ID: 1102370023

View in Genome Browser
Species Human (GRCh38)
Location 12:112375084-112375106
Sequence ACCTGGGGATAGAGGCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 377}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102370023_1102370030 22 Left 1102370023 12:112375084-112375106 CCTGCCTGCCTCTATCCCCAGGT 0: 1
1: 0
2: 3
3: 38
4: 377
Right 1102370030 12:112375129-112375151 TTTCTAGAATTTCATAGAAATGG 0: 3
1: 39
2: 252
3: 803
4: 2219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102370023 Original CRISPR ACCTGGGGATAGAGGCAGGC AGG (reversed) Intronic
900300473 1:1974371-1974393 TCCTGAGGTTGGAGGCAGGCAGG - Intronic
900952569 1:5866103-5866125 ATCTGGGGACAGAGGCTGACTGG + Intronic
900984849 1:6067113-6067135 ACATGGGGAGTGAGGAAGGCCGG - Intronic
901094496 1:6667336-6667358 ATCAGAGGACAGAGGCAGGCAGG - Intronic
901748003 1:11387431-11387453 ACATGGGGCCAGAGGGAGGCAGG - Intergenic
902262493 1:15237312-15237334 ACCGTGGGACAGAGGGAGGCAGG - Intergenic
903018236 1:20375675-20375697 ACCTTAGGAGAGAGGCAGCCAGG + Intergenic
903225083 1:21890140-21890162 CCCTGGGGATGGAGACAGGCAGG + Exonic
903630684 1:24767466-24767488 ACCTGGTGGTAGTGGCAGTCTGG - Intronic
904043965 1:27599434-27599456 GCCTGGGGAGAGAAGCAGGCAGG - Intronic
904277681 1:29394900-29394922 AGGAGGGGATTGAGGCAGGCTGG + Intergenic
904464193 1:30698381-30698403 GCCCGGGGAAAGAGGCAGCCAGG + Intergenic
904942047 1:34170757-34170779 AGCTGAGCAGAGAGGCAGGCTGG - Intronic
904951941 1:34249663-34249685 GACAGGGGATAGAGTCAGGCTGG + Intergenic
904962649 1:34346831-34346853 AACTCTGGATTGAGGCAGGCAGG - Intergenic
905278289 1:36833256-36833278 AACTCTGGAGAGAGGCAGGCAGG - Intronic
906324955 1:44839740-44839762 TCCTGGGGCTGGGGGCAGGCAGG + Intronic
906346713 1:45020035-45020057 CCCTGGGGGTAGAGGGAGGTGGG + Intronic
907539736 1:55202754-55202776 AACTGTGGATAGACTCAGGCAGG + Intronic
907816089 1:57919461-57919483 CCCTGGGGTCAGAGGCAGTCAGG + Intronic
908393526 1:63704594-63704616 ACCTGAGGAAGGAGGAAGGCAGG - Intergenic
911150113 1:94590342-94590364 CCCTGGGGAGAGAGGGAGGGCGG - Intergenic
911717058 1:101145002-101145024 ACCTGGGGATGGAGGTAGGTAGG - Intergenic
913285780 1:117225126-117225148 ACCTGGAGCCAGAAGCAGGCTGG - Intergenic
914348893 1:146822651-146822673 ACCTGGGGAGAGAGACAGCAGGG - Intergenic
915892251 1:159782929-159782951 ATCTGGGGGTAGAGACAGCCTGG + Intergenic
917925881 1:179788846-179788868 ACCTGGTGAGTGAGGCAGGCTGG - Intronic
918042189 1:180920158-180920180 ACTCGGGGATAGAGCCAGACAGG - Intronic
918337421 1:183532299-183532321 CCCTGGGCATAGAGGAAGACTGG + Intronic
919746238 1:201010762-201010784 AGCTGGGGACAGAGACAGGGTGG - Intronic
919748886 1:201024478-201024500 ACCTGGGTAGAGAGGCTGGGCGG + Intergenic
919915414 1:202135799-202135821 ACCTGGGGAAAGAGGCAGGGTGG + Exonic
920072052 1:203309014-203309036 ACCTGGGGGTAGAGGAAGTGGGG - Exonic
920279694 1:204833458-204833480 ACCTGGGGTTGGAGGCGGGGAGG - Intronic
920300503 1:204985888-204985910 CCTTCGGGACAGAGGCAGGCTGG - Intronic
920527069 1:206675031-206675053 TCCTGGGGAGTGACGCAGGCAGG + Intronic
920529155 1:206689233-206689255 ACCTAGGGAGAGAGGAATGCTGG - Intronic
920616364 1:207496382-207496404 GCCTGGGGTGAGAGGCGGGCGGG + Exonic
922354337 1:224761731-224761753 ATCAGTGCATAGAGGCAGGCAGG - Intergenic
924029313 1:239870281-239870303 ACCTGGGGAGATGGACAGGCTGG - Intronic
1064886501 10:20119083-20119105 ACCTGAGGGTAGAGGCATCCAGG + Intronic
1064896212 10:20240075-20240097 ACTTGAGGATAGAGGGAGGCAGG - Intronic
1065366096 10:24938462-24938484 AGCTGGGGATAGGGGCTGGGGGG - Intronic
1065674110 10:28155898-28155920 ATTTGGGGATAGAGGCAGTGTGG - Intronic
1065962747 10:30747285-30747307 AGCTGGGGAAAAAGGCAGGGTGG + Intergenic
1066046864 10:31602755-31602777 AGCTGGGGCTCCAGGCAGGCAGG - Intergenic
1066126549 10:32347521-32347543 AGCTGGGGAGAGTGGCAGGCGGG + Intronic
1067522569 10:47019377-47019399 GCCAGGAGATAGAGGAAGGCAGG + Intergenic
1067532770 10:47086488-47086510 CCCAGGGGAGAGAGGCAGCCTGG + Intergenic
1068769908 10:60809558-60809580 TCCTGGGGACAAAGGTAGGCTGG + Intergenic
1069233313 10:66039167-66039189 ACCTAGGAATACAGGCAGCCAGG + Intronic
1069740412 10:70683570-70683592 TCCTGGGGAAATAGGCAGGGTGG + Intronic
1070817663 10:79335530-79335552 GCATGGGGATAGTGGCAGGGAGG + Intergenic
1070959706 10:80490016-80490038 AGGTGGGGACAGAGGCATGCAGG + Intronic
1071063372 10:81600671-81600693 AGCTGGGACTACAGGCAGGCAGG + Intergenic
1071833408 10:89394839-89394861 GCCTGGGGAAAGAGGCAAGTAGG - Intronic
1072743064 10:97922004-97922026 AACTGGGGGGAGAGGCATGCAGG - Intronic
1073143443 10:101263827-101263849 AGCTGAGTATAGAGGCAGGAGGG + Intergenic
1073430631 10:103484556-103484578 ACCTGGGGGCAAAGACAGGCAGG + Intergenic
1073481286 10:103787610-103787632 CCCTGGGGAGCAAGGCAGGCTGG + Intronic
1073638947 10:105230078-105230100 ACCTGGTGGTAGTGGCAGGGTGG + Intronic
1074883766 10:117679006-117679028 ACCTGGGGAGAGTGGCAACCAGG - Intergenic
1075300739 10:121321835-121321857 AGGTGAGGATAGAGGCAGGTGGG - Intergenic
1075345492 10:121679173-121679195 AGCTGGGGATAGAGAGAGGAGGG + Intergenic
1076293015 10:129362040-129362062 ACCTGGGGAGAGAAGGAGGCAGG + Intergenic
1076695319 10:132244524-132244546 CCCTGGGGAGCGAGGCTGGCGGG - Intronic
1076824050 10:132958339-132958361 ACCTGGGGTGTGGGGCAGGCAGG + Intergenic
1077070068 11:665697-665719 AGCAGGGGAGAGAGGCAGCCAGG + Intronic
1077308859 11:1879727-1879749 ACTTAGGGAGGGAGGCAGGCTGG + Intronic
1077337225 11:2010828-2010850 ACATGGGGAGGGAGGGAGGCAGG - Intergenic
1078395569 11:10978794-10978816 ACTTGAGGGTAGAGGCAGGGAGG + Intergenic
1081571033 11:44291008-44291030 ACCTGGGGAAGGAAGCAGGTGGG - Intronic
1083081714 11:60100828-60100850 TCCTGGGGATAGATTTAGGCTGG + Intergenic
1083202636 11:61129754-61129776 CGCTGGGGAGGGAGGCAGGCTGG + Intergenic
1083592357 11:63903174-63903196 TCCTAGGGAGTGAGGCAGGCAGG - Intronic
1083633693 11:64108924-64108946 TCCTAAGGACAGAGGCAGGCAGG + Intronic
1083650553 11:64201509-64201531 AACTGCTGATAGAGGCAGGGTGG - Intronic
1083923006 11:65790468-65790490 ACCTAGTGGTAGAGCCAGGCTGG - Intronic
1083956685 11:65987704-65987726 ACCTGGGGAAGGAGGCAGACAGG + Intergenic
1085267603 11:75246514-75246536 ACCCGGAGCCAGAGGCAGGCAGG - Intergenic
1085405861 11:76261785-76261807 ACCTGGAGGTAGAGGGAGGAAGG + Intergenic
1088917513 11:114238753-114238775 CCCTGGGGATGGAGACAAGCTGG - Intronic
1089292895 11:117449192-117449214 ACCTGGGAGGAGGGGCAGGCGGG + Intronic
1089365166 11:117917092-117917114 ACCCAGGGATGGGGGCAGGCAGG - Intronic
1089502202 11:118939364-118939386 AGATGTGGACAGAGGCAGGCAGG + Intronic
1089602419 11:119623994-119624016 AGCCGGGGACAGAGGAAGGCAGG + Intronic
1089666011 11:120019740-120019762 AGCTGGGGAAAGTGACAGGCAGG - Intergenic
1089679003 11:120109135-120109157 ACCTGGGCTGATAGGCAGGCAGG - Intergenic
1089800706 11:121024462-121024484 CCCTGGGGCTAGAGGGAGGATGG + Intronic
1090416874 11:126546504-126546526 ACCTGGGGGCAGAAGCAAGCGGG + Intronic
1090972051 11:131652616-131652638 ACCTGTGGACAGAGGCAGAGCGG + Intronic
1091234843 11:134014422-134014444 ACCCTGGGAGAGAGGCAGGAGGG + Intergenic
1202820209 11_KI270721v1_random:66010-66032 ACATGGGGAGGGAGGGAGGCAGG - Intergenic
1091779732 12:3206120-3206142 ACATGGAGATAGGAGCAGGCCGG - Intronic
1094540634 12:31360670-31360692 CCCTGCGGATAATGGCAGGCTGG + Intergenic
1095509370 12:42933389-42933411 CCCTGTGGATAGAGGTAGGGAGG + Intergenic
1096240234 12:49955883-49955905 AGCTGGGGAGGGAGGCAGGTGGG + Exonic
1096303294 12:50451218-50451240 AGCTAGGGATAGGGGGAGGCAGG - Intronic
1097262055 12:57725754-57725776 ACATGGGGATGGGGGCGGGCAGG - Intronic
1097333813 12:58360081-58360103 CCCTGGGGATATAGGCAAGTGGG + Intergenic
1098352997 12:69583359-69583381 AACTGAGGCTAGAGGCAGCCAGG - Intergenic
1098381959 12:69879174-69879196 ACCTGGGGAGAGACACAAGCAGG - Intronic
1099033131 12:77553937-77553959 ACCAGGGGAGAGAGGCAGATGGG - Intergenic
1102370023 12:112375084-112375106 ACCTGGGGATAGAGGCAGGCAGG - Intronic
1102439090 12:112947981-112948003 ACCTGGGGAATGGGGCAGCCTGG + Exonic
1102561115 12:113762878-113762900 TCCTGGGGCTGGAGGAAGGCTGG - Intergenic
1102655593 12:114480158-114480180 AGCTGGAGCCAGAGGCAGGCGGG - Intergenic
1103971825 12:124677377-124677399 ACCTCGGGACAGAGGCAGGGAGG + Intergenic
1104062794 12:125282277-125282299 ACCAGGGCACAGAGGCAGGCAGG - Intronic
1104698026 12:130879470-130879492 GCCTGGGGAGACAGGCAGTCAGG + Intergenic
1104746062 12:131211186-131211208 ACCTAGGAATAGAGCCAGGCAGG - Intergenic
1105619159 13:22050277-22050299 ACCTGGGGGTGGAGGCTGGGAGG + Intergenic
1107424974 13:40283642-40283664 ACCTGGGGCCTCAGGCAGGCTGG - Intergenic
1108322283 13:49300833-49300855 ACCTGGGAAGAGACGCAGGCTGG - Intergenic
1111962650 13:94828065-94828087 ACCTGAGGAAAAAGGCAGACAGG + Intergenic
1112371416 13:98796961-98796983 ACCTGGGGCTAGAGCATGGCAGG + Intronic
1112947158 13:104943125-104943147 ACCGAGAGATTGAGGCAGGCTGG + Intergenic
1113562262 13:111291221-111291243 ACCTGGGCTGAGAGGCAGGCTGG - Intronic
1114616903 14:24073145-24073167 AGCTTGGGAAAGAGGGAGGCTGG + Intronic
1118821961 14:69351555-69351577 AGCTGGTGTTAGAGGCAGGATGG + Intronic
1120875505 14:89371626-89371648 TCCTGGGGCTAGGAGCAGGCAGG - Intronic
1122090391 14:99334604-99334626 ACCAGGGGTTACAGGAAGGCAGG + Intergenic
1122151473 14:99728370-99728392 GGCTGGGGAGAGGGGCAGGCTGG - Intergenic
1122177966 14:99934983-99935005 CCCTGGGAAGAGAGGCAGGAAGG + Intronic
1122329911 14:100904959-100904981 ACCAGGGGGTAGAGGGAGGTGGG + Intergenic
1122855759 14:104559420-104559442 AGATGGGGATGGAGGGAGGCCGG - Intronic
1122863438 14:104592985-104593007 ACCTGGGGCCAGAGGCTGGAAGG + Exonic
1122976730 14:105173935-105173957 ACCCGGGGACACAGGCTGGCTGG + Intronic
1123039372 14:105484112-105484134 TTCTGGGCATAGAGGCAGCCTGG + Intergenic
1123760126 15:23425417-23425439 ACATGGGTAGAGGGGCAGGCAGG - Intergenic
1124177379 15:27439028-27439050 ACCTGGGGAAAGAGGCCAACAGG + Intronic
1125609367 15:40960368-40960390 CACTGGAGATAGAGGCAAGCAGG + Intergenic
1126106067 15:45147846-45147868 GCCTGGGGGTTCAGGCAGGCAGG + Intronic
1128151434 15:65365772-65365794 AACTGAAGAAAGAGGCAGGCCGG + Intronic
1129321588 15:74777978-74778000 ACCTGGGGAGAGTGCCAGGCTGG - Intergenic
1129552665 15:76470358-76470380 ATCTGGGGAAAGAGTCAGGCTGG + Intronic
1129871684 15:78945347-78945369 ACGTGGGGATGGCGACAGGCTGG - Intronic
1129888748 15:79057151-79057173 GCCTGGGCATAGGTGCAGGCTGG + Intronic
1130555321 15:84918479-84918501 ACCGCAGGTTAGAGGCAGGCAGG - Intronic
1131337176 15:91560530-91560552 TCCTGGGGATGGACTCAGGCTGG + Intergenic
1132479340 16:159333-159355 AGCTAGGGATAGAGGGAGGGAGG + Intronic
1132841774 16:1981513-1981535 TCCTGTGGCCAGAGGCAGGCAGG - Exonic
1133167325 16:3957543-3957565 TCCTGGGGCTTGAGGAAGGCAGG + Intronic
1133825932 16:9278299-9278321 ACCTGAGGATAAAGACAGGAAGG + Intergenic
1134059153 16:11188555-11188577 ACCTGGGCCTAGGGGCAGACTGG + Intergenic
1134456213 16:14397459-14397481 ACATGGGTAGAGGGGCAGGCAGG + Intergenic
1136118432 16:28111771-28111793 AGCTGGGGAAGGAGGTAGGCAGG - Intronic
1136402425 16:30025820-30025842 ACCTGGGCACAGAGGCAGGAAGG + Exonic
1136403436 16:30030539-30030561 ACTTGGGCAGGGAGGCAGGCGGG + Exonic
1136525863 16:30829889-30829911 CCCTGGTGGTTGAGGCAGGCTGG + Intergenic
1138124679 16:54428974-54428996 ACCTGGTGACAGAGGGAGGAAGG + Intergenic
1138331636 16:56220162-56220184 ATCTGAGGTTGGAGGCAGGCTGG + Intronic
1138421004 16:56899109-56899131 ACATGGGGGTAGCGGCAGACAGG - Intronic
1138617769 16:58184492-58184514 AACTGGGGATAGTGGGAGGTGGG + Intronic
1139985142 16:70892904-70892926 ACCTGGGGAGAGAGACAGCAGGG + Intronic
1140134186 16:72190629-72190651 GCTTGGGGTCAGAGGCAGGCGGG + Intergenic
1140288454 16:73627247-73627269 ACTTGGGGACAGAGAGAGGCAGG + Intergenic
1140629576 16:76835049-76835071 CTCTGGGGATAAAGGCTGGCAGG - Intergenic
1141376442 16:83535198-83535220 CCCTGGGGCAAGAGGCAGCCTGG + Intronic
1142235382 16:88920065-88920087 ATCTGGGGAAGGAGGGAGGCAGG - Intronic
1142417397 16:89949874-89949896 GCCTGGTGAGAGGGGCAGGCTGG + Intronic
1143325044 17:6093146-6093168 ACCTGGGGAATGAGGGAGACTGG + Intronic
1144465192 17:15491326-15491348 AACTGGGGATGGGGGCAGGATGG + Intronic
1145916254 17:28575765-28575787 CCCTGGGGAAAGATGCAGGGTGG + Intronic
1146194036 17:30795857-30795879 ACCCGGGGGAAGCGGCAGGCGGG + Intronic
1147177384 17:38664266-38664288 CCCTGGGGGTAGAGGCAGGGGGG - Intergenic
1147687382 17:42294741-42294763 AGCTGGGGTTGGAGGTAGGCAGG + Intronic
1147760094 17:42792320-42792342 CCCTGGGGATAGGGGGAAGCTGG - Intronic
1147925088 17:43941141-43941163 ACCTGGGGACAGCAGCATGCGGG + Exonic
1147979889 17:44267965-44267987 ACCTGGGCATAGATTCAGGCTGG + Intronic
1148091444 17:45024755-45024777 ACTTGGGGTGAGAGGGAGGCAGG - Intronic
1148439760 17:47705891-47705913 ACCTGGGGCCTGAGGCAGGTGGG - Intronic
1148496519 17:48056240-48056262 ACCAGGGGGTAAAGGCTGGCAGG + Intronic
1148766948 17:50045106-50045128 TCCTGGAGAAAGTGGCAGGCAGG + Intergenic
1149063914 17:52457837-52457859 ACCTGAGGATAGAGGGTGGAAGG + Intergenic
1151346969 17:73508157-73508179 ACGGGGAGGTAGAGGCAGGCTGG - Intronic
1151630726 17:75309215-75309237 GGCTGGGGAAAGAGGCAGGGTGG + Intergenic
1152614559 17:81331775-81331797 ACCTCAGGAGAGGGGCAGGCAGG - Intergenic
1152688774 17:81708023-81708045 ACCTGGGCAAAGCGGCAGGAGGG + Intergenic
1152755813 17:82086557-82086579 CCCTGGGGAGGGAGGGAGGCAGG + Exonic
1152831626 17:82500810-82500832 ACCTGGCCAAAGAGGCTGGCTGG - Intergenic
1152855143 17:82661390-82661412 ACCAGGGGAGAGAGGCCGGTGGG + Intronic
1154486863 18:14879007-14879029 ACCTGGGCAGGCAGGCAGGCCGG + Intergenic
1156125799 18:33903886-33903908 CCCTGGGCATAGAGGGAGGGTGG - Intronic
1156334981 18:36162222-36162244 TCCTAGGGATGGAGGCAGGAGGG - Intronic
1156731442 18:40197981-40198003 GCTTGGGGACAGAGGGAGGCGGG - Intergenic
1157904884 18:51560800-51560822 ACCTGGGGAGAAAAGCAGGATGG + Intergenic
1158680864 18:59565452-59565474 ACCAGGGGCGAGGGGCAGGCTGG + Intronic
1158791613 18:60786310-60786332 TCCTGTGGATAGTGGAAGGCTGG - Intergenic
1160124323 18:76156255-76156277 AGCTGGGGATAGAGAAAGGAGGG - Intergenic
1160130820 18:76223512-76223534 ACTTGGAGAAAGAAGCAGGCTGG - Intergenic
1160368497 18:78350122-78350144 AACTGGGGAGAGGGCCAGGCAGG - Intergenic
1160824344 19:1072633-1072655 CCCTGGAGATAAAGCCAGGCAGG + Intronic
1161074715 19:2279896-2279918 AGCTGGGCATAGTGGCGGGCGGG - Intronic
1161195524 19:2984138-2984160 CCCGGGGGAGAGTGGCAGGCGGG - Intronic
1161772010 19:6235893-6235915 GCCTGGGGACAGCAGCAGGCCGG - Intronic
1161981891 19:7634187-7634209 CCCTGGGGACAGAGGCAGGCGGG + Intronic
1163437204 19:17302898-17302920 ACCTGGGGTAGGGGGCAGGCAGG - Intronic
1164587202 19:29483528-29483550 ATCTGGGGAAAGAGAAAGGCTGG + Intergenic
1164605018 19:29591683-29591705 ACCTCGGCAGAGTGGCAGGCAGG - Intergenic
1165250901 19:34533250-34533272 ACCAGGGGCTAGAGGCAGAGAGG - Intergenic
1165329474 19:35133661-35133683 GCCAGGGGATGGAGGCAGGTGGG - Intronic
1165732212 19:38152996-38153018 TCCTGCGGAGTGAGGCAGGCGGG - Intronic
1165774196 19:38395353-38395375 ACCTTGGGAGAGAAGCAAGCTGG + Intronic
1167125391 19:47545332-47545354 GCCTCGGAAGAGAGGCAGGCAGG + Exonic
1168240279 19:55085744-55085766 AGCTGGGGTTAGAGCCAAGCTGG - Intronic
1168316901 19:55488502-55488524 AGCTGGGGAGAGAGGGAGGGAGG - Intronic
927152414 2:20203665-20203687 CCCTGGGGGTAGGGGAAGGCGGG + Intronic
927856382 2:26530265-26530287 ACCTGGGGAGGGAGGCTGCCTGG + Intronic
929038778 2:37722958-37722980 ACCTGAAGAAAGAGGAAGGCTGG + Intronic
929564665 2:42976845-42976867 ACCTGGGGAGAAGGGCAGGCTGG - Intergenic
929769232 2:44878229-44878251 CCCTGGGGCTAGAAGGAGGCAGG - Intergenic
929863346 2:45697674-45697696 TCCTGGGAACAGAGGCAGGTTGG - Intronic
931102893 2:59022146-59022168 GTCTGAGGATAGGGGCAGGCTGG + Intergenic
931288174 2:60850031-60850053 AGCTGGGGCTAGGGGCTGGCTGG - Intergenic
932977049 2:76615400-76615422 ACCTGGGGAAACAGCCAAGCTGG - Intergenic
933975744 2:87507952-87507974 ACCTGGGGCCAGAGGCAGGTGGG + Intergenic
933979116 2:87536359-87536381 ACCTGGGGTTGCAGGGAGGCAGG - Intergenic
936314711 2:111414433-111414455 ACCTGGGGTTGCAGGGAGGCAGG + Intergenic
936318082 2:111442861-111442883 ACCTGGGGCCAGAGGCAGGTGGG - Intergenic
937041476 2:118824053-118824075 ACATAGGGGTGGAGGCAGGCAGG + Intergenic
937504999 2:122526988-122527010 ACCTGGGCATAGAAGGAGGAGGG - Intergenic
938137972 2:128774832-128774854 ACTTTGGGATGGAGGGAGGCTGG + Intergenic
939036752 2:137141106-137141128 GGCTGGGGAGAGAGGCAGGAGGG + Intronic
940180917 2:150931870-150931892 ACCTGTGCATTGTGGCAGGCAGG + Intergenic
940290510 2:152073932-152073954 GGCAGGGGATAGGGGCAGGCAGG + Intronic
940456440 2:153907550-153907572 ACCTTAGGATAGAGGGTGGCAGG - Intronic
941043319 2:160647387-160647409 CCCTGGGGCTAGAGTCAGGGAGG + Intergenic
944207755 2:197174610-197174632 CCCTGGGGAGAGAGGCGGGGAGG + Intronic
945663017 2:212709574-212709596 TCCTGGCAATAGTGGCAGGCAGG + Intergenic
946165926 2:217863829-217863851 GTCTGGGGATAGAGGGAGGAAGG + Intronic
947736826 2:232459485-232459507 TCCTTAGGATAGAGGCAGGGTGG - Exonic
947799163 2:232916987-232917009 AGATGGGGAGAGAGGCGGGCAGG - Intronic
948129814 2:235592151-235592173 ACCTGGGGAGGGAGGGTGGCTGG + Intronic
948166049 2:235863581-235863603 ACCAGGGGACAGACGCTGGCTGG + Intronic
948662596 2:239516336-239516358 CCCTGGTGATGGAGGCAGGTGGG + Intergenic
948761786 2:240196927-240196949 GCCTGGAGACAGAGACAGGCAGG - Intergenic
948761859 2:240197281-240197303 AGCTGGGAACAGAGGCAGGCCGG - Intergenic
1168764232 20:371144-371166 AGCTGGAGGTAGAGTCAGGCAGG - Intronic
1168831362 20:846881-846903 ACCTGGGGAGAGGGGAAGGAAGG + Intronic
1169406320 20:5324238-5324260 ACCTGAGGATAGAGGGTGGGAGG - Intergenic
1172753458 20:37267492-37267514 ACTTGGAGGCAGAGGCAGGCAGG + Intergenic
1173664982 20:44757036-44757058 CGCTGGGGATAGAGGCCAGCAGG + Exonic
1173837680 20:46136444-46136466 GCCTGGGGCTTGAGGAAGGCAGG + Intergenic
1175568894 20:60003922-60003944 ACCTCGGGAAGGAGCCAGGCTGG + Intronic
1175899104 20:62353090-62353112 GCCTGGGGGGAGAGGCAGGGGGG - Intronic
1176992379 21:15513172-15513194 ACCTGGGGAAATAAGCAGCCAGG + Intergenic
1178698708 21:34816030-34816052 ACCTGGGGGGAGAGCCTGGCTGG - Intronic
1179193154 21:39140463-39140485 GCCTGGGGACACAGGAAGGCAGG + Intergenic
1179645866 21:42775749-42775771 ATCTGGGGACTGAGGCAGGTTGG + Intergenic
1180958625 22:19752188-19752210 ACCTGGGGCCAAAGGCAGGTGGG - Intergenic
1181009554 22:20032478-20032500 AGCTGGAGGAAGAGGCAGGCAGG - Intronic
1181492456 22:23269062-23269084 TCCTGGGGCTAAATGCAGGCAGG - Intronic
1181727245 22:24820117-24820139 CTCTGGGGATAGAAGGAGGCTGG + Intronic
1181775657 22:25158497-25158519 ACCTGGGGATGGGGCCAGCCAGG + Intronic
1182074959 22:27489068-27489090 GCCTGGGGATAGGAGCAGGATGG + Intergenic
1182236475 22:28881004-28881026 GCCAGGGGATAGGGGGAGGCAGG - Intergenic
1182587931 22:31356465-31356487 AGCTGGGCATGGTGGCAGGCGGG - Intergenic
1182729420 22:32475111-32475133 ACCTGGGGGTACAGGTACGCTGG + Exonic
1183166253 22:36149184-36149206 ACCTGTGGACAGAGGGAGGTTGG + Intronic
1183368717 22:37420314-37420336 ACCTGGGTCTGGAGGCCGGCTGG - Intronic
1183492288 22:38123061-38123083 CCCTGGGGATGGGGCCAGGCGGG - Intronic
1183598371 22:38825788-38825810 ACCTGGGGATGGAGGGAGGAAGG - Intronic
1183926651 22:41211140-41211162 GCCTGTGAAGAGAGGCAGGCTGG + Intronic
1184177104 22:42794651-42794673 ACCAGCGCTTAGAGGCAGGCAGG - Intergenic
1184848397 22:47103117-47103139 GCCTGGGGAAAGGGACAGGCTGG - Intronic
1184871620 22:47244140-47244162 TCCTGGGGATGGAGGCAGGGTGG - Intergenic
1185183597 22:49378829-49378851 ACCTGGGGGTAGGTGCAAGCGGG - Intergenic
1185291664 22:50030579-50030601 ACGTGGCGACAGGGGCAGGCCGG + Exonic
1185382519 22:50516647-50516669 ACCTGAGGAGAGAGGGAGGTAGG - Intronic
949213275 3:1532579-1532601 TCCTTGGGAATGAGGCAGGCAGG + Intergenic
949478684 3:4472665-4472687 ACCTGTGGAAGGAGGGAGGCAGG + Intergenic
950133259 3:10562227-10562249 ACCAGGGGCTAGAGGCAGTGAGG + Intronic
950381796 3:12622103-12622125 ACCTGGGGATAGAGTTATGTAGG - Intronic
950443303 3:13022320-13022342 ACCAGGGCACAGAGGCTGGCCGG - Intronic
951017559 3:17746659-17746681 AGCTGGGCATAGTGGCGGGCAGG + Intronic
951090973 3:18573612-18573634 ACCTGGGGACAGCTGCAGTCTGG - Intergenic
952845967 3:37688594-37688616 GTCTGGGGAGAAAGGCAGGCAGG - Intronic
953585601 3:44198573-44198595 TCCAGGGGACAGAGGCAGGTAGG + Intergenic
953668392 3:44942482-44942504 TCCTGGGGAGAGAGGCAAGGAGG + Intronic
953979068 3:47404775-47404797 ACCTGGTGAGAGCCGCAGGCAGG + Exonic
959597881 3:108147443-108147465 AACTGGGGCTAGAGGAAGGATGG + Intergenic
960142301 3:114162897-114162919 ACCCTGGGATAGAGGCAATCAGG - Intronic
960945533 3:122963955-122963977 CCCTGGGGAGAGAGGGAGGGAGG - Intronic
961003396 3:123388984-123389006 ACCTGGGGAAGGAGGCGGGGCGG + Intronic
961317654 3:126051483-126051505 ACCTGGGGGCAGAGGGAGGCAGG - Intronic
961651388 3:128418321-128418343 TCCTGGGGAAACAGCCAGGCTGG - Intergenic
961913539 3:130346001-130346023 ACTTGGGGCCTGAGGCAGGCGGG + Intronic
964891388 3:161540311-161540333 ATATGGGGATGGAGCCAGGCAGG + Intergenic
967013788 3:185463679-185463701 ACCTGGGGATGAAGGGAGGTGGG - Intronic
967980347 3:195061601-195061623 AGCTGGGGAAAGAGGCTGGAAGG + Intergenic
968126347 3:196163304-196163326 ACCTAGGAAGAGGGGCAGGCGGG + Intergenic
968232960 3:197015177-197015199 CCCAGGGGACAGAGACAGGCGGG - Intronic
969255421 4:5998527-5998549 GCCAGGGCATAGAGGCTGGCGGG + Intergenic
969291811 4:6244972-6244994 AGCTGGTGATAGAGGCAAGGAGG + Intergenic
969691261 4:8705407-8705429 GCCTGGGGAGAGAGGGAAGCTGG + Intergenic
969782579 4:9420575-9420597 ACCTGGGGATGGAGGGTGGGAGG + Intergenic
970031865 4:11685258-11685280 ACCTGGGGATTGAGGAAGTTGGG + Intergenic
971412754 4:26392650-26392672 TCCTGGGGATAGGGGGAGGCAGG + Intronic
972807019 4:42539247-42539269 ACCTGGGGGGAGAGGAAGGGTGG + Intronic
973636971 4:52869615-52869637 ACCTGGGGTTAGGAGCTGGCTGG - Intergenic
973855723 4:55008509-55008531 CGCTGGGGAGAGAGGAAGGCTGG - Intergenic
975161516 4:71129977-71129999 ACTTGAGGATAGAGGGAGGAAGG + Intergenic
975244762 4:72107228-72107250 ACTTGGGGTTATAGGCAGGGTGG + Intronic
976256464 4:83105588-83105610 AACTGGGGGTTGAGGCAGGTTGG + Intronic
977656154 4:99523144-99523166 ACCTGGGGAGAAAGGAAGGATGG - Intronic
978102136 4:104854517-104854539 ACCTGTGGAAAGAGAGAGGCAGG - Intergenic
978689790 4:111493573-111493595 ACCTGGGGGTAGAGGCTGGTTGG - Intergenic
983471342 4:168159511-168159533 ACCTGGGTCTAGAGATAGGCGGG + Intronic
984846745 4:184114937-184114959 CCCTGGGGATGGAGCAAGGCTGG + Intronic
986346513 5:6840400-6840422 ACCTTGAGAGAGAGTCAGGCTGG + Intergenic
988481948 5:31638916-31638938 ACCTGGGGATCGTGGGAGGAAGG - Intergenic
990233302 5:53739122-53739144 ACTTGGGGCTATTGGCAGGCAGG + Intergenic
991234256 5:64375937-64375959 AGCTGGGGAAAGAGGCTGACTGG - Intergenic
991362884 5:65839536-65839558 ACTTGAGGATGGAGGCTGGCAGG + Intronic
991969310 5:72123444-72123466 AGCTGGGCATAGTGGCAGGCTGG - Intronic
994438017 5:99763392-99763414 ACCTGGGGGAAGAGGCAGATAGG - Intergenic
995831667 5:116361474-116361496 ACCTGCGGAGGGAGGGAGGCCGG - Intronic
995841175 5:116444769-116444791 ACATGGAAATAGATGCAGGCAGG - Exonic
996185233 5:120465492-120465514 ACCTGGGGCTAGGGGCGGGCGGG - Intronic
997372311 5:133369920-133369942 ACCTGGGGAGGGAGGGAGGGAGG - Intronic
997511478 5:134457799-134457821 AGCTGGGGCTAGAGGCAGATGGG + Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
999143244 5:149376727-149376749 CCCTGGGGCTACAGGTAGGCTGG - Exonic
999451445 5:151681227-151681249 ACATGGGGACCGAGCCAGGCAGG + Intronic
1001301209 5:170535140-170535162 ACTTGGAGATAGAGCCAGGCAGG - Intronic
1002056266 5:176599527-176599549 TCCTGGGGAGAGAAGCAGGTTGG + Exonic
1002185434 5:177452612-177452634 ACCTGGGGGTGGAGCCAGGTTGG + Intronic
1002860488 6:1075425-1075447 ACCTGGGGTAGGAGGCAGGGAGG + Intergenic
1003406931 6:5833743-5833765 GGCTGGGGACAGGGGCAGGCAGG - Intergenic
1004162337 6:13225729-13225751 AGCTGGGGATAACGGCAGCCGGG - Intronic
1006211607 6:32400436-32400458 ACCTAGGCAGGGAGGCAGGCTGG + Intronic
1006278871 6:33030101-33030123 ACCTGGGGATGGGAGCAGGAGGG - Intergenic
1006913329 6:37578388-37578410 ACCGGGGGAGAGTGGCAGGACGG + Intergenic
1007486076 6:42181640-42181662 ACCTGGGGAAACACACAGGCTGG + Intergenic
1007594104 6:43040818-43040840 AGTCTGGGATAGAGGCAGGCTGG - Intronic
1008652630 6:53578591-53578613 AACAGGGGAAACAGGCAGGCAGG - Intronic
1011921566 6:92583453-92583475 ACTTGGGGGTGGAGGCAGGCAGG + Intergenic
1012482377 6:99681268-99681290 TCCTGGGGGTAGAGCCAGGGTGG + Intergenic
1013638726 6:112053077-112053099 GCCTTGGGATGGGGGCAGGCAGG + Intergenic
1014286380 6:119503518-119503540 ACCAGGGGATAAAGGCATCCAGG - Intergenic
1016696290 6:147000099-147000121 ACTTAGGGAAAGAGGGAGGCTGG - Intergenic
1017052630 6:150407887-150407909 ACCTGGAGAGAGAGGCAGAGAGG + Intergenic
1018655431 6:166029674-166029696 ATCTGGGGAAATACGCAGGCTGG + Intergenic
1019592860 7:1844397-1844419 ACCTGGGGAGAGACGCCGGTTGG + Intronic
1019732102 7:2634141-2634163 GGCGGGGGATGGAGGCAGGCCGG - Intronic
1019812226 7:3173163-3173185 CCAAGGGGAGAGAGGCAGGCAGG + Intronic
1021305008 7:19021766-19021788 AGCTGGGGAAAGAGGCTGACTGG + Intronic
1022515186 7:30970698-30970720 ACCTGGGGACAGCCACAGGCAGG - Intronic
1022515925 7:30974950-30974972 ACCTGGGGAGAGAGGAAAGAAGG - Exonic
1022536628 7:31102488-31102510 GCCTAGGGCCAGAGGCAGGCAGG + Intronic
1023214608 7:37848555-37848577 ATCTGGGGATAGAGGAACGTAGG + Intronic
1023633411 7:42185071-42185093 ACCTGGGCATGCAGGCAGGCAGG + Intronic
1023960408 7:44921770-44921792 AAATGGGGCTAGAGACAGGCTGG + Intergenic
1024505681 7:50159307-50159329 GCCGGGGGAGAGAGGCGGGCTGG - Exonic
1025111551 7:56221158-56221180 AGCTGGGACTAGAGGCATGCTGG - Intergenic
1028360653 7:89962833-89962855 ATCTGGAGAAAGAGGCTGGCTGG + Intergenic
1029264901 7:99330849-99330871 AGTTGGGGGTAGAGGAAGGCTGG + Intronic
1030878861 7:114851155-114851177 GCCTGAGGAGAGAGGCAAGCAGG - Intergenic
1032190848 7:129764862-129764884 TCCTGGGGTGAGAGGCCGGCTGG - Intergenic
1033528890 7:142243876-142243898 ACCAGGGGATAGGGGAAGTCTGG - Intergenic
1034385337 7:150736470-150736492 ACCTGGTTATACAGCCAGGCAGG - Intronic
1034411790 7:150945923-150945945 ACCTAGAAACAGAGGCAGGCTGG + Intronic
1034849172 7:154477766-154477788 ACCTGATGATACAGGCAGGCTGG - Intronic
1034955831 7:155334079-155334101 ACCTGGGGAGAAAGGCTGGGTGG - Intergenic
1036765582 8:11547601-11547623 TACTGGGGATAGAGGCAGGCGGG + Intronic
1037443661 8:18943115-18943137 GCCTGGGTATAGAGACAGGGTGG + Intronic
1039065634 8:33605132-33605154 AACTGGGGAGAGAGGCACGCTGG + Intergenic
1039099234 8:33923030-33923052 CCCTGGGAAAAGAGGCAGGGTGG + Intergenic
1043446630 8:80325594-80325616 CCCTGGGGTGACAGGCAGGCAGG + Intergenic
1045312840 8:101018148-101018170 CCCTTGGGAGTGAGGCAGGCAGG + Intergenic
1047211897 8:122847342-122847364 ACCTGGGGCAGGAGGCAGGGCGG - Intronic
1048150355 8:131887714-131887736 ACCTGGGAAGAAAGGCAGGCAGG - Intergenic
1048178348 8:132172692-132172714 CCCTGGAGGGAGAGGCAGGCAGG + Exonic
1049170735 8:141159191-141159213 ACCAGGGGATGGTAGCAGGCAGG - Intronic
1051109928 9:13624569-13624591 ACCTCAGGATGGAGCCAGGCTGG + Intergenic
1051357632 9:16254374-16254396 ACCTGGGGAGAAAGGGAAGCTGG - Intronic
1051384558 9:16493942-16493964 ACGAGGGTAGAGAGGCAGGCAGG + Intronic
1052824202 9:33163529-33163551 AACTGGTGAGAGAGGCAGGCTGG - Intronic
1053141263 9:35684314-35684336 GCCTGGGGGTAAAGGCAGGATGG + Exonic
1053157130 9:35789372-35789394 CCCAGAGGATAGAGGCAGCCTGG - Intergenic
1054783643 9:69189506-69189528 ACTTGGAGACTGAGGCAGGCAGG + Intronic
1055303518 9:74905723-74905745 AGCTGGGGTTGGATGCAGGCTGG + Intergenic
1056340190 9:85622055-85622077 ACCTGGAGTTACAGGCAGTCTGG - Intronic
1056918689 9:90766230-90766252 AGTTGGGAATAGAGGTAGGCAGG + Intergenic
1059021171 9:110578930-110578952 ACCCCGGGATAGAGACGGGCAGG + Intronic
1059136593 9:111813063-111813085 ACCTGGGCTTAGAGTCATGCAGG + Intergenic
1059798015 9:117720773-117720795 GGCTGTGGATAGAGTCAGGCTGG - Intergenic
1060047777 9:120354149-120354171 ACCTGGGTTTAGAGTCAGGAGGG + Intergenic
1060948018 9:127581805-127581827 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060948040 9:127581886-127581908 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060948049 9:127581913-127581935 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060948081 9:127582017-127582039 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060948090 9:127582044-127582066 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060991216 9:127850277-127850299 AACTGGGGATAGAGGCAAGGAGG + Intronic
1061164724 9:128915776-128915798 TAGTGGGGATCGAGGCAGGCAGG + Intronic
1061456419 9:130701272-130701294 TCCTGGGAACAAAGGCAGGCTGG + Intronic
1061474843 9:130858158-130858180 ACCTTGGAACAGATGCAGGCAGG + Intronic
1061681847 9:132246328-132246350 CCCTGGGGAGACAGGGAGGCGGG - Intergenic
1061809190 9:133152582-133152604 CACTGGGGACACAGGCAGGCTGG + Intergenic
1061985695 9:134129120-134129142 TCCAGCGGCTAGAGGCAGGCAGG - Intergenic
1062374024 9:136253974-136253996 TCCTGGGGACCCAGGCAGGCTGG - Intergenic
1062468721 9:136692748-136692770 TCCTGTGGGCAGAGGCAGGCGGG + Intergenic
1185622729 X:1463443-1463465 ACGTGGAGACAGAGGCAGACTGG - Exonic
1185924507 X:4131635-4131657 ACGTGGAGATGGAGGCAGACTGG - Intergenic
1189664174 X:43335001-43335023 CCCAGGGTACAGAGGCAGGCAGG - Intergenic
1189847452 X:45150240-45150262 TCCTGGGGTTAAAGGCTGGCAGG + Exonic
1190116098 X:47627139-47627161 ACCTGGGCAGGGTGGCAGGCCGG + Exonic
1190732962 X:53236599-53236621 GCCTGGGGACAGAGGGAGGGAGG - Intronic
1192040737 X:67618681-67618703 ATCTAGGGATAGAGTCAGGAAGG + Intronic
1192362352 X:70447706-70447728 ACCTGGGGAGACAGGCAAGAGGG + Intronic
1192531605 X:71892394-71892416 AGCTAGGGAAAGAGGCAGACTGG + Intergenic
1194461576 X:94176182-94176204 ACATGGGGATAGATGCACACAGG + Intergenic
1195466270 X:105182936-105182958 TAGTGGGGATAGTGGCAGGCTGG + Intronic
1197753160 X:129979663-129979685 ATCTGGGGATGGAGGCGGGGGGG - Intergenic
1197782652 X:130172626-130172648 ACCTGTGGGCAGAGGGAGGCAGG + Intronic
1200147806 X:153935403-153935425 GCCTGCGGGTAGAGGCGGGCAGG + Exonic
1200301840 X:154984215-154984237 ATAGGGGCATAGAGGCAGGCTGG - Intronic
1201950510 Y:19558563-19558585 ACCTGAGATTAGAGGCAGGCAGG - Intergenic