ID: 1102376407

View in Genome Browser
Species Human (GRCh38)
Location 12:112425108-112425130
Sequence TGTAATCTCCAGCACTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 879
Summary {0: 1, 1: 4, 2: 12, 3: 55, 4: 807}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102376407 Original CRISPR TGTAATCTCCAGCACTTTGG AGG (reversed) Intronic
900352556 1:2242489-2242511 TGTAATCTCTACCACATTGATGG + Intronic
900569609 1:3351813-3351835 TGCAGTCTCCAGCCATTTGGGGG + Intronic
900790545 1:4677033-4677055 TGTAATCTCAGGTACTTGGGAGG + Intronic
901085711 1:6611052-6611074 TGTTAATCCCAGCACTTTGGGGG + Intronic
901370438 1:8793033-8793055 TGTAATCTCAGCTACTTTGGAGG + Intronic
901422072 1:9157883-9157905 TATAATCCCCAACACTTTGAGGG + Intergenic
901427907 1:9194819-9194841 TGTAATCTCAACTACTTGGGAGG - Intergenic
901476638 1:9494676-9494698 TGTAATCTCAAGTACTGGGGAGG + Intergenic
901753146 1:11424358-11424380 TGTAATCTCCAGCATTGGAGCGG + Intergenic
901941335 1:12664486-12664508 TGTAATCCCAGGCACTTGGGAGG - Intronic
901990876 1:13112948-13112970 TGTAATCTCAGGTACTTGGGAGG - Intergenic
902064969 1:13677425-13677447 TGTAGTCTCAACCACTTAGGAGG - Intergenic
902334128 1:15745166-15745188 TGTAATCCCCACAACTTGGGAGG - Intronic
902568030 1:17327661-17327683 TGTAATCTCAGCCACTTGGGAGG - Intronic
903532029 1:24038181-24038203 TGTAATCCCAGCCACTTTGGAGG + Intergenic
903904903 1:26678281-26678303 TGTAATCTCGATTACTTGGGAGG - Intergenic
903949513 1:26987621-26987643 TGTAATCTCAACTACTTGGGAGG - Intergenic
904020051 1:27456997-27457019 TGTAAATCCCAGCACTTTGGGGG - Intronic
904816529 1:33205792-33205814 TGTAATCTCAGGTACTTGGGAGG + Intergenic
905209911 1:36366954-36366976 TGTAATCTCAGGTACTTGGGAGG - Intronic
905978535 1:42200598-42200620 TGTAATCCCAACTACTTTGGAGG - Intronic
906083906 1:43113738-43113760 TGTAATCTCAACTACTTGGGAGG - Intergenic
906325100 1:44840587-44840609 TGTAATCTCAGCTACTTTGGAGG + Intronic
906335369 1:44925668-44925690 TGTAATCCCCAGCACTTTGGGGG + Intronic
906406515 1:45546715-45546737 TGTAATCTCAGCTACTTTGGAGG - Intergenic
906460383 1:46031630-46031652 TGTAATCTCTAGGCCTTGGGAGG + Intronic
906625847 1:47325072-47325094 TGTAATCTCAGCCACTTGGGAGG - Intergenic
907033328 1:51194142-51194164 TGTAATCTCCACTACTTGGGAGG + Intergenic
907042084 1:51270489-51270511 TGTAATCCCAACCACTTGGGAGG + Intronic
907095541 1:51776487-51776509 TGTAATGTCCAGCAGATAGGAGG + Intronic
907377567 1:54056445-54056467 TGTAATCCCCACCACTCGGGAGG - Intronic
907394912 1:54182669-54182691 TGTAATCCCAACCACTTGGGAGG - Intronic
907538129 1:55184176-55184198 TGTAATCTCAGCCACTTGGGAGG - Intronic
907835854 1:58107736-58107758 TGTAATCCCAGGTACTTTGGAGG - Intronic
908371420 1:63482909-63482931 TGTAAATCCCAGCACTTTGGGGG - Intronic
908861266 1:68492583-68492605 TGTAGTCCCCACTACTTTGGAGG + Intronic
909497168 1:76291246-76291268 TAAAATCCCCAGCACGTTGGAGG + Intronic
909633844 1:77793906-77793928 TGTAATCCCAACCACTTGGGAGG - Intronic
909936872 1:81561580-81561602 TGTAATCTCAAGTATTCTGGAGG - Intronic
910046948 1:82929021-82929043 TTTAATTTCCACCAATTTGGTGG - Intergenic
910052701 1:82994414-82994436 TGTAATCTCAGGTACTTGGGAGG - Intergenic
911005014 1:93211154-93211176 TGTAATCCCCACTACTTGGGAGG + Intronic
911389179 1:97217084-97217106 TGTAATCCCAAGTACTTGGGAGG + Intronic
911502918 1:98711136-98711158 TGTAATCCCCACTACTTGGGAGG - Intronic
911728726 1:101269538-101269560 TGTAATCTCAACTACTTGGGAGG - Intergenic
911841048 1:102682479-102682501 TGTAATCTCAGATACTTTGGAGG - Intergenic
912325805 1:108761023-108761045 TGTAATCTCAACTACTTGGGAGG - Intronic
912825879 1:112902819-112902841 TGTAATCTCAAATACTTGGGAGG - Intergenic
913477886 1:119256493-119256515 TGTAATCTCAGCCACTTGGGAGG - Intergenic
914216330 1:145633276-145633298 TTTAATTGCCTGCACTTTGGGGG + Intronic
914468902 1:147955935-147955957 TTTAATTGCCTGCACTTTGGGGG + Intronic
914731875 1:150378859-150378881 TGTAATCCCAACCACTTGGGAGG + Intronic
915126116 1:153666303-153666325 TGTAATCCCCACTACTTGGGAGG - Intronic
915292054 1:154891076-154891098 TGTTAATCCCAGCACTTTGGGGG - Intergenic
915362388 1:155294009-155294031 TGTAATCCCCACTACTTGGGAGG + Intronic
916150712 1:161786240-161786262 TGTAATCCCAAGCACTTTGGGGG - Intronic
916636594 1:166676217-166676239 TGTAATCCCAAGTACTTGGGAGG + Intergenic
916800483 1:168211139-168211161 TGTAATCTCCGCTACTTGGGAGG + Intergenic
917873712 1:179266023-179266045 TGTAATCTCAACTACTTGGGAGG + Intergenic
918931932 1:190865170-190865192 TGTAAGCTAAAGCACTTTTGTGG - Intergenic
919092648 1:192993173-192993195 TGTAATCTCAGCCACTTGGGAGG + Intergenic
919442476 1:197654352-197654374 TGTAATCCCCAGCACTTTGGGGG + Intronic
919475503 1:198028234-198028256 TGTAATCTCAATTACTTGGGAGG + Intergenic
919662218 1:200258402-200258424 TGTAATCTCAGCCACTTGGGAGG + Intergenic
920922897 1:210312797-210312819 TGCAGTCCCCAGCACTTGGGAGG - Intergenic
921211388 1:212902519-212902541 TGTAATCCCCACTACTTGGGAGG - Intergenic
921615472 1:217261218-217261240 TGTAATCTCAGCCACTTGGGAGG + Intergenic
922153094 1:223021684-223021706 TGTAATCTCTACTACTTGGGAGG - Intergenic
922177288 1:223206499-223206521 TGTAATCCCCACTACTTGGGAGG + Intergenic
922209521 1:223476888-223476910 TGTCATCCCCAGCACTCTGCTGG + Intergenic
922814145 1:228437282-228437304 TGTAATCTCAGCCACTTGGGAGG + Intergenic
923309268 1:232720013-232720035 TGTAATCCCCACTACTTAGGAGG - Intergenic
923573883 1:235140655-235140677 TGCACTCCCCAGCCCTTTGGTGG - Intronic
923683078 1:236135065-236135087 TGTAATCCCCACTACTTGGGAGG - Intergenic
924273844 1:242364592-242364614 TGTAATCCCAACCACTTGGGAGG + Intronic
924705267 1:246496156-246496178 TGTAATCCCAACCACTTGGGAGG - Intronic
1063050719 10:2444233-2444255 TGTCATCCACAGCTCTTTGGAGG + Intergenic
1063119889 10:3097885-3097907 TGTAATCCCAAGTACTCTGGAGG + Intronic
1063391865 10:5654978-5655000 TGTAATCCCCGCCACTTGGGAGG + Intronic
1063998816 10:11645727-11645749 TGTAATCCCCTCCACTTGGGAGG + Intergenic
1064019224 10:11795974-11795996 TGTAATCTCAATCATTTGGGAGG + Intergenic
1064466155 10:15584173-15584195 TGTAATCTCAGCCACTTGGGAGG + Intronic
1064773256 10:18747367-18747389 TGTAATCTCAGCTACTTTGGCGG - Intergenic
1064999060 10:21320643-21320665 TGTAATCTCAACTACTTGGGAGG + Intergenic
1065533379 10:26695987-26696009 TGTAATCCCAACCACTTAGGAGG - Intergenic
1065915472 10:30351259-30351281 TGTAATCTCAACTACTTGGGAGG - Intronic
1065987142 10:30966206-30966228 TGTAATCTCAGGTACTTAGGAGG + Intronic
1066011138 10:31194229-31194251 TGTAGTCTCAAGTACTTGGGAGG + Intergenic
1066079601 10:31917150-31917172 TGTTAATCCCAGCACTTTGGGGG + Intronic
1066176290 10:32910858-32910880 TGTAATCTCAACTACTTGGGAGG - Intronic
1066323064 10:34325129-34325151 TGTAATCTCAACTACTTCGGAGG - Intronic
1066391037 10:34977491-34977513 TGTAATCTCAGGAATTTTGGAGG + Intergenic
1066423265 10:35281419-35281441 TGTAATCTCAGGTACTTGGGAGG - Intronic
1066589587 10:36979879-36979901 TGTAATCTCAGTTACTTTGGAGG + Intergenic
1066710870 10:38232067-38232089 TGTAATCCCAACCACTTGGGAGG - Intergenic
1068117408 10:52750268-52750290 TGTAATCCCAACTACTTTGGAGG - Intergenic
1069430287 10:68328998-68329020 TGTAATCTCAGTCACTTGGGAGG - Intronic
1069488770 10:68843677-68843699 TGTAATCCCAACTACTTTGGAGG - Intronic
1070077887 10:73155719-73155741 TGTAATCTCAGCTACTTTGGAGG - Intronic
1072334015 10:94381303-94381325 TGTAATCTCAGCTACTTTGGAGG + Intergenic
1072351575 10:94562279-94562301 TGTAATCCCCACTACTCTGGAGG + Intronic
1072991226 10:100196058-100196080 TGTAATCCCAGCCACTTTGGAGG - Intronic
1073017874 10:100416239-100416261 TGTAATCTCAGCCACTTGGGAGG - Intergenic
1073279025 10:102338360-102338382 TGTAATCTCAGCTACTTTGGAGG - Intronic
1073790750 10:106937840-106937862 TGTAATCCCCACTACTTGGGAGG + Intronic
1074011479 10:109485983-109486005 TGTAATCTCAGCCACTTAGGAGG - Intergenic
1074359001 10:112810279-112810301 TGTAATCCCAAGTACTTGGGAGG + Intronic
1074440404 10:113472625-113472647 TGTAATCTCAACTACTTGGGAGG - Intergenic
1074572523 10:114636909-114636931 TGTAATCTCAAATACTTGGGAGG + Intronic
1074575452 10:114664663-114664685 TGTAATCTCAGCCACTTGGGAGG - Intronic
1074694033 10:116031378-116031400 TGTAATCCCCACTACTCTGGAGG + Intergenic
1074716271 10:116222318-116222340 TGTAATCTCAGCTACTTTGGAGG - Intronic
1075050608 10:119180562-119180584 TGTAATCTCAGCCACTTGGGAGG + Intergenic
1075320352 10:121486561-121486583 TGTAATCTCCACTACTTGGGAGG - Intronic
1075812779 10:125237711-125237733 TGTAATCCCCACTACTTGGGAGG + Intergenic
1076292226 10:129354644-129354666 TGTAATCTCAGCCACTTAGGAGG + Intergenic
1076552118 10:131288029-131288051 TGTAATTTACAGCACTTTTTTGG + Intronic
1077848269 11:6049078-6049100 TCTAATCCCCAGCAGTTTGGGGG - Intergenic
1078189589 11:9081561-9081583 TGTAATCTCAGCCACTTGGGAGG + Intronic
1078351822 11:10601262-10601284 TGTCATCTCCTGCAGTGTGGTGG - Intronic
1079187585 11:18251253-18251275 TGTAATCCCAAGTACTTGGGGGG + Intergenic
1079439322 11:20494453-20494475 TGTAATCCCAAGTACTTGGGAGG - Intronic
1079595961 11:22246732-22246754 TGTAATCTCAGCTACTTTGGAGG + Intronic
1079596454 11:22254774-22254796 TGATAATTCCAGCACTTTGGGGG + Intronic
1079687148 11:23373430-23373452 TGTAGTCTCAAATACTTTGGAGG + Intergenic
1079731875 11:23943083-23943105 TGTAATCTCAGGTACTCTGGAGG + Intergenic
1079956283 11:26869441-26869463 TGTAATCTCAACTACTTGGGAGG - Intergenic
1080155265 11:29103365-29103387 TGTAATTCCCAGCACTTTCAGGG - Intergenic
1080275088 11:30494614-30494636 TGTAATCCCAGGTACTTTGGAGG + Intronic
1081745367 11:45469138-45469160 TGTAATCTCAACTACTTGGGAGG - Intergenic
1081970200 11:47193116-47193138 TGTAATCTCAACTACTTTGGTGG - Intergenic
1082058786 11:47842864-47842886 TGTAATCTCAGCCACTTGGGAGG + Intronic
1083018666 11:59483224-59483246 TGTAATCTCAACTACTTGGGAGG + Intergenic
1083456945 11:62785654-62785676 TGTAATCTCAACTACTTGGGAGG - Intronic
1083791248 11:64987546-64987568 TGTAATCCCCACTACTTGGGAGG + Intergenic
1083984699 11:66205889-66205911 TGTAAATCCCAGCACTTGGGAGG + Intronic
1084107696 11:66990753-66990775 TGTAATCTCAGGTACTTGGGAGG + Intergenic
1084283292 11:68113867-68113889 TGTAATCTCAAGAACTCAGGAGG + Intronic
1084330701 11:68428390-68428412 TCTGGTCTCCAGCACATTGGGGG - Intronic
1084340894 11:68499828-68499850 TATAATCCCTAGCACTTTGGAGG - Intronic
1084552732 11:69856917-69856939 TGTAATCCCAACCACTTGGGAGG - Intergenic
1085094388 11:73747459-73747481 TGTAATTCCCAGCACTTGGGAGG - Intronic
1085542925 11:77289239-77289261 TGTAATCCCAAGTACTTGGGAGG + Intronic
1085874508 11:80389604-80389626 TGTATACACCAGCATTTTGGGGG - Intergenic
1086097796 11:83068001-83068023 TGTAATCTCAACTACTTGGGAGG + Intronic
1086490207 11:87351937-87351959 TTGAATCTCCAGGACTTTGATGG - Intergenic
1086673498 11:89575059-89575081 TGTAATCCCCACTACTCTGGAGG + Intergenic
1086798238 11:91136322-91136344 TGTAATCCCCACTACTCTGGAGG + Intergenic
1087162218 11:94959747-94959769 TCTAATCTTCAGCTTTTTGGGGG + Intergenic
1087406658 11:97739609-97739631 TGTAATCTCAACTACTCTGGAGG - Intergenic
1088090101 11:106027943-106027965 TGTAATCTCAACTACTTGGGAGG - Intergenic
1088221442 11:107574421-107574443 TTTAAATCCCAGCACTTTGGGGG - Intergenic
1088240842 11:107772476-107772498 TGTAATCTCAACTACTTGGGAGG - Intergenic
1088246720 11:107825624-107825646 TGTAATCCCAACAACTTTGGGGG - Intronic
1088345231 11:108816672-108816694 TGTAATCTCCACTACTTGGGAGG - Intronic
1088650784 11:111956609-111956631 TGTAATCCCAACTACTTTGGAGG - Intronic
1088656386 11:112003920-112003942 TGTAATCTCAACTACTTGGGAGG + Intronic
1088885724 11:114004934-114004956 TGTAATCTCAGCTACTTTGGAGG - Intergenic
1089253356 11:117180655-117180677 TGTAATCTCAACTACTTGGGAGG - Intronic
1089791303 11:120946402-120946424 TGTAATCCCAGCCACTTTGGAGG + Intronic
1090004942 11:122993568-122993590 TGTAATCTCAGGTACTTGGGAGG + Intergenic
1090779077 11:129990727-129990749 TATAAATCCCAGCACTTTGGGGG - Intronic
1091700886 12:2660999-2661021 TGTAATCTCAACAACTTGGGAGG + Intronic
1092188580 12:6500167-6500189 TGTAATCCCAACCACTTGGGAGG + Intronic
1092358398 12:7816020-7816042 TGTAATCTCAGGTACTTGGGAGG - Intronic
1092494872 12:8983520-8983542 TGTAATCTCAGGTACTCTGGAGG - Intronic
1092604589 12:10104455-10104477 TGTAATCCCCACTACTTGGGAGG + Intronic
1092607293 12:10134399-10134421 TGTAATCTCAGCCACTTGGGAGG + Intergenic
1092614185 12:10201316-10201338 TGTAATCCCCACCACTCGGGAGG - Intergenic
1092742479 12:11643469-11643491 TGTAATCTCAACTACTTGGGAGG - Intergenic
1093149594 12:15605314-15605336 TGTCCTCTCCAGCTCTTAGGAGG - Intergenic
1093314568 12:17632496-17632518 TGTAATCTCAGGTACTTGGGAGG - Intergenic
1093469721 12:19487594-19487616 TGTAATCTCAGGTACTTGGGAGG + Intronic
1094108061 12:26833605-26833627 TTTCATCTCCAGCAGTTCGGGGG - Intergenic
1095427662 12:42094399-42094421 TGTAATCTCAGCCACTATGGAGG + Intronic
1095763154 12:45863975-45863997 TGTAGTCTCAGTCACTTTGGAGG - Intronic
1096431443 12:51547200-51547222 TGTAATCCCCAGCACTTTGGGGG + Intergenic
1096444918 12:51680880-51680902 TGTAATCTCAAGTACTGGGGAGG + Intronic
1097440640 12:59603743-59603765 TGTCATCTTTAGCATTTTGGTGG + Intronic
1097665731 12:62475356-62475378 TGTAATCCCAGCCACTTTGGAGG - Intronic
1098012065 12:66063663-66063685 TGCATTCTCCAACACTTTTGGGG - Intergenic
1098557024 12:71830705-71830727 TGTAATTCCCAGCACTTTCAAGG - Intergenic
1098971208 12:76858753-76858775 TTTATTCACCAGCATTTTGGGGG - Exonic
1099002681 12:77198993-77199015 TGTAGTCTCAACCACTTTGGAGG - Intergenic
1099237385 12:80097742-80097764 TGTAATCCCCACTACTTAGGAGG + Intergenic
1099454788 12:82850500-82850522 TGCAATTTCCACCTCTTTGGTGG - Intronic
1100542785 12:95573827-95573849 TGTGATCTCAAGCCATTTGGGGG - Intergenic
1100826939 12:98483556-98483578 TGTAATCCCAAGTACTTGGGAGG + Intergenic
1101541290 12:105667880-105667902 TCTAATCCTCAGAACTTTGGGGG + Intergenic
1101666292 12:106818703-106818725 TGTAATCTCAACTACTTGGGAGG - Intronic
1101983424 12:109427192-109427214 TGTAATCCCCACTACTTGGGAGG + Intronic
1102152181 12:110696456-110696478 TGGAATCCCAATCACTTTGGAGG + Intronic
1102194878 12:111018012-111018034 TGTAGTCTCAGGCACTTGGGAGG + Intergenic
1102359082 12:112268078-112268100 TGTAATCCCCAGCACTTTGAGGG - Intronic
1102376407 12:112425108-112425130 TGTAATCTCCAGCACTTTGGAGG - Intronic
1102458096 12:113083445-113083467 TGTAATCTCCACTACTTGGGAGG - Intronic
1103490085 12:121310810-121310832 TGTAATCTCAGTTACTTTGGTGG + Intronic
1103550658 12:121734789-121734811 TGTAATCCCAGGTACTTTGGAGG + Intronic
1103634058 12:122288152-122288174 TGTAATCTCAACTACTTGGGAGG - Intronic
1103817874 12:123672926-123672948 TGTAATCTCAGCTACTTTGGAGG + Intronic
1104116679 12:125755887-125755909 TTTAAGCTCATGCACTTTGGGGG - Intergenic
1104347195 12:128011191-128011213 TGTAATCTCAGGTACTTGGGAGG - Intergenic
1105423897 13:20277085-20277107 TGTAATCTCAGGTACTCTGGAGG + Intergenic
1106484472 13:30160054-30160076 TGTAATCCCCGCTACTTTGGAGG + Intergenic
1106792183 13:33166871-33166893 TGTAATCTCAACTACTTGGGAGG + Intronic
1106951971 13:34894499-34894521 TGTAATCTCAGCTACTTTGGGGG - Intergenic
1107088622 13:36451799-36451821 TGTAATCTCAACTACTTGGGAGG - Intergenic
1107258652 13:38462981-38463003 TGTAATCTCAACTACTTAGGAGG + Intergenic
1108205474 13:48084986-48085008 TGTAATCTCAGGTACTTGGGAGG - Intronic
1108295338 13:49011353-49011375 TGTGATCTCCGCCACTTGGGAGG - Intronic
1108730230 13:53227741-53227763 TGTAGTCCCCACCACTTGGGAGG + Intergenic
1109278729 13:60331057-60331079 TGTAATCCCAACCACTTGGGAGG + Intergenic
1109327461 13:60885558-60885580 TGACATCTCCAGCACTTTGCAGG - Intergenic
1110261083 13:73486070-73486092 TGTAATCCCAAGTACTTGGGAGG - Intergenic
1111015702 13:82378904-82378926 TCCAATCACCATCACTTTGGGGG - Intergenic
1111360269 13:87167088-87167110 TGTAATCTCAGGTACTTGGGAGG + Intergenic
1111592858 13:90372117-90372139 TGTAATCATGAGCACTTGGGAGG + Intergenic
1111632203 13:90856508-90856530 TGTATTCTCCAGGAGTATGGAGG - Intergenic
1111877095 13:93910882-93910904 TGTGATCTACAGTACTATGGGGG - Intronic
1112361020 13:98718685-98718707 TGTAATCTCAACTACTTGGGAGG + Intronic
1112480502 13:99770841-99770863 TGTAATCTCAACCACTTGGGAGG - Intronic
1113027694 13:105959130-105959152 TGTAATCTCCACTACTTGGGAGG - Intergenic
1113556291 13:111238394-111238416 TCTAAGGTCCAGCACTTTGCTGG - Intronic
1115649600 14:35393568-35393590 TGTAATCCCCGCCACTTGGGAGG - Intergenic
1116509410 14:45725486-45725508 TGTAATCTCAACTACTTGGGAGG - Intergenic
1116741281 14:48758245-48758267 TCTCATCTCCTGCAGTTTGGAGG + Intergenic
1117120842 14:52566989-52567011 TGTAATCTCAACTACTTGGGAGG + Intronic
1117443000 14:55777580-55777602 TGTAATCTCAACTACTTGGGAGG - Intergenic
1118082373 14:62375476-62375498 TGTAGTCCCAACCACTTTGGAGG + Intergenic
1118106691 14:62667994-62668016 TGTAATCTCCGCTACTTGGGAGG - Intergenic
1118282018 14:64438128-64438150 TGTAAATCCCAGCACTTTGGGGG - Intronic
1118300499 14:64611293-64611315 TCTAATCTCCACCATTATGGTGG - Intergenic
1118369966 14:65129470-65129492 TGTAATCTCAAATACTTGGGAGG + Intergenic
1118550262 14:66942131-66942153 TGTAATCTCAGGTACTTGGGAGG - Intronic
1118681606 14:68247199-68247221 TTTATTCACCAGCATTTTGGGGG + Intronic
1119305108 14:73601440-73601462 TGTAATCCCCACAACTTGGGAGG + Intergenic
1119507321 14:75184091-75184113 TGTAGTCCCCAGCACTGGGGAGG - Intergenic
1119507415 14:75185004-75185026 TGTAATCTCAGGTACTTGGGAGG + Intergenic
1119580493 14:75774808-75774830 TGTAATCTCCGCTACTTGGGAGG - Intronic
1119833008 14:77720254-77720276 TGTAATCCCCACTACTTGGGAGG - Intronic
1120236520 14:81897944-81897966 TGTAATCTCAGCCACTTGGGAGG - Intergenic
1120274541 14:82354870-82354892 TGTAATCTCAGCTACTTTGGAGG + Intergenic
1120855343 14:89207097-89207119 TGTAATCCCCACTACTTGGGAGG + Intronic
1120950663 14:90038714-90038736 TGTAATCCCAAGTACTTGGGTGG + Intronic
1121080649 14:91105191-91105213 TGTAATCCCCACTACTTAGGAGG + Intronic
1122735681 14:103839368-103839390 TGTTAACCCCAGCACTTTGGGGG + Intronic
1123159362 14:106263048-106263070 TGTAATCTCAACTACTTGGGGGG + Intergenic
1202838706 14_GL000009v2_random:100205-100227 TGTAATCCCAAACACTTGGGAGG + Intergenic
1202908064 14_GL000194v1_random:90271-90293 TGTAATCCCAAACACTTGGGAGG + Intergenic
1125029664 15:35063508-35063530 TGTAATCCCAACCACTTGGGAGG - Intergenic
1125303423 15:38282383-38282405 TGTAATTCCCACCACTTGGGAGG + Intronic
1125595492 15:40882967-40882989 TGTAATCTCAACTACTTGGGAGG - Intergenic
1126066960 15:44833327-44833349 TGTAATCTCCACTACTTAGGAGG - Intergenic
1126092870 15:45067238-45067260 TGTAATCTCCACTACTTAGGAGG + Intronic
1126614069 15:50558569-50558591 TGTAATCTCAGCTACTTTGGAGG + Exonic
1126962540 15:54013728-54013750 TGAGATCTCCAGCAGTGTGGAGG + Exonic
1127356429 15:58205201-58205223 TGTCATCTCCAGGACTGTGTTGG - Intronic
1127371809 15:58348511-58348533 TATTCTCTCCAGCACTATGGAGG - Intronic
1127380823 15:58429289-58429311 TGTACTCTGCAGAAATTTGGGGG + Intronic
1127486152 15:59419750-59419772 TGTAATCTCAACTACTTGGGAGG + Intronic
1127501881 15:59561439-59561461 TGTAATTCCCAGCACTTTGGAGG + Intergenic
1127881064 15:63158694-63158716 TGTAATCTCAGGTACTTGGGAGG - Intergenic
1127935047 15:63629069-63629091 TGTAATCTCAGCCACTTGGGAGG - Intronic
1128360520 15:66958521-66958543 TGTAATCCCCAGCACTTCGGAGG + Intergenic
1128851566 15:70963007-70963029 TGTTAATTCCAGCACTTTGGGGG + Intronic
1129136602 15:73558080-73558102 TGTAGTCCCAAGCACTTTGGGGG + Intronic
1129195624 15:73964558-73964580 TGTAATCCCAACCACTTGGGAGG - Intergenic
1129455143 15:75672839-75672861 TGTTATCTCCAGCGCCTGGGAGG + Intergenic
1130313781 15:82777723-82777745 TGTAATCTCAACTACTTAGGAGG + Intronic
1130320213 15:82835378-82835400 TGTAACCCCCAGCATTTGGGAGG - Exonic
1131162945 15:90120332-90120354 TGTAATCTCAGGTACTCTGGAGG + Intergenic
1131553796 15:93379656-93379678 TATAATCCCCAGCACTTTTGGGG + Intergenic
1132609819 16:810045-810067 TGTAATCTCAGACACTTGGGAGG - Intronic
1132815718 16:1825693-1825715 TGTAGTCTCAGTCACTTTGGAGG - Intronic
1133185331 16:4092146-4092168 TGTAATCACCGGTACTTGGGAGG + Intronic
1133268916 16:4600990-4601012 TGTAATTTCAGCCACTTTGGAGG + Intergenic
1133625201 16:7564417-7564439 TGTAATCTCAAGTACTCAGGAGG + Intronic
1133813084 16:9176507-9176529 TGTAATCTCAGGTACTTGGGAGG - Intergenic
1133940709 16:10306868-10306890 TGTAATCTCAGCTACTTTGGAGG + Intergenic
1134003981 16:10805151-10805173 TGTAATCCCCACTACTTGGGAGG - Intronic
1134014918 16:10881155-10881177 TGTAATCTCAACTACTTGGGAGG + Intronic
1134252715 16:12585759-12585781 TGTAGTCTCAGGCACTTGGGAGG + Intergenic
1134622375 16:15699218-15699240 TGTAACCCCCAGCACTTGGGAGG - Intronic
1134677552 16:16101288-16101310 TGTAATCCCCAGCACTTTCAAGG - Intronic
1135058213 16:19248698-19248720 TGTAATCCCAGGTACTTTGGAGG + Intronic
1135196624 16:20400194-20400216 TGTAATCTCAACTACTTGGGAGG - Intronic
1135257927 16:20956183-20956205 TGTAAATCCTAGCACTTTGGGGG - Intronic
1135407531 16:22208639-22208661 TGTAATCCCAGCCACTTTGGGGG + Intronic
1135472747 16:22746152-22746174 TGTAATCTCAGCTACTTTGGAGG + Intergenic
1135670345 16:24370123-24370145 TGTAAATCCCAACACTTTGGGGG - Intergenic
1136013453 16:27379766-27379788 TGTAATCTCAACTACTTGGGAGG - Intergenic
1136123952 16:28162811-28162833 TGTAAATCCCAGCACTTTGGGGG - Intronic
1136179293 16:28539799-28539821 TGTAATCTCCCTCACCTAGGAGG + Intergenic
1136282828 16:29223872-29223894 TGTAATCCCAAGTACTTGGGAGG + Intergenic
1136489563 16:30597942-30597964 TGTAATCTCAACTACTTGGGAGG - Intergenic
1137281501 16:46980740-46980762 TGTAATCCCCACTACTTGGGAGG - Intergenic
1137324414 16:47419722-47419744 TGTAATCTCAGGTACTTGGGAGG - Intronic
1137361738 16:47823430-47823452 TGTAATCTCAGCCACTTGGGAGG + Intergenic
1137795674 16:51215970-51215992 TGTAATCCCAAGTACTTGGGAGG + Intergenic
1138056422 16:53838715-53838737 TGTAATCCCCACCACTCAGGAGG + Intronic
1138056920 16:53844715-53844737 TGTAAATCTCAGCACTTTGGGGG - Intronic
1138330745 16:56213586-56213608 TGTAATCTCAGCCACTTGGGAGG - Intronic
1138373822 16:56548773-56548795 TGTAATCTCAACTACTTGGGAGG - Intergenic
1138971572 16:62150586-62150608 TGTAATCCCAAGTACTTGGGAGG - Intergenic
1139389695 16:66599166-66599188 TGTAATCTCAACTACTTGGGAGG + Intergenic
1139562370 16:67751365-67751387 TGTAATCCCAAGCACTTGGGAGG + Intronic
1140311147 16:73849852-73849874 TGTAATCCCCGCCACTTGGGAGG - Intergenic
1140465613 16:75179668-75179690 TGTAATCCCCCCTACTTTGGAGG + Intergenic
1141042983 16:80688135-80688157 TGCAACCTCCAGTAATTTGGAGG - Intronic
1141107231 16:81243588-81243610 TGTAATCCCAACCACTCTGGAGG - Intronic
1141502017 16:84450842-84450864 TGTCATCTCCAGCAGTCTTGGGG - Intronic
1141505249 16:84472586-84472608 TGTAATCCCCACTACTTGGGAGG + Intergenic
1142087207 16:88189795-88189817 TGTAATCCCAAGTACTTGGGAGG + Intergenic
1142188311 16:88705396-88705418 TGTATTATTCAGCACTTAGGAGG + Intronic
1142877830 17:2862873-2862895 TGTAATCTCAACTACTTGGGAGG + Intronic
1142999734 17:3785345-3785367 TGTAATCCCAACCACTTGGGAGG + Intronic
1143007177 17:3844726-3844748 TGTAATCTCAACTACTTGGGAGG + Intronic
1143412883 17:6722634-6722656 TGTAATCTCAACTACTTGGGAGG + Intergenic
1144030436 17:11316540-11316562 TGTAATCCCCATTACTTGGGAGG - Intronic
1144066799 17:11631521-11631543 TGTAATCTCAATTACTTGGGAGG + Intronic
1144478334 17:15608573-15608595 TGTAATCCCCACTACTTAGGAGG - Intronic
1144605474 17:16661894-16661916 TGTAATCTCAGGTACTTGGGAGG - Intergenic
1144694425 17:17292430-17292452 TGTAATCTCAACTACTTGGGAGG - Intergenic
1144785452 17:17828790-17828812 TGTAGTCTCCATTACTCTGGAGG + Intronic
1144919960 17:18755139-18755161 TGTAATCCCCACTACTTAGGAGG + Intronic
1145200428 17:20939860-20939882 TGTAATCCCAGGTACTTTGGAGG + Intergenic
1145893035 17:28431761-28431783 TGTAGTCTCAACTACTTTGGAGG - Intergenic
1145952659 17:28831626-28831648 TGTAATCCCAGGTACTTTGGAGG - Intronic
1146080549 17:29776436-29776458 TGTAATGTCCATCACAGTGGTGG - Intronic
1146215212 17:30973587-30973609 TGTAATCCCAAATACTTTGGAGG - Intronic
1146387777 17:32392571-32392593 TGTAATCCCCGGTACTCTGGAGG + Intergenic
1146594882 17:34159661-34159683 TCTAAGCTCCATCATTTTGGAGG - Intronic
1146723731 17:35141289-35141311 AGTAATCCCCAGCACTTTGGAGG + Intronic
1147569763 17:41562050-41562072 TGTAATCTCAGGTACTTGGGAGG - Intergenic
1147708474 17:42445527-42445549 TGTAATCTCAAGTACTCGGGAGG + Intergenic
1147816360 17:43213449-43213471 TGTATTCTCCAGCCCCTTGTGGG + Intronic
1147834540 17:43320634-43320656 TGTAATCCCCACTACTTGGGAGG - Intergenic
1147930602 17:43978072-43978094 TGTAATCTACACTACTTGGGAGG + Intronic
1148159548 17:45442116-45442138 TGTCCTCTCCAGCCCTTGGGAGG - Intronic
1148176047 17:45566180-45566202 TGTAATCCCAAGTACTTGGGAGG - Intergenic
1148295322 17:46496791-46496813 TGTAATCCCAAGTACTTGGGAGG + Intergenic
1148359814 17:47002510-47002532 TGTAATCTCAACTACTTGGGAGG - Intronic
1148376771 17:47155365-47155387 TGTAATCCCAGGTACTTTGGGGG - Intronic
1148527592 17:48355703-48355725 TGTAATCTCAACTACTTGGGTGG + Intronic
1148731980 17:49842406-49842428 TGTAATCTCAACTACTTGGGAGG + Intronic
1148811812 17:50297752-50297774 TGTAATCCCAAGCACTTTGGGGG + Intergenic
1149430172 17:56591428-56591450 TGTAATCCCAAGTACTTGGGAGG - Intergenic
1149450270 17:56744686-56744708 TGTAATCCCAACTACTTTGGAGG + Intergenic
1150098372 17:62399287-62399309 TGTAATCTCAGGCATTTGGGAGG - Intronic
1150407278 17:64913148-64913170 TGTAATCCCAAGTACTTGGGAGG - Intronic
1150572192 17:66396748-66396770 TGTAATCTCAGCTACTTTGGAGG - Intronic
1150800429 17:68277549-68277571 TGTAATCCTCAGTACTTGGGAGG - Intronic
1151790389 17:76302018-76302040 TGTAATCCCAAGCACTTGGGAGG - Intronic
1152440386 17:80305133-80305155 TGTAATCCCCACAACTTGGGAGG - Intronic
1152917152 17:83046249-83046271 TGTAATCTCAGCCACTTGGGAGG - Intronic
1153180744 18:2430039-2430061 TGTAATCTCAGGTACTTGGGAGG - Intergenic
1153233159 18:2960046-2960068 TGTAATCCCAGGCACTTGGGAGG + Intronic
1153436780 18:5076474-5076496 TGTAATCCCCACTACTTAGGAGG + Intergenic
1153648712 18:7220069-7220091 TGTAATCCCCACTACTTAGGAGG - Intergenic
1153830183 18:8914930-8914952 TGTTCTCTCAACCACTTTGGTGG - Intergenic
1154326208 18:13392551-13392573 TGAAATCTCCACCACTATGACGG - Intronic
1154378971 18:13832592-13832614 TGTAATCTCAGGTACTTGGGAGG + Intergenic
1154393643 18:13967108-13967130 TGTAATCCCAGACACTTTGGGGG + Intergenic
1155201358 18:23520579-23520601 TGTAATCCCCACTACTTGGGAGG - Intronic
1155209824 18:23590874-23590896 CCTATTATCCAGCACTTTGGAGG - Intergenic
1155933596 18:31731471-31731493 TCTACTCTTCAGCACTTTGTTGG + Intergenic
1156262711 18:35459746-35459768 TGTAATCTCAGCCACTTGGGAGG + Intronic
1157296980 18:46452534-46452556 TGTAATCTCAACAATTTTGGAGG - Intronic
1157391184 18:47304695-47304717 TGTAATCTCCGCTACTTGGGAGG + Intergenic
1158060784 18:53338478-53338500 TGTAATCTCAGCCACTTGGGAGG + Intronic
1158433465 18:57414991-57415013 TGTTAATACCAGCACTTTGGGGG + Intergenic
1158513945 18:58115548-58115570 TCTAATTTCCAGAACTCTGGTGG + Intronic
1158691139 18:59661843-59661865 TGTAATCCCCACTACTTGGGAGG + Intronic
1158962461 18:62597749-62597771 TGTAATCTCAGGTACTTGGGAGG + Intergenic
1159344033 18:67175593-67175615 TGTAATCTCAGGTACTTGGGAGG + Intergenic
1160198112 18:76773847-76773869 TGTAATCTCAGCCACTTGGGAGG + Intergenic
1161367365 19:3887991-3888013 TGTAATCCCCAGTACTCGGGAGG + Intronic
1161549464 19:4903622-4903644 TGTAATCTCAGGTACTTGGGGGG - Intronic
1161676953 19:5656696-5656718 TGTAATCTCAGTTACTTTGGAGG - Intronic
1162049185 19:8022091-8022113 TGTAATCTCAACCACTCAGGAGG - Intronic
1162235730 19:9307824-9307846 TGTAATCGCCACTACTTGGGAGG + Intronic
1162451070 19:10755580-10755602 TGTAATCGCAACCACTTGGGAGG - Intronic
1162533105 19:11247208-11247230 TGTAATCCCCACTACTTGGGAGG - Intronic
1162774467 19:12970800-12970822 TGTAATCTCAATTACTTGGGAGG - Intronic
1163384762 19:16992807-16992829 TGTAATCTCAGGTACTTGGGAGG + Intronic
1163410170 19:17149233-17149255 TGTAATCCCCAGAGCTTTGGGGG - Intronic
1163468070 19:17481045-17481067 TGTAATCCCAACCACTTGGGAGG - Intronic
1163989055 19:20981347-20981369 TGTAATCTCAGCTACTTTGGAGG + Intergenic
1164213932 19:23127066-23127088 AATAATCTGCAGCACTTTTGTGG + Intronic
1164852607 19:31497276-31497298 TGTAATCCCAGGCACTTGGGAGG - Intergenic
1164956969 19:32394682-32394704 TGTAATCTCAGACACTTGGGAGG + Intergenic
1165066121 19:33229570-33229592 TGTAATTTTCACCATTTTGGTGG - Intergenic
1165150253 19:33756077-33756099 TTCGCTCTCCAGCACTTTGGGGG - Intronic
1165240051 19:34459140-34459162 TGGAATCTGCAGCACAGTGGTGG + Intronic
1166081302 19:40445440-40445462 TGTAATCTCAGCCACTTGGGAGG + Intergenic
1166696120 19:44852269-44852291 TGTAATCCCCACTACTTGGGAGG - Intronic
1166915733 19:46194969-46194991 TGTAATCCCAACCCCTTTGGAGG - Intergenic
1167015319 19:46837539-46837561 TGTAATCTCAGCTACTTTGGAGG + Intergenic
1167094368 19:47366400-47366422 TGTAATCTCAACTACTTGGGAGG - Intronic
1168213511 19:54908749-54908771 TGTAATCTCAACTACTTGGGAGG - Intronic
1168330140 19:55563385-55563407 TTTAATCTCCAGCACTCTGTCGG - Intergenic
1168507280 19:56946893-56946915 TGTAATCTCAGCCACTTGGGAGG + Intergenic
1168602065 19:57726198-57726220 TGTAATCTCAACTACTTGGGAGG + Intronic
925511153 2:4626756-4626778 TGTAATCTCAGCCACTTGGGAGG - Intergenic
925660792 2:6200091-6200113 TGTAATCCCCACTACTTGGGAGG - Intergenic
926182840 2:10661195-10661217 TGTAATCCCAAGTACTTGGGAGG - Intronic
926345263 2:11939029-11939051 TGTAATCTCAAGTACTTGGGAGG - Intergenic
927020341 2:19010184-19010206 TGTAATCTTTGGCAGTTTGGGGG - Intergenic
927298025 2:21477404-21477426 TGTAATTCCCAGCATTTGGGAGG + Intergenic
927357452 2:22189254-22189276 TGTAATCTCAGGTACTTGGGAGG + Intergenic
927546203 2:23955984-23956006 TGTAATCTCCACTACTCAGGAGG - Intronic
928391321 2:30913099-30913121 TGTGATCTCTGGTACTTTGGAGG - Intronic
928860943 2:35856329-35856351 TGTAATCTCAGCCACTTGGGAGG + Intergenic
929126186 2:38524497-38524519 TGTTAATCCCAGCACTTTGGAGG - Intergenic
929309346 2:40404149-40404171 TGTAATCCTCAGTACTTTGGAGG - Intronic
929471751 2:42200830-42200852 TGAAATTTCCAGCGCTTTGCAGG + Intronic
929686695 2:44041293-44041315 TGTAATCCCCACTACTTGGGAGG - Intergenic
929985748 2:46730476-46730498 TGTAATCCCAGCCACTTTGGAGG + Intronic
931063976 2:58563454-58563476 TGTAATCCCCACTACTTGGGAGG + Intergenic
931137376 2:59418252-59418274 TGTAATCCCCACTACTTGGGAGG - Intergenic
931605150 2:64045167-64045189 TGTAATCTCAACTACTTGGGAGG - Intergenic
932119561 2:69085803-69085825 TCAAATCACCAGCACTTAGGTGG + Intronic
932537829 2:72618245-72618267 TGTAATCTCAGCCACTTGGGAGG + Intronic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
933853318 2:86388689-86388711 TGTAATCTCAACTACTTGGGAGG + Intergenic
933885440 2:86715540-86715562 TGTAATCTCAACTACTTGGGAGG + Intronic
933891936 2:86780163-86780185 TGTACTTTCCAGCAGTTTGTAGG - Intergenic
933924736 2:87081151-87081173 TGTAATCTCAACTACTTGGGAGG - Intergenic
934134196 2:88979551-88979573 TGTAATCCCAGGCACTTGGGAGG - Intergenic
934687075 2:96328876-96328898 TGTTAATCCCAGCACTTTGGGGG + Exonic
935045982 2:99482893-99482915 TGTAATCTCAACCACTTGGGAGG + Intronic
935783394 2:106527660-106527682 TGTAATCTCAACTACTTGGGAGG + Intergenic
938828107 2:135026987-135027009 TGTAATCTCCACAGCTTGGGAGG + Intronic
939343828 2:140936216-140936238 TGTAATCTCAGCTACTTTGGAGG + Intronic
940632884 2:156260776-156260798 TGTAATCCCAACCACTTGGGAGG + Intergenic
940782624 2:157949087-157949109 TGTAATCTCAACTACTTGGGAGG - Intronic
941113556 2:161445345-161445367 TGTAAGCCCAAGCACTTGGGGGG - Intronic
942012480 2:171776615-171776637 TGTAATCTCAGCCACTTGGGAGG + Intergenic
942026923 2:171920122-171920144 TGTAATCTCAACTACTTGGGAGG - Intronic
942670861 2:178375542-178375564 TGTAATCCCCACTACTTGGGAGG - Intronic
943033495 2:182713507-182713529 TGTAATCCCCACTACTTGGGAGG + Intergenic
943043735 2:182833114-182833136 TGTAATCCCCACTACTTGGGAGG - Intergenic
943043797 2:182833885-182833907 TGTAATCTACAGCATTTTTATGG + Exonic
943110680 2:183601355-183601377 TGTAATCGCAAGCACTCTGGGGG - Intergenic
943253477 2:185562402-185562424 TGTAATCTTCAGCTGTTAGGTGG - Intergenic
943265929 2:185732375-185732397 TCTAATCTCCAGAACTGTGAGGG + Intergenic
943525971 2:189017763-189017785 TGTAATCTCAGCCACTTGGGAGG + Intergenic
944246948 2:197541020-197541042 TGTAATCTCAGCCACTTGGGAGG - Intronic
944325327 2:198397730-198397752 TGTAATCTCAGGTACTTGGGAGG + Intronic
944575436 2:201086929-201086951 TGTAATCCCAAGTACTTGGGAGG + Intergenic
944705041 2:202280452-202280474 TGTAATCTCAGCTACTTTGGAGG - Intronic
944726460 2:202475950-202475972 TGTAATCTCAGCCACTTGGGAGG + Intronic
944976145 2:205053516-205053538 TGTAATCCCAAGCACTTGAGAGG + Intronic
945252450 2:207775938-207775960 TATAATCTCCACCACATTGTAGG - Intergenic
945313905 2:208349039-208349061 TGTAATCTCAACTACTTGGGAGG + Intronic
945489489 2:210438254-210438276 TGTAATCCCAAGTACTTGGGAGG - Intronic
945524232 2:210868255-210868277 TGTAATCTCAGGTACTTGGGAGG - Intergenic
945893756 2:215459118-215459140 TGTAATATCAAGTTCTTTGGGGG - Intergenic
946840076 2:223811212-223811234 TGTAATCTCAGGTACTTGGGAGG - Intronic
946986377 2:225278261-225278283 TGTAATCTCAGCCACTTGGGAGG - Intergenic
947003860 2:225488493-225488515 TGTAATCTCAACTACTTGGGAGG - Intronic
947003974 2:225489452-225489474 TGTAATCTCAACCATTTGGGAGG - Intronic
947210920 2:227707847-227707869 TGTAATCTCAACTACTTGGGAGG - Intronic
947504136 2:230694034-230694056 TGTAATCTCCACTACTTGGGAGG - Intergenic
947582259 2:231327904-231327926 TGTAATCCCAACTACTTTGGAGG - Intronic
947938584 2:234028267-234028289 TGTAATCTCAGCTACTTTGGAGG - Intergenic
948060487 2:235040111-235040133 TGTAATCTCAGCTACTTTGGAGG + Intronic
948448781 2:238055402-238055424 TGTAATCTCAATTACTTGGGAGG + Intronic
948498290 2:238369754-238369776 TGTAATTACTAGCATTTTGGAGG + Intronic
948500512 2:238389624-238389646 TGTAATCTCAACTACTTGGGAGG + Intronic
948633291 2:239316340-239316362 TGTAAATCCCAGCACTCTGGGGG + Intronic
949039693 2:241842434-241842456 TGTAATCTCAGGTACTTGGGAGG - Intergenic
1169048279 20:2555200-2555222 TGTAATCTCAGCTACTTTGGAGG - Intronic
1169332127 20:4724459-4724481 TAAAATCTCCTGCACTTGGGAGG + Intronic
1169420653 20:5456430-5456452 TGTAATCCCAACTACTTTGGAGG + Intergenic
1170209039 20:13829518-13829540 TGTAATCCCAAGTACTTGGGAGG + Intergenic
1170391976 20:15885017-15885039 TCTAATCACCATCACCTTGGAGG + Intronic
1170457965 20:16551250-16551272 TGTAATCTCCGCTACTTAGGAGG - Intronic
1171070959 20:22068127-22068149 TGTAATCCCCACTACTTGGGAGG - Intergenic
1171445283 20:25198352-25198374 TGTAATCTCAGGTACTTGGGAGG + Intronic
1171950491 20:31417221-31417243 TGTAATCTCAGGTACTTGGGAGG + Intergenic
1172073393 20:32275814-32275836 TGTAATCCCCACTACTTTGGAGG - Intergenic
1172453360 20:35045658-35045680 TGTAATCCCCACTACTTGGGAGG - Intronic
1172927537 20:38552399-38552421 TGTAATTCTCAGCACTTTGAGGG - Intronic
1173550384 20:43929035-43929057 TGTAATCTCAACTACTTGGGAGG + Intronic
1173812843 20:45966971-45966993 TGTAATCTCAACTACTTGGGAGG - Intronic
1173970257 20:47147168-47147190 TGTAATCTCAACTACTTGGGAGG - Intronic
1174205712 20:48836791-48836813 TGTAATCCCCACTACTCTGGAGG + Intergenic
1174212206 20:48888681-48888703 TGTAATCTCAACTACTTGGGAGG + Intergenic
1174329588 20:49807611-49807633 TGTAATCTCAACTACTTGGGAGG - Intergenic
1174346312 20:49932681-49932703 TGTAATCCCTAGCACTTTGGAGG + Intergenic
1174377582 20:50136599-50136621 TGTAATCTCAACTACTTGGGAGG + Intronic
1174797618 20:53535530-53535552 TGTAATCCCCGTCACTTGGGAGG - Intergenic
1174814682 20:53676423-53676445 TGTAATCTCAGGTACTCTGGAGG - Intergenic
1175112160 20:56656125-56656147 TGTAGTCTCAGGTACTTTGGAGG + Intergenic
1175182903 20:57161063-57161085 TGTAATCCCCTCCACTTGGGAGG - Intergenic
1175621085 20:60448199-60448221 TGTAATACGCAGCCCTTTGGAGG + Intergenic
1176162660 20:63655988-63656010 TGTAATCTCAGCTACTTTGGAGG + Intergenic
1176600593 21:8789991-8790013 TGTAATCCCAAACACTTGGGAGG - Intergenic
1176627425 21:9104954-9104976 TGTAATCCCAAACACTTGGGAGG + Intergenic
1176646542 21:9356151-9356173 TGTAATCCCAAACACTTGGGAGG - Intergenic
1176946250 21:14985537-14985559 TGGTAATTCCAGCACTTTGGGGG - Intronic
1177104369 21:16936519-16936541 TGTAATCCCCACCACTCTGGAGG - Intergenic
1177394729 21:20518420-20518442 TGTAATCTCAGGTACTTGGGAGG - Intergenic
1177558641 21:22721824-22721846 TGTAAATTCCAGCACTTTGGGGG - Intergenic
1177658950 21:24057072-24057094 TGTAATCTCAACTACTTGGGAGG + Intergenic
1177784368 21:25654524-25654546 TGTAATCTCAACTACTTGGGAGG + Intronic
1178229799 21:30768963-30768985 TGTAATCTCAGCCACTTGGGAGG - Intergenic
1178402136 21:32295852-32295874 TGTAATCTCAACTACTTGGGAGG + Intronic
1178543495 21:33475046-33475068 TGTAATCTCCGCTACTTGGGAGG - Intronic
1178712156 21:34927173-34927195 TGTAAACTCCAGCTCTTTAATGG - Intronic
1178860370 21:36284067-36284089 TGTAATCTCAGCTACTTTGGAGG - Intronic
1178945461 21:36943561-36943583 TGTAAATCCCAGCACTTTGCGGG + Intronic
1179302103 21:40121811-40121833 TGTAATCTCAGGTACTTGGGAGG - Intronic
1179770100 21:43608849-43608871 TGTAATCCCAAGTACTTGGGAGG + Intronic
1179892266 21:44341957-44341979 TGTAATCCCAACTACTTTGGAGG + Intergenic
1179900701 21:44392217-44392239 TGTAAATTCCAGCCTTTTGGAGG - Intronic
1180417770 22:12784554-12784576 TGTAATCCCAAACACTTGGGAGG + Intergenic
1181321743 22:22012611-22012633 TGTAAATCCCAGCACTTGGGAGG + Intergenic
1181565937 22:23737580-23737602 TGTAATCTCAGCTACTTTGGAGG + Intergenic
1182259278 22:29061386-29061408 TGTAATCTCAACTACTTCGGAGG - Intronic
1182579254 22:31294597-31294619 TGTAAATCCCAGCACTTGGGAGG + Intergenic
1182673331 22:32016551-32016573 TGTAATCTCAGCCACTTGGGAGG + Intergenic
1182814973 22:33154360-33154382 TGTAATCTCAGGTACTTGGGAGG - Intergenic
1183202447 22:36394948-36394970 TGTAATCCCCAGCATTTTGGAGG - Intergenic
1183216471 22:36483399-36483421 TGTAATCCCAAGTACTTGGGGGG - Intergenic
1183870279 22:40736654-40736676 TGTAATCTCAGCTACTTTGGAGG - Intergenic
1183882567 22:40847275-40847297 TGTAATCCCAAACACTTTGGAGG + Intronic
1184210598 22:43033236-43033258 TGTAATCTCAACTACTTAGGAGG + Intergenic
1184368782 22:44069388-44069410 TGAAATTTCCAGCACTCTGCTGG + Intronic
1185207477 22:49548405-49548427 TGTAATCTCCATTTCTTAGGTGG + Intronic
949464055 3:4325941-4325963 TGTAGTCTCCGCTACTTTGGAGG - Intronic
949705626 3:6813643-6813665 TGTAATCTCAACTACTTGGGAGG - Intronic
950317947 3:12021946-12021968 TGTAATCTCAGCTACTTTGGAGG + Intronic
950591418 3:13938260-13938282 TGTAATCCCCACTACTTGGGAGG - Intronic
950743373 3:15067262-15067284 TGTAATCTCAGCCACTTGGGAGG - Intergenic
950985651 3:17362591-17362613 TGTAATCTCAACTACTTGGGAGG - Intronic
951215564 3:20021672-20021694 TGTAATCCCAACCACTTGGGAGG + Intergenic
951401384 3:22236451-22236473 TGTAATCTCGATGACTTGGGAGG - Intronic
951477477 3:23123340-23123362 TGTAATCTCCACTACTCAGGAGG - Intergenic
951602992 3:24397702-24397724 TGTAATCTCAACTACTTGGGAGG - Intronic
951623218 3:24629542-24629564 TGTAATCTCGGCTACTTTGGAGG + Intergenic
951830624 3:26922309-26922331 TGTATTCTTTAGCACTATGGTGG - Intergenic
953302682 3:41794537-41794559 TGTAATCTCAACTACTTAGGAGG + Intronic
953314086 3:41909591-41909613 TGTAATCCCAACCACTTGGGAGG + Intronic
954474394 3:50730261-50730283 TGTAATCCCAACCACTTGGGAGG - Intronic
954788414 3:53112619-53112641 TGTAATCTCAACTACTTGGGAGG + Intronic
955295402 3:57730205-57730227 TGTAATCCCAACTACTTTGGAGG - Intergenic
955896193 3:63703569-63703591 TGTAATCTCAATTACTTGGGAGG - Intergenic
956665061 3:71634193-71634215 TGTAATCTCAACTACTTGGGAGG - Intergenic
956778120 3:72583202-72583224 TGTAATCCCAACTACTTTGGAGG - Intergenic
956821545 3:72958751-72958773 TGTAATCTCCGCTACTTGGGAGG - Intronic
957072499 3:75578074-75578096 TGTAATCCCAAGTACTTGGGAGG - Intergenic
959237932 3:103748447-103748469 TGTAATCTCAGCTACTTTGGAGG + Intergenic
959746644 3:109783161-109783183 TGTAATCTCCAGAACTCTAACGG - Intergenic
960124872 3:113987653-113987675 TGTAATCTCAGCTACTTTGGAGG - Intronic
960131760 3:114064091-114064113 TGTAATCTCAACTACTTGGGAGG + Intronic
960653266 3:119975323-119975345 TGTAATCTCAAATACTTGGGAGG + Intronic
961281577 3:125768701-125768723 TGTAGTCCCAAGTACTTTGGAGG + Intergenic
961579926 3:127872498-127872520 TGTAATCCCAAGTACTCTGGAGG - Intergenic
961872784 3:130000889-130000911 TGTAGTCCCAAGTACTTTGGAGG - Intergenic
962024867 3:131537403-131537425 TGTAATCTCAACTACTCTGGAGG - Intronic
962480707 3:135795844-135795866 TGTAAACTACGGCTCTTTGGAGG + Intergenic
962732338 3:138295018-138295040 TGTAATCCCAACCACTTCGGAGG - Intronic
962928227 3:140014473-140014495 TGTAATCTCAACAATTTTGGAGG - Intronic
963169603 3:142237477-142237499 TGTAATCCCCACTACTTGGGAGG + Intergenic
963423500 3:145093165-145093187 TTTATTCACCAGTACTTTGGTGG - Intergenic
963788262 3:149557190-149557212 TGTAATCTCAACTACTTGGGAGG - Intronic
963958726 3:151284728-151284750 TGTAATCCCAACCACTTGGGAGG - Intronic
964197725 3:154083561-154083583 TATATTTTCCAGCACATTGGAGG + Intergenic
964347499 3:155769188-155769210 TGTAATCTCAGCTACTTTGGAGG + Intronic
964726122 3:159816068-159816090 TGTAATCTCAACTACTTGGGAGG - Intronic
965376587 3:167931841-167931863 TGTAATCTCAGCCACTTGGGAGG + Intergenic
965389295 3:168085010-168085032 TGACATCTTCAGCACTTTGCTGG - Intronic
965412484 3:168349436-168349458 TGTAATCTCAACTACTTGGGAGG - Intergenic
965580394 3:170261603-170261625 TGTAATCCCAAGTACTTTGGAGG - Intronic
966185459 3:177222963-177222985 TGTAATCCCCACTACTTGGGAGG - Intergenic
966378028 3:179317010-179317032 TGTAATCCCAAGTACTTGGGAGG - Intergenic
966405352 3:179591952-179591974 TGTAATCTCAACTACTTAGGAGG - Intronic
966612153 3:181878412-181878434 TGTAATCCCAACCACTCTGGAGG - Intergenic
966734418 3:183177553-183177575 TGTAATCTCAACTACTTGGGAGG + Intergenic
966987451 3:185194488-185194510 TGTAATCCCCACTACTTGGGAGG + Intronic
967041484 3:185697360-185697382 TGTAAATCCCAGCACTTCGGAGG - Intronic
967059660 3:185860909-185860931 TGTAATCTCAGCTACTTTGGAGG + Intergenic
967488396 3:190060360-190060382 TGTAACCTCCAGAAAATTGGCGG - Intronic
967557389 3:190875892-190875914 TGTAATCTCAACTACTTGGGAGG - Intronic
967594277 3:191312028-191312050 TGTAATCTCAACTACTTGGGAGG + Intronic
967927762 3:194664796-194664818 TGTAATCTCAGCCACTTGGGAGG + Intronic
968065291 3:195755315-195755337 TGTAATCTCAAGTATTTGGGAGG - Intronic
968253216 3:197242463-197242485 TGTATTCTCCAGCAGTTGGGTGG - Intronic
1202740341 3_GL000221v1_random:48889-48911 TGTAATCCCAAACACTTGGGAGG + Intergenic
969016094 4:4105387-4105409 TGTAGTCCCAAGTACTTTGGAGG - Intergenic
969051712 4:4377941-4377963 TGTAATCTCCAGCACACTCCGGG + Intronic
969833043 4:9814016-9814038 TGTAATCTCAACTACTTGGGAGG + Intronic
970408463 4:15785683-15785705 TGTAGTTTCCAGCACATTGCAGG - Intronic
970621277 4:17821719-17821741 TGTAATCCCAACCACTTCGGGGG - Intronic
970698925 4:18711641-18711663 TGTAATCTCAGCTACTTTGGAGG - Intergenic
971332421 4:25693155-25693177 TGTAATCTCAACTACTTGGGAGG + Intergenic
972262985 4:37429434-37429456 TGTAATCTCAGGTACTTGGGAGG - Intronic
972384647 4:38553287-38553309 TGTAATCCCCACTACTCTGGAGG + Intergenic
972617255 4:40711506-40711528 TATAATTCCCAGCACGTTGGAGG - Intergenic
972656797 4:41071557-41071579 TGTAATCTCTTCCACTTGGGAGG + Intronic
973364024 4:49192739-49192761 TGTAATCCCAAACACTTGGGAGG - Intergenic
976177520 4:82370018-82370040 TGTAATCCCAACTACTTTGGAGG + Intronic
976514623 4:85950790-85950812 TGTAATCTCAGCCACTTGGGAGG - Intronic
977381798 4:96283849-96283871 TGTAATCCCAGGGACTTTGGAGG - Intergenic
977391903 4:96421363-96421385 TATAATATCTATCACTTTGGGGG - Intergenic
977759316 4:100712243-100712265 TGTAATCTCAACTACTTGGGAGG - Intronic
978233197 4:106425192-106425214 GATAATATCCAGCAATTTGGTGG + Intergenic
978369991 4:108020346-108020368 TGTAGTCTCCAGTACTTGGAAGG + Intronic
978430697 4:108630186-108630208 TTTAACCTCCAGCTCTCTGGGGG - Exonic
978440298 4:108727338-108727360 TGTAATCCCCATTACTTGGGAGG - Intergenic
978759046 4:112335132-112335154 TGTAATCCCTGGCACTTGGGAGG + Intronic
978885753 4:113764183-113764205 TGTAATCCCAGCCACTTTGGAGG + Intergenic
979830699 4:125297613-125297635 TGTAATCTCAGCCACTTGGGAGG - Intergenic
980102440 4:128554982-128555004 CTTAATGGCCAGCACTTTGGGGG + Intergenic
980123197 4:128748836-128748858 TGTAAATCCCAGGACTTTGGGGG - Intergenic
980126532 4:128779797-128779819 TGTAATCTCAATGACTTGGGAGG + Intergenic
980942158 4:139284982-139285004 TGTAATCCCAAGTACTTGGGAGG - Intronic
981457982 4:144978562-144978584 TGTAATCTCAACTACTTAGGAGG + Intronic
981758355 4:148166474-148166496 TGTAAATTCCAGAGCTTTGGTGG + Intronic
981948799 4:150380858-150380880 TGTAATCTCAACTACTTGGGAGG + Intronic
982841602 4:160194815-160194837 TGTGGTCTCCAGCTCTGTGGAGG + Intergenic
983621945 4:169771408-169771430 TGTAATCCCCGCCACTTGGGAGG - Intergenic
983669353 4:170217433-170217455 TGTAATCTCAGTCACTTGGGAGG + Intergenic
983851549 4:172587041-172587063 TGTAATATCCAGAAGTTTAGAGG + Intronic
984679639 4:182592601-182592623 TGTAATCTCAACTACTTGGGAGG + Intronic
984914197 4:184706245-184706267 TGTAATCTCAACTACTCTGGAGG + Intronic
985209102 4:187572823-187572845 TGTAATCTCCACTACTCGGGAGG - Intergenic
985366688 4:189238408-189238430 TGTTGTAACCAGCACTTTGGAGG - Intergenic
1202761337 4_GL000008v2_random:113851-113873 TGTAATCCCAAACACTTGGGAGG - Intergenic
985863336 5:2491899-2491921 TGTAATCTCAACTACTTGGGAGG + Intergenic
985977586 5:3433160-3433182 TAGATTCTCCAGTACTTTGGTGG - Intergenic
987329250 5:16841021-16841043 TGTAATCCCAAGTACTTGGGAGG + Intronic
988630129 5:32920562-32920584 TGTAATCTCAACTACTCTGGAGG - Intergenic
988910612 5:35837907-35837929 TGTAATCTCAGACACTCTGGAGG - Intergenic
989387652 5:40869263-40869285 TGTAATCCCCACTACTTGGGAGG - Intergenic
989649762 5:43673896-43673918 TGTAATCCCCACTACTCTGGAGG + Intronic
990025854 5:51187753-51187775 AATAATCTCCAGCAATATGGTGG - Intergenic
991580306 5:68147834-68147856 TGTAACATGCTGCACTTTGGTGG + Intergenic
991670643 5:69044087-69044109 TGTAATCTCAACTACTTGGGAGG - Intergenic
992311615 5:75507238-75507260 TGTAGTCTCAATCACTTGGGAGG - Intronic
992806710 5:80344984-80345006 TGTAATCTCCACAACTTGGGAGG + Intergenic
992823596 5:80524523-80524545 AGCAAACTCCAGAACTTTGGAGG - Intronic
992835811 5:80640175-80640197 TGTAATCTCAGGTACTTGGGAGG + Intronic
992839995 5:80679273-80679295 TGTAATCTCAGCCACTTGGGAGG + Intronic
993120642 5:83769755-83769777 TGTAGTCCCCACCACTTGGGTGG + Intergenic
993802717 5:92363683-92363705 GGGAATCTCAAGCACTGTGGAGG - Intergenic
994136281 5:96290883-96290905 TGTAATCTATAGGACCTTGGGGG + Intergenic
994373595 5:98993941-98993963 TGTAATCCCCAGCACTTTGAGGG + Intergenic
995514750 5:112943422-112943444 TGTAATCCCAACTACTTTGGAGG - Intergenic
995975251 5:118027561-118027583 TGTAACCTCCTGAACTATGGAGG + Intergenic
996163568 5:120197111-120197133 TATATTCTTGAGCACTTTGGTGG - Intergenic
996457050 5:123696668-123696690 TGTAATCTCAACCATTTGGGAGG - Intergenic
997101138 5:130970576-130970598 TGTAATCCCCACTACTTGGGAGG + Intergenic
997321392 5:132981885-132981907 TGTAATCCCAAGTACTCTGGAGG - Intergenic
997419211 5:133752493-133752515 TGTAATCTCAGCCACTTGGGAGG + Intergenic
997958495 5:138299372-138299394 TGTAATCTCAACTACTTGGGAGG + Intronic
998776691 5:145611283-145611305 TGTAATCTCAACTACTTGGGAGG - Intronic
998847367 5:146324015-146324037 TGTAATCTCAGCCACTTGGGAGG + Intronic
999447351 5:151650680-151650702 TGTAATCCCAACCACTTGGGAGG - Intergenic
999950342 5:156642588-156642610 TGTAATCTCAACTACTTGGGAGG - Intronic
1000007666 5:157202333-157202355 TGTAATCTCAGGCACTTGGGTGG - Intronic
1001043332 5:168352703-168352725 TGTAATCCCAACTACTTTGGAGG - Intronic
1001351865 5:170975405-170975427 TGTAATCTCAACTACTCTGGAGG + Intronic
1001461649 5:171920467-171920489 TGTAAATCCCAGCACTTTGGAGG + Intronic
1001595087 5:172893267-172893289 TGTAATCCCAACCACTTGGGAGG - Intronic
1001803566 5:174564397-174564419 TTTAATCTCCTGCATTATGGAGG - Intergenic
1002707978 5:181175770-181175792 TGTAATCCCCACTACTTGGGAGG + Intergenic
1003359987 6:5415826-5415848 TGTAATCCCCATTACTTGGGAGG - Intronic
1003504814 6:6731666-6731688 TGTAATCTCAGCCACTTGGGAGG + Intergenic
1004643913 6:17541320-17541342 TGTAATGATCGGCACTTTGGGGG + Intronic
1004731961 6:18367188-18367210 TGTAATCTCAACTACTCTGGAGG - Intergenic
1005586429 6:27280633-27280655 TGTGATCTCCATCTCTTGGGAGG + Intergenic
1005955731 6:30662156-30662178 TGCAATCTCCACCACTCTGAGGG + Intronic
1005980262 6:30831068-30831090 TGTAATCTCAGGTACTTGGGAGG + Intergenic
1006219008 6:32472101-32472123 TGTAGTCTCCACTACTCTGGAGG + Intergenic
1006657511 6:35608436-35608458 TGTAATCTCAACTACTTGGGAGG + Intronic
1007017128 6:38479983-38480005 TGTAATCTCCACACCTTGGGAGG - Intronic
1007188150 6:39990160-39990182 TGTAATCCCAACCACTTGGGAGG + Intergenic
1007439183 6:41843522-41843544 TGTAGTCTCAACCACTTGGGAGG + Intronic
1007900446 6:45406661-45406683 TGCTAACCCCAGCACTTTGGGGG - Intronic
1008152749 6:47974968-47974990 TGGAATCTCCAGTACGTAGGAGG - Intronic
1008441924 6:51541442-51541464 TGTCATCACCTGCACTTTGTGGG + Intergenic
1008908442 6:56706742-56706764 TGTAATCCCCAGCACTTTGGAGG + Intronic
1008959560 6:57252560-57252582 TGTAATCCCAACTACTTTGGAGG - Intergenic
1011284520 6:85708548-85708570 TGTAATTGCCATTACTTTGGAGG - Intergenic
1011578055 6:88826659-88826681 TGTAATCTCAACTACTTGGGAGG + Intronic
1011748107 6:90427149-90427171 TGTAAATCCCAGCATTTTGGAGG + Intergenic
1011947048 6:92918608-92918630 TGAAAACTCCAGCAGTTTTGAGG - Intergenic
1012484930 6:99710812-99710834 TGTAATCTCAGGTACTTGGGAGG - Intergenic
1012774740 6:103484839-103484861 TGTAATATCCAGCTCTTGAGGGG - Intergenic
1013529195 6:111003410-111003432 TGTAATCCCAACCACTTGGGAGG - Intronic
1013802764 6:113966428-113966450 TGTAATCTCAACTACTTGGGAGG + Intronic
1014234239 6:118936996-118937018 TGTAATCCCCAGGAGTCTGGTGG + Intergenic
1014495575 6:122117889-122117911 TGTAATCTCAAGTACTTCGGAGG - Intergenic
1015971655 6:138748714-138748736 TGTAATCTCAGCTACTTTGGAGG - Intergenic
1016468857 6:144353723-144353745 TGTAATCTCAACTACTTGGGAGG + Intronic
1017046140 6:150348834-150348856 TGTAATCTCAGCTACTTTGGAGG - Intergenic
1017273311 6:152535022-152535044 TGCATTCTGCAGCATTTTGGGGG - Intronic
1017476737 6:154802360-154802382 TATAATCCCCAGCACTTTGGGGG + Intronic
1017535173 6:155339922-155339944 TGTAATCCCAACCACTTGGGAGG - Intergenic
1017897518 6:158693504-158693526 TGTAATCTCCACTACTCAGGAGG - Intronic
1019085778 6:169475342-169475364 TGTAATCCCCACTACTTGGGAGG - Intronic
1019980836 7:4620713-4620735 TGTTAATCCCAGCACTTTGGGGG + Intergenic
1019982031 7:4628811-4628833 TGTAATCTCAGCTACTTTGGAGG + Intergenic
1020205288 7:6109820-6109842 TGTAATCTCAACTACTTGGGAGG - Intronic
1020274055 7:6614538-6614560 TGTAATCCCAACTACTTTGGAGG - Intergenic
1020641369 7:10758184-10758206 TGTAATCTCAGCTACTTTGGAGG - Intergenic
1020687949 7:11319023-11319045 TGTAATCCCAATTACTTTGGAGG - Intergenic
1020888071 7:13844552-13844574 TGTAATCTCAGACACTTGGGAGG - Intergenic
1021030935 7:15734969-15734991 TGTAATTTCCACTACTTGGGAGG + Intergenic
1021507818 7:21404670-21404692 TGTAATCCCAGGTACTTTGGAGG - Intergenic
1021614413 7:22487680-22487702 TGTAATCCCAGGCACTCTGGAGG + Intronic
1021837102 7:24688933-24688955 TGTAATCTCAATTACTTGGGAGG - Exonic
1022699313 7:32743113-32743135 TGTAATCTCAGCCACTTGGGGGG - Intergenic
1023441617 7:40190503-40190525 TGTAAATCCCAGCACTTTGGAGG - Intronic
1023441957 7:40193540-40193562 TGTAAATCCCAGCACTTTGGGGG - Intronic
1024483384 7:49888787-49888809 TGTAATCTCAGCTACTTTGGGGG + Intronic
1025034575 7:55585748-55585770 TGTAATCCCAGGTACTTTGGAGG + Intergenic
1025060356 7:55800500-55800522 TGTAATCCCAACCACTTGGGAGG + Intronic
1025195862 7:56932481-56932503 TGTAGTCTCCATCACTCAGGAGG + Intergenic
1025676087 7:63644454-63644476 TGTAGTCTCCATCACTCAGGAGG - Intergenic
1025687697 7:63732309-63732331 TGTAATCCCCACTACTTGGGAGG + Intergenic
1026236881 7:68534984-68535006 TGCACTCTTCAGCCCTTTGGCGG + Intergenic
1026838925 7:73657544-73657566 TGTAATCTCAGCCACTTGGGAGG + Intergenic
1027174522 7:75894755-75894777 TGTAATCCCCGCTACTTTGGAGG - Intergenic
1027509068 7:79056134-79056156 TGTAAACTCCAGCCCTTTCGGGG + Intronic
1028657347 7:93224168-93224190 TGTAATCCCAGGCACTTTAGGGG + Intronic
1029090355 7:98043295-98043317 TGTAATCCCAACCACTTGGGAGG - Intergenic
1029291250 7:99504092-99504114 TGTAATCTCAGCCACTTGGGAGG - Intergenic
1029376953 7:100184142-100184164 TGTAATCCCAGCCACTTTGGAGG + Intronic
1030309508 7:108055306-108055328 TGTAATCCCCACTACTTGGGAGG - Intronic
1030433553 7:109485093-109485115 TATAAACACCATCACTTTGGGGG - Intergenic
1031554190 7:123151200-123151222 TGTAATCCCCACTACTTGGGAGG + Intronic
1031642785 7:124186022-124186044 TGTAATCTCAGGTACTTGGGCGG + Intergenic
1032118787 7:129141112-129141134 TGTAATCTCAACTACTTGGGAGG - Intergenic
1032243867 7:130190259-130190281 TGTAATTCCCAGCACTTTGGAGG + Intronic
1032900468 7:136301428-136301450 TGTAATCTCATCTACTTTGGAGG + Intergenic
1033119454 7:138654009-138654031 TGTAATCTCAGGTACTTGGGAGG + Intronic
1033468715 7:141623255-141623277 TGTAATCTCAGGTACTTGGGAGG + Intronic
1033526151 7:142215634-142215656 TGTAATCCCCACTACTTGGGAGG + Intronic
1033911944 7:146274523-146274545 TGTACTCATCAGCCCTTTGGAGG + Intronic
1034113955 7:148565842-148565864 TGTAATCCCCACTACTTCGGAGG - Intergenic
1035000164 7:155606290-155606312 TGTAATCCCCACTACTTGGGAGG - Intergenic
1035868545 8:3111708-3111730 TGTAATCCCAAGTACTTGGGGGG + Intronic
1036242949 8:7094231-7094253 TGTAGTCCCAAGGACTTTGGAGG + Intergenic
1036415118 8:8539742-8539764 TGTAATCCCCATTACTTGGGAGG + Intergenic
1036435764 8:8731663-8731685 TCTAATCTCAACTACTTTGGAGG + Intergenic
1036435958 8:8733684-8733706 TGTAATCTCAGCCACTTGGGAGG - Intergenic
1036447647 8:8836498-8836520 TGTAGTCTCCAGCTTTTTGGAGG - Intronic
1036829779 8:12012923-12012945 TGTAGTCCCAAGTACTTTGGAGG - Intergenic
1036852671 8:12215105-12215127 TGTAATCTCAACTACTTGGGAGG - Intergenic
1036874042 8:12457627-12457649 TGTAATCTCAACTACTTGGGAGG - Intergenic
1036898874 8:12657198-12657220 TGTAGTCCCAAGTACTTTGGAGG - Intergenic
1036900127 8:12664228-12664250 TGTAGTCCCAAGGACTTTGGAGG - Intergenic
1037129787 8:15393794-15393816 TTAAATCTCCAGCAGTTTAGAGG - Intergenic
1037982281 8:23262773-23262795 GGTAATCTACAGGACTCTGGTGG + Intergenic
1037996657 8:23357324-23357346 CGTAATTCCCAGCACTTGGGAGG - Intronic
1038347141 8:26742732-26742754 TGTAATCTCAGCTACTTTGGAGG + Intergenic
1038629439 8:29227409-29227431 TGTAATCCCAAGTACTTGGGTGG - Intronic
1038678084 8:29641737-29641759 TGTAATCTCAGGTACTTGGGAGG + Intergenic
1038750055 8:30286507-30286529 TGTAGTCCCCAGTACTTGGGAGG - Intergenic
1039026914 8:33268480-33268502 TGTAATCTCAACTACTCTGGAGG - Intergenic
1039237775 8:35521654-35521676 TGTAATTTCCAGCCCTGTGATGG + Intronic
1039372544 8:37001382-37001404 TAGACTCTCCAGGACTTTGGTGG - Intergenic
1039485702 8:37908075-37908097 TGTAATCCCAAGTACTTGGGAGG - Intergenic
1039959432 8:42234749-42234771 TGTAATCTCAGGTACTTGGGAGG - Intergenic
1040437796 8:47409770-47409792 TGTAATCTCCATCCTTTGGGAGG + Intronic
1040587105 8:48754597-48754619 TATACTTTCCAGTACTTTGGGGG + Intergenic
1041151121 8:54935367-54935389 GTTAATACCCAGCACTTTGGAGG - Intergenic
1041190144 8:55345170-55345192 TGTAATCCCCACTACTTGGGAGG + Intronic
1041280235 8:56201062-56201084 TGTAATCTCCATGGGTTTGGGGG - Intronic
1041686473 8:60649307-60649329 TGTAATCTCAGCCACTTGGGAGG + Intergenic
1041741312 8:61159922-61159944 TGCATTCTCCAGCAATTTGTGGG + Intronic
1042026632 8:64430954-64430976 TGTAATCCCCACTACTTGGGAGG + Intergenic
1042395270 8:68284995-68285017 TGTAATCTCCACTACTTGGGAGG + Intergenic
1042658087 8:71122773-71122795 TTTAATCTCCAAGTCTTTGGGGG + Intergenic
1043082076 8:75779233-75779255 TGTAATCCCCACTACTTGGGAGG + Intergenic
1043211316 8:77522038-77522060 TGTAATCTTCAGTGCTGTGGAGG - Intergenic
1043439807 8:80266949-80266971 TGTAATCCCAAGTACTTGGGAGG + Intergenic
1043453350 8:80390830-80390852 TGTAATCCCCACTACTTGGGAGG + Intergenic
1043563326 8:81520778-81520800 TGTAATCCCAAGTACTTGGGAGG - Intergenic
1044010340 8:86986050-86986072 TGTAATCTCAGGTACTTGGGAGG - Intronic
1044129868 8:88508583-88508605 TGTAATCCCAACCACTTGGGAGG + Intergenic
1044534497 8:93344057-93344079 TGTAATCCCAAGTACTTGGGAGG - Intergenic
1044565181 8:93654889-93654911 TGTAATCCCAACTACTTTGGAGG - Intergenic
1044986428 8:97760166-97760188 TGTAATCTCAGCCACTTGGGAGG + Intergenic
1045009283 8:97943709-97943731 TGTAAATCTCAGCACTTTGGGGG - Intronic
1045345562 8:101290659-101290681 TGTAATCCCCACTACTTGGGAGG - Intergenic
1046346633 8:112937470-112937492 TGTAATCCCAACCACTTGGGAGG - Intronic
1046491557 8:114959429-114959451 TCTAATCTCTAGTACCTTGGTGG + Intergenic
1046574202 8:116005235-116005257 TTTAATCTCCAGGTATTTGGGGG - Intergenic
1047427989 8:124764274-124764296 TGTAATCCCAAGTACTTGGGAGG - Intergenic
1047947748 8:129899120-129899142 TGTAAATCCCAGTACTTTGGAGG - Intronic
1048340361 8:133534027-133534049 TTGAATCCCCAGTACTTTGGTGG - Intronic
1048748793 8:137647386-137647408 TGTAATCCCAGCCACTTTGGAGG + Intergenic
1049045210 8:140144996-140145018 TGTAATCTCAGGTACTTGGGAGG - Intronic
1049878689 8:145046118-145046140 TGTAATCCCCACCACTTGGGAGG - Intergenic
1050004357 9:1114309-1114331 TGTAATCTCAGCCACTTGGGAGG - Intergenic
1050620708 9:7449361-7449383 TCTAATCTCCAGCTCTTTGTGGG + Intergenic
1050721802 9:8599872-8599894 TGTAAATTCCAGCAATTTGGGGG - Intronic
1051416752 9:16849478-16849500 TGTAATCTCAGCTACTTTGGGGG - Intronic
1051666782 9:19473408-19473430 TGTAATCTCCACTACTTGGGAGG - Intergenic
1051772770 9:20596860-20596882 TGTAACCTGAAGCAATTTGGGGG + Intronic
1051924043 9:22301473-22301495 TGTAGGCTCCATGACTTTGGAGG - Intergenic
1051933475 9:22414579-22414601 TGTATTCTGTAGCACTTTGGGGG - Intergenic
1052129796 9:24829260-24829282 TGTCATTTGCAGCACTTTGGAGG + Intergenic
1052129918 9:24831027-24831049 TGTAATCCCAGGCACTTGGGAGG - Intergenic
1052913558 9:33906242-33906264 TGTAATCCCAAGTACTTGGGAGG - Intronic
1053300249 9:36943927-36943949 TGTAATCTCAGGGACTTGGGAGG + Intronic
1053672548 9:40382469-40382491 TGTAATCCCCACTACTGTGGAGG - Intergenic
1053922365 9:43008830-43008852 TGTAATCCCCACTACTGTGGAGG - Intergenic
1054383662 9:64522501-64522523 TGTAATCCCCACTACTGTGGAGG - Intergenic
1054512077 9:65993840-65993862 TGTAATCCCCACTACTGTGGAGG + Intergenic
1055441456 9:76340521-76340543 TGTAATCTCAACTACTTGGGAGG + Intronic
1055466111 9:76568253-76568275 TGTAATCTCAACTACTTGGGAGG + Intergenic
1055865271 9:80805766-80805788 TGTAATCTCAGCCACTTGGGAGG - Intergenic
1055896227 9:81179043-81179065 TGTAATCCCAAGTACTTGGGAGG - Intergenic
1056022915 9:82459851-82459873 TGTAATCCCAACCACTTGGGAGG - Intergenic
1056292004 9:85153126-85153148 TGTAATCTCAGGTACTTGGGAGG - Intergenic
1056423056 9:86448361-86448383 TGTAATCTCCACTACTCAGGAGG - Intergenic
1056648339 9:88434928-88434950 TGTAATCCCCACTACTTGGGAGG + Intronic
1057144026 9:92746408-92746430 TGTAATCTCAACTACTTGGGAGG + Intronic
1057170306 9:92959448-92959470 TGTAAATCCCAGCACTTTGCAGG + Intronic
1057818073 9:98310368-98310390 TGTAATCCCAATTACTTTGGAGG - Intronic
1057866166 9:98683213-98683235 TGTAATCTCAGGTACTTGGGAGG - Intronic
1057937305 9:99251673-99251695 TGTAATCTCAACTACTTGGGAGG + Intergenic
1058021067 9:100089321-100089343 TGTTAATCCCAGCACTTTGGAGG + Intronic
1058267881 9:102928642-102928664 TGTGATCTCCAGCACTAGGCAGG + Intergenic
1058267938 9:102929752-102929774 TGTGATCTCCAGCACTAGGCAGG - Intergenic
1058509978 9:105706896-105706918 TGTAATCTCAGCCACTTGGGAGG - Intronic
1058964822 9:110026919-110026941 TGTAATCTCAGCCACTCTGGAGG + Intronic
1059798281 9:117723792-117723814 TCTAAACTCAAGCACTTTTGTGG + Intergenic
1059924044 9:119188504-119188526 TGTAATCTCAAAGACTGTGGAGG + Intronic
1060981567 9:127795311-127795333 TGTAATCCCAACCACTCTGGAGG + Intronic
1061269470 9:129529484-129529506 TGTAATCTCAACTACTTGGGAGG - Intergenic
1061282166 9:129603655-129603677 TGGCACCTCCAGTACTTTGGAGG + Intergenic
1061343654 9:130004139-130004161 TGTAATCTCAACTACTCTGGAGG + Intronic
1061514399 9:131080408-131080430 TGTAATCTCAACTACTCTGGAGG - Intronic
1061777714 9:132977077-132977099 TGTAATCTCAGCCACTTAGGAGG - Intronic
1062113032 9:134792495-134792517 TGTAATCTCAACTACTTAGGAGG - Intronic
1062222269 9:135423200-135423222 TGTAATCCCAAGTACTTGGGAGG + Intergenic
1062576397 9:137210723-137210745 TGTAATCCCCACTACTTGGGAGG + Intronic
1062701771 9:137909890-137909912 TGTAATCCCAACCACTTGGGAGG - Intronic
1203750269 Un_GL000218v1:72640-72662 TGTAATCCCAAACACTTGGGAGG + Intergenic
1203708984 Un_KI270742v1:78845-78867 TGTAATCCCAAACACTTGGGAGG + Intergenic
1203542107 Un_KI270743v1:98732-98754 TGTAATCCCAAACACTTGGGAGG - Intergenic
1185634809 X:1543803-1543825 TGTAATCTCGGGTACTGTGGAGG + Intergenic
1185818523 X:3179879-3179901 TGTAATCTCAGGTACTTGGGAGG - Intergenic
1187234125 X:17450752-17450774 TGTAATCTCAGGTACTTGGGAGG + Intronic
1187343754 X:18444571-18444593 TGTACATCCCAGCACTTTGGGGG - Intronic
1187621827 X:21064140-21064162 TTTAATTTCCAGAAGTTTGGAGG + Intergenic
1188081285 X:25844093-25844115 TGTTATCTTCAACAATTTGGGGG - Intergenic
1188294171 X:28426090-28426112 TGTGGTCTGCAGCCCTTTGGGGG + Intergenic
1189077855 X:37936926-37936948 TGTAATCTCAGGTACTTGGGAGG + Intronic
1189633363 X:42978041-42978063 TGTAATCTCAGCTACTTTGGAGG - Intergenic
1190236368 X:48619027-48619049 TGTAATCTTCAACATTATGGAGG - Intergenic
1190370985 X:49740434-49740456 TGTACTCTCAGCCACTTTGGGGG - Intergenic
1190764015 X:53460999-53461021 TGTAATCTCAACTACTTGGGAGG - Intergenic
1190889679 X:54557382-54557404 TGTAATCCCAGGCACTTGGGAGG - Intronic
1192326765 X:70139186-70139208 TGTAATCTCAGGTACTTGGGAGG + Intronic
1193145160 X:78068629-78068651 TGTAATCCCGACCACTTGGGAGG - Intronic
1193918401 X:87396121-87396143 TGTAATCCCCGCCACTTGGGAGG + Intergenic
1194013357 X:88588460-88588482 TGTAATCCCAGGTACTTTGGAGG + Intergenic
1195029965 X:100917358-100917380 TGTAATCCCAAGCACTTTGCGGG + Intronic
1195222369 X:102757927-102757949 TGTAATCTCAACCACTCAGGTGG + Intergenic
1195533547 X:105984339-105984361 TGTAAACTCCAGCACTTTTAAGG - Intergenic
1196504889 X:116430060-116430082 TGTAATCTCAACTACTTGGGAGG - Intergenic
1197627200 X:128815447-128815469 TGTAATCTCAGGTACTTGGGAGG - Intergenic
1198033135 X:132774800-132774822 TGTAATCCCCACTACTCTGGAGG - Intronic
1198186028 X:134254972-134254994 TGTAATCCCAACCACTTGGGAGG - Intergenic
1198622053 X:138523730-138523752 TAGAATCAACAGCACTTTGGGGG - Intergenic
1198815641 X:140587209-140587231 AATTTTCTCCAGCACTTTGGGGG + Intergenic
1200378076 X:155805244-155805266 TGTAATCCCCACTACTTGGGAGG + Intergenic
1200773271 Y:7147004-7147026 TATAGTCTCAAGCACTTGGGAGG - Intergenic
1200795610 Y:7338634-7338656 TGTAATCTCAACTACTTGGGAGG - Intergenic
1201163921 Y:11190280-11190302 TGTAATCCCAAACACTTGGGAGG + Intergenic
1201619537 Y:15940762-15940784 TGTAATCTCAACTACTTAGGAGG - Intergenic