ID: 1102371306

View in Genome Browser
Species Human (GRCh38)
Location 12:112384102-112384124
Sequence CCAAGGGGGTCTCGAGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2884
Summary {0: 1, 1: 0, 2: 6, 3: 158, 4: 2719}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102371306_1102371316 26 Left 1102371306 12:112384102-112384124 CCAGAAGCTCGAGACCCCCTTGG 0: 1
1: 0
2: 6
3: 158
4: 2719
Right 1102371316 12:112384151-112384173 AAAAAATACAAAAATTAGCCAGG 0: 10819
1: 99340
2: 153306
3: 124873
4: 162903

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102371306 Original CRISPR CCAAGGGGGTCTCGAGCTTC TGG (reversed) Intergenic
Too many off-targets to display for this crispr