTTGAAGGAGGAGGCAGG - Intronic
1175692134 20:61073178-61073200 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
1176293639 21:5059280-5059302 TGGCAGATGAATGAGGAGGAGGG + Intergenic
1176320508 21:5315519-5315541 TTTCTTTTGAATGAGGAGCTTGG - Intergenic
1176427398 21:6557261-6557283 CTGCCTTTGAAGGTGGAGGAGGG + Intergenic
1176477894 21:7245538-7245560 TTTCTTTTGAATGAGGAGCTTGG - Intergenic
1177324169 21:19562194-19562216 TTAACTTTGAATCAGGAGTAGGG - Intergenic
1177469385 21:21537850-21537872 TTGCCTTTAAAGGAAGAAGATGG + Exonic
1178500666 21:33123442-33123464 TTGCCAGAGAATGAGGAGAACGG + Intergenic
1179008542 21:37535060-37535082 CTGGCTTTGAAGGTGGAGGAGGG + Intergenic
1179182490 21:39057629-39057651 CTGGCTTTGAAGGAGGAGGAAGG - Intergenic
1179402832 21:41099966-41099988 CTGCCTTTGAAAATGGAGGAAGG - Intergenic
1179471664 21:41614424-41614446 TTGGCTTTGAAGAGGGAGGAAGG + Intergenic
1179553460 21:42157813-42157835 CTGCCTTTGAAGAGGGAGGAGGG - Intergenic
1179702889 21:43165578-43165600 CTGCCTTTGAAGGTGGAGGAGGG + Intergenic
1179717065 21:43294024-43294046 TTACCTCTGATGGAGGAGGAGGG - Intergenic
1179863621 21:44204368-44204390 TGGCAGATGAATGAGGAGGAGGG - Intergenic
1180076267 21:45464720-45464742 TTGGCTTTGAAGGGGGAAGAAGG - Intronic
1180401731 22:12437757-12437779 TTTCCTTTGATTGAGCAGGTTGG - Intergenic
1180800624 22:18630272-18630294 GGGCCTTTGGAGGAGGAGGAAGG - Intergenic
1180849679 22:19009774-19009796 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1180851856 22:19025829-19025851 GGGCCTTTGGAGGAGGAGGAAGG - Intergenic
1181221095 22:21364990-21365012 GGGCCTTTGGAGGAGGAGGAAGG + Intergenic
1181664912 22:24387930-24387952 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1181974289 22:26717828-26717850 TTTCCTTAGAATGAAGAGGTAGG - Intergenic
1182447416 22:30397683-30397705 ATGCCATGGAATGAGGAGGTTGG + Intronic
1184923606 22:47622749-47622771 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
1184988008 22:48148523-48148545 TTTCCTTTCAATGATTAGGAAGG + Intergenic
949401396 3:3668681-3668703 ATGACTTTGAAGAAGGAGGAAGG - Intergenic
949847478 3:8386488-8386510 TTACCTCTGGATGGGGAGGAGGG + Intergenic
950067517 3:10124852-10124874 TTGGCTTTGAAAGTGGAAGAAGG - Intronic
950129712 3:10533819-10533841 TGGCATTTGAATTAGGAGCATGG - Intronic
951594444 3:24301896-24301918 TTGACTTTGAAGATGGAGGAAGG + Intronic
952518406 3:34129289-34129311 CTACCTTTGAAGGTGGAGGAAGG - Intergenic
953542881 3:43837897-43837919 TTTCCTTTAAATGTGGAAGAGGG - Intergenic
954661262 3:52228127-52228149 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
954675518 3:52313374-52313396 TTCCCTTTACAGGAGGAGGAGGG - Intergenic
955205835 3:56895124-56895146 CTGTCTTTGAAAGTGGAGGAGGG - Intronic
955414737 3:58681461-58681483 TTGGATTTGAATGAGGAAGGAGG - Intergenic
957234494 3:77568055-77568077 CTGCATTTGAATGCGGATGAGGG + Intronic
959472335 3:106767310-106767332 CTGGCTTTGAATTTGGAGGAAGG + Intergenic
959555354 3:107711176-107711198 TTGACTTTGAATGAGTTGGGTGG - Intronic
959747231 3:109790931-109790953 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
961799638 3:129436988-129437010 TTGCTTTTGAAAGAAGATGAGGG - Exonic
961917291 3:130390532-130390554 TTGTCTTACAATGTGGAGGAGGG + Intronic
962950124 3:140210756-140210778 GTGGGTTTGAAGGAGGAGGAGGG + Intronic
963775610 3:149436142-149436164 TTGCCTTTGAGGCAGGAGGTAGG + Intergenic
963923248 3:150925601-150925623 GTGCATTAGAATGAAGAGGAGGG - Intronic
964055565 3:152452072-152452094 TTATCTTTAAATGAGGTGGAAGG - Intronic
964087992 3:152841080-152841102 GTGCCATTGAATGAGCAGTATGG + Intergenic
964716816 3:159731640-159731662 TTGTCTTGGAGTCAGGAGGAAGG + Intronic
964834585 3:160923685-160923707 TTGCTTTTAAATGAGTAGTAAGG + Intronic
965509256 3:169550056-169550078 TAGACTTTGAATGATGAGGAAGG + Intronic
966570902 3:181441779-181441801 CTGCTGCTGAATGAGGAGGAGGG + Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
968119513 3:196115091-196115113 TTGCCTTTTGCTGAGGAGGTGGG + Intergenic
968221687 3:196944545-196944567 TTGCCGTTGAAACAAGAGGAAGG + Intergenic
968310895 3:197682341-197682363 CTGCCTTTAAATGAAGAGAACGG + Intronic
968976078 4:3822692-3822714 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
969049853 4:4365038-4365060 CTGCCTTTGAAGATGGAGGAAGG - Intronic
969842220 4:9891030-9891052 TTGCCTCTGAAGGAGGAGAAGGG - Intronic
969975892 4:11101120-11101142 TTGGCCTTGAATGAGGTGGTGGG - Intergenic
970340737 4:15103912-15103934 TTGTTTTTGATTAAGGAGGAAGG + Intergenic
970938946 4:21608473-21608495 ATGCCTTTGAAAATGGAGGAAGG - Intronic
972053198 4:34766020-34766042 TTTCCTTGGAATAAGGAAGAAGG - Intergenic
974283116 4:59825051-59825073 TTGCATTTTAATGAGCATGATGG - Intergenic
976069509 4:81224978-81225000 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
977163367 4:93664291-93664313 TTGCTTTAGAGTGAGTAGGAAGG + Intronic
978231108 4:106401097-106401119 TTGCGTTTGACAGAGGAGGATGG + Intergenic
978688212 4:111475016-111475038 TTTCCTTTGATTGAGGTAGAGGG - Intergenic
979452067 4:120884720-120884742 TGTTCTTTGAAGGAGGAGGATGG - Intronic
979905278 4:126281457-126281479 TTTCCATTGAATTAGGAGAATGG + Intergenic
980119922 4:128717219-128717241 TTGGCTCTGAATGGGGAGGTAGG - Intergenic
980788511 4:137587155-137587177 TTGCCTTTGACTGAGGAACTAGG - Intergenic
980970097 4:139559469-139559491 TTGGTCTTGAATCAGGAGGAGGG + Intronic
981701365 4:147610533-147610555 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
982606516 4:157523356-157523378 TGGACATTGAATGAGGAGGAGGG + Intergenic
983951383 4:173646613-173646635 TTGGCTTTGGAAGTGGAGGAAGG + Intergenic
984624883 4:181996007-181996029 TTGAGTTTGCCTGAGGAGGAGGG - Intergenic
986275933 5:6274990-6275012 TTGGCTTTAAGTGAGGGGGATGG + Intergenic
987561062 5:19520619-19520641 TTCCATTCAAATGAGGAGGAAGG + Intronic
989835935 5:45991239-45991261 TTTCCTTTGAAGGAGCAGGTTGG + Intergenic
989838999 5:46036069-46036091 TTGCCTTTGATTGAGTAGTTTGG + Intergenic
989854777 5:46270114-46270136 TTTCTTTTGACTGAGGAGTATGG - Intergenic
990526975 5:56637648-56637670 ATGGCTTTGGAGGAGGAGGAGGG + Intergenic
991419629 5:66427964-66427986 TTGCCTTTGAAGATGGAAGAAGG + Intergenic
991598748 5:68331520-68331542 TTGCCTTTGAAGATGGAGGAAGG + Intergenic
993508648 5:88744079-88744101 TTGCCTTTTATTGAGTAGAAAGG - Intronic
993524721 5:88950344-88950366 TTGCATTTTAATGTAGAGGATGG + Intergenic
993855655 5:93071271-93071293 TTTCTTGGGAATGAGGAGGAAGG + Intergenic
994563800 5:101413771-101413793 TGGACTCTGAGTGAGGAGGATGG + Intergenic
997261547 5:132469231-132469253 CTGGCTTTGAAGGTGGAGGAAGG + Intronic
997262298 5:132474543-132474565 CTGGCTTTGAAAGTGGAGGAAGG - Intronic
997499970 5:134365875-134365897 TTGGCTTTGAAGGATGTGGAGGG - Intronic
997510382 5:134449813-134449835 TTGACTTGGAGTGTGGAGGAGGG - Intergenic
999082719 5:148859239-148859261 TTTCATTTAAATGAGAAGGATGG + Intergenic
999197802 5:149794641-149794663 TTGCCTTTGAGGCAGGAGAAGGG + Intronic
999350167 5:150862443-150862465 TTGTCTCTCAATGAGGAGGCTGG - Intronic
1000187138 5:158870134-158870156 TTGCCTTTGGTTGAAGTGGAGGG - Intronic
1000947739 5:167442125-167442147 TTCCCATTGAAAGGGGAGGAAGG - Intronic
1001955324 5:175844783-175844805 GTGCCTTTGCAGGGGGAGGAAGG + Intronic
1003135071 6:3428630-3428652 TTGCCTTTGAGTGAGACAGAAGG - Intronic
1003972704 6:11314302-11314324 TTGGCTTTAAATGAGGACGTAGG + Intronic
1005969252 6:30748625-30748647 TTGCCTTGGAATAAGGATGTTGG - Intergenic
1007325856 6:41059036-41059058 TTGCCTAGGGAAGAGGAGGAGGG + Intronic
1008008067 6:46433587-46433609 TTGGCTTTGAAGTTGGAGGAAGG + Intronic
1008949283 6:57137759-57137781 TTGCCTAGGGATGAGGAAGATGG - Intronic
1010768196 6:79799884-79799906 CTGTATTTGAATGAGTAGGATGG + Intergenic
1011507556 6:88063531-88063553 TTGCCTCTGGAGGATGAGGAAGG + Intronic
1012988521 6:105900320-105900342 TTTCCTTTGAATTAGGAGCTGGG - Intergenic
1013526249 6:110976533-110976555 CTGGCTTTGAATATGGAGGAAGG - Intergenic
1014490721 6:122058497-122058519 TTGAATTAGAATGAGGAGAAAGG + Intergenic
1014781329 6:125568165-125568187 GTGCCTTTATATGAAGAGGAAGG - Intergenic
1014788097 6:125640876-125640898 CTGCCAGTGGATGAGGAGGAGGG - Intergenic
1014801477 6:125783015-125783037 CTGCCTTTGAAAAGGGAGGAAGG + Intronic
1015862414 6:137694967-137694989 TTGCCTTGGAGTCAGGAGAAAGG - Intergenic
1016017518 6:139201062-139201084 TCTCCTGTGAATGAGGAAGAGGG - Intergenic
1016806775 6:148219631-148219653 TTGCCCCAGAAGGAGGAGGAAGG - Intergenic
1017346526 6:153389605-153389627 TTGCCTTTGATTCAGAAGGTGGG + Intergenic
1018078943 6:160242261-160242283 TTTCCTTAGAATGACGAGGGTGG - Intronic
1018637700 6:165878816-165878838 TAGCCTTTGAAGATGGAGGAAGG + Intronic
1019739827 7:2667112-2667134 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
1021250952 7:18324191-18324213 TGGACTTTGAAGGATGAGGAAGG + Intronic
1022645886 7:32228345-32228367 ATGCCATTGAAAGAGGAGGTTGG + Intronic
1023782128 7:43666235-43666257 TTGCCTTGCAATGAAGAGCATGG + Intronic
1024788288 7:52933553-52933575 GTGCCTTTGAATAAGAAGCAAGG + Intergenic
1025309171 7:57906342-57906364 TTTCTTTTGAATGAGTAGTATGG - Intergenic
1025502003 7:61312991-61313013 TTTCTTTTGATTGAGGAGGTTGG - Intergenic
1025516870 7:61659213-61659235 TTTCTTTTGATTGAGGAGGTTGG - Intergenic
1025518210 7:61682804-61682826 TTTCCTTTGATTGAGCAGTATGG - Intergenic
1025520273 7:61720113-61720135 TTTCCTTTGATTGAGGAGTTTGG - Intergenic
1025541209 7:62088037-62088059 TTTCTTTTGATTGAGGAGGTTGG - Intergenic
1025542536 7:62111452-62111474 TTTCCTTTGATTGAGCAGTATGG - Intergenic
1025544595 7:62148768-62148790 TTTCCTTTGATTGAGGAGTTTGG - Intergenic
1025869843 7:65421541-65421563 GTGCCTTTCAAAGAGCAGGAAGG - Intergenic
1025946715 7:66110327-66110349 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1026574792 7:71563232-71563254 TTGACTTTGAAGGATGAGGCTGG + Intronic
1026648270 7:72192060-72192082 CTGGCTTTGAATGCGGAGGAAGG - Intronic
1027891245 7:83978383-83978405 TTGCCTGGGAAGGAGGAGGTAGG + Intronic
1028204215 7:87997651-87997673 TTGCCTTTGAAAGTGGAGGAAGG - Intronic
1028305379 7:89256800-89256822 TTTCCTCTGGAGGAGGAGGATGG + Intronic
1028534782 7:91880541-91880563 TTGTCTTTGGAGGAGGAAGAGGG - Intronic
1028753211 7:94406043-94406065 TTGCCATTGAGAGAGAAGGATGG - Intronic
1029676298 7:102071412-102071434 TTGCCTTAGAATCTGGAGTAAGG + Intronic
1030086756 7:105822340-105822362 TCTCCTGTGAATGGGGAGGATGG + Intronic
1030186786 7:106770466-106770488 TTGCCTGTGTGTCAGGAGGAAGG + Intergenic
1031291170 7:119937696-119937718 TTGACTTTGAAAGAGCAAGAGGG - Intergenic
1031984184 7:128152254-128152276 TTGGGGTTGAAGGAGGAGGAAGG - Intergenic
1032335425 7:131020473-131020495 TAGGCTTTGAAGGAGCAGGAGGG + Intergenic
1032464958 7:132138362-132138384 TTTCCTTGGAATGGGGAGGCGGG + Intronic
1032864990 7:135916239-135916261 TTTCCTTTGTGTGAGTAGGAGGG + Intergenic
1033436795 7:141340126-141340148 TTGGCTTTGAATATGGAGGAAGG + Intronic
1035477820 7:159156098-159156120 GTGCCTTAGAGTGAGAAGGAGGG - Intergenic
1035836982 8:2765007-2765029 ATGCCTGGGAATGGGGAGGAGGG - Intergenic
1036494104 8:9253718-9253740 TTGTCTTTGCATGAGTAGGCTGG + Intergenic
1036532168 8:9601947-9601969 TTGCATGTGTATGAGGAGGTGGG + Intronic
1036625296 8:10466114-10466136 TTGACTTTGAAGATGGAGGAAGG + Intergenic
1037587932 8:20290804-20290826 TTGGCTTTGAAGCAGGAGGAAGG + Intronic
1038284543 8:26195315-26195337 TTGCCCTGGAAGGATGAGGATGG + Intergenic
1038660683 8:29494057-29494079 CTGCATTTGAATGAGGAGAAAGG - Intergenic
1039719606 8:40149241-40149263 TTGTCTTTGAAGATGGAGGAAGG - Intergenic
1040114969 8:43606541-43606563 TTTCCTTTGAATCAGCAGGTTGG + Intergenic
1040127787 8:43758046-43758068 TTTCCTTTGATTGATCAGGATGG + Intergenic
1040130741 8:43793438-43793460 TTTCCTTTGAATCAGCAGGTTGG + Intergenic
1040327398 8:46358344-46358366 TTGCTTTTGATTCAGCAGGATGG - Intergenic
1042817691 8:72895381-72895403 CTGCCTTTGAAGGTGGAAGAAGG + Intronic
1043509264 8:80933487-80933509 CAGCCTGTGAAAGAGGAGGAAGG + Intergenic
1044341765 8:91054259-91054281 TTGGCTTTGAAGATGGAGGAGGG - Intergenic
1044398657 8:91743996-91744018 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
1044421643 8:92003000-92003022 TTTCCTTAGAGTTAGGAGGAAGG - Intronic
1045412729 8:101934895-101934917 TTGCCTAAGTCTGAGGAGGATGG - Intronic
1046109110 8:109700354-109700376 TTGGCTGAGAAGGAGGAGGAGGG - Intergenic
1046803625 8:118455906-118455928 TTGCCTTTGAATGAGGTGGAAGG - Intronic
1047335647 8:123933271-123933293 ATGGCTTTGAAGGATGAGGAGGG - Intronic
1047509211 8:125503520-125503542 TTGGCTTTGAAGACGGAGGAAGG + Intergenic
1047768271 8:128007970-128007992 TTACCTTTGTCTGAGGAGGCTGG + Intergenic
1048687517 8:136920267-136920289 TTGTCTTTGAAGATGGAGGAAGG + Intergenic
1048967403 8:139624759-139624781 TTGCCTCTGACTGTGGAGGTGGG - Intronic
1048980099 8:139698628-139698650 CTGGCCTTGAGTGAGGAGGAGGG - Intronic
1049976321 9:863443-863465 CTGGCTTTGAAGGTGGAGGAAGG + Intronic
1050035217 9:1428151-1428173 TTACTTTTGAGTGAGAAGGAAGG + Intergenic
1050115436 9:2258703-2258725 TGGTCTTTGGATAAGGAGGAAGG + Intergenic
1051138344 9:13949989-13950011 TTGCCTTAGAAGGATGAGGATGG + Intergenic
1051632925 9:19156775-19156797 TTGCCTTGGAATTAGGAGTTAGG + Intergenic
1051649651 9:19309049-19309071 TTGCCTTGGAATGAAGAGGATGG + Intronic
1051925823 9:22323559-22323581 CTGCCTTTGAAGGTGGAGGAAGG - Intergenic
1051972761 9:22910950-22910972 TTGGCTTTGAAGGTGGAGAAAGG + Intergenic
1055941994 9:81659287-81659309 TAGCCTTTGCAAGAGGTGGAAGG - Intronic
1056065567 9:82930178-82930200 ATGCCTTTGAGAGAGGAGGAAGG - Intergenic
1056509717 9:87292191-87292213 TTGCCTGAGAATAAGGTGGAAGG - Intergenic
1057268730 9:93635375-93635397 TTGCCTTTGTCTGTGAAGGAAGG + Intronic
1058083581 9:100724817-100724839 TTGCCTTAGAATGAGCAGCCCGG - Intergenic
1059048800 9:110900276-110900298 TTGGCTTTGAAGAAAGAGGAAGG - Intronic
1059341965 9:113602338-113602360 TTGCCTTTGAAACAGCAGGCAGG - Intergenic
1061020031 9:128008377-128008399 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
1061526635 9:131170342-131170364 TTTCCTTTGAAGGCTGAGGAAGG - Intronic
1061819825 9:133220910-133220932 CTGGCTTTGAAGGTGGAGGAGGG + Intergenic
1061876531 9:133546868-133546890 TGGCCAGTGAATGCGGAGGAGGG - Intronic
1062240830 9:135537038-135537060 CTGGCTTTGAAGGTGGAGGAGGG - Intergenic
1062347626 9:136122705-136122727 GTGGCTTTGTGTGAGGAGGAAGG - Intergenic
1203359406 Un_KI270442v1:199819-199841 TTTCTTTTGATTGAGGAGTATGG - Intergenic
1203416329 Un_KI270591v1:884-906 TTTCCTTTGAATGAGCAGTTTGG - Intergenic
1186081983 X:5943171-5943193 CTGGCTTTGAAGGGGGAGGAAGG + Intronic
1186129203 X:6448203-6448225 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1186652560 X:11576941-11576963 CTGGCTTTGAAGAAGGAGGAAGG - Intronic
1186773873 X:12845053-12845075 TGGCCTTTGGGTGAGGAGAAAGG - Intergenic
1187236747 X:17474956-17474978 GTGCCTGAGAATGAGGAGTAGGG + Intronic
1187266226 X:17736904-17736926 TTGACTTGGAATGAGGAGAGGGG - Intergenic
1187482062 X:19666588-19666610 TTGCCTGTCACTGAGGGGGAAGG - Intronic
1187709659 X:22040593-22040615 TGACCTTTGAATGATGAGGAGGG + Intronic
1188336070 X:28934546-28934568 TTGCCTATGGCTGAGGGGGAAGG - Intronic
1188483500 X:30657934-30657956 TTGCCTTTGAATGAGTACTGTGG + Intronic
1188490383 X:30732970-30732992 TTACCTCTGAAAGAGGAGGATGG + Intergenic
1188621359 X:32228803-32228825 TTGTGTTTGAATGAAGAGAAAGG - Intronic
1189069630 X:37849609-37849631 CTGGCTTTGAATTTGGAGGAAGG - Intronic
1189483116 X:41408271-41408293 TTGCCTTTTCCTGAGAAGGAAGG - Intergenic
1190118603 X:47642016-47642038 TTGGCTTTGAAGATGGAGGAAGG + Intronic
1190516998 X:51234167-51234189 TTGGCTTTGAATATAGAGGAAGG + Intergenic
1191577045 X:62717366-62717388 TTTCCTTTGAATCAGCAGGTTGG - Intergenic
1192531276 X:71888850-71888872 TTGGCTTTGAAGAAGGAGGAAGG + Intergenic
1193054898 X:77139456-77139478 TTACCTTTGCATGAGGAAAAGGG + Intergenic
1193584762 X:83307331-83307353 TTGTCTTTGAATGCAAAGGAGGG + Intergenic
1193892745 X:87070848-87070870 TTAGCTTTGAAAGTGGAGGAGGG - Intergenic
1195253044 X:103066550-103066572 TTGCTTTGGTATGAAGAGGATGG - Intergenic
1196804715 X:119574299-119574321 TTGCCTTAGAATTAGCAGGTGGG + Intergenic
1197150136 X:123211344-123211366 CTGCCTTTTAATTAGGAGAAGGG - Intronic
1198083493 X:133261727-133261749 CTGGCTTTGAAGGGGGAGGACGG + Intergenic
1199228927 X:145412055-145412077 TTGGCTTTGAATACAGAGGAAGG - Intergenic
1199599226 X:149531879-149531901 CTGCCTTTGAAAGAGAAGGGTGG - Intronic
1199611635 X:149621750-149621772 TTGACTTTGAAGATGGAGGAAGG - Intronic
1201479336 Y:14422430-14422452 TAGCATTTGAATGAGTAGCAAGG - Intergenic