ID: 1102381325

View in Genome Browser
Species Human (GRCh38)
Location 12:112469094-112469116
Sequence CTGGCAGACCTGATGATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102381317_1102381325 10 Left 1102381317 12:112469061-112469083 CCCAACAACAAAAAAAAAGATTA 0: 1
1: 1
2: 32
3: 738
4: 4704
Right 1102381325 12:112469094-112469116 CTGGCAGACCTGATGATGGGTGG 0: 1
1: 0
2: 1
3: 14
4: 162
1102381318_1102381325 9 Left 1102381318 12:112469062-112469084 CCAACAACAAAAAAAAAGATTAA 0: 1
1: 1
2: 22
3: 511
4: 5089
Right 1102381325 12:112469094-112469116 CTGGCAGACCTGATGATGGGTGG 0: 1
1: 0
2: 1
3: 14
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102381325 Original CRISPR CTGGCAGACCTGATGATGGG TGG Intronic
900889900 1:5442073-5442095 CTGGAAGACCTGATGGAGGGAGG + Intergenic
901571706 1:10166133-10166155 CTGGCAGAGCTGAAGCTGGCCGG - Intronic
902297079 1:15474974-15474996 CTGGCCGCTCTAATGATGGGGGG - Intronic
905865978 1:41377048-41377070 CTGGCAGGTTTGAGGATGGGAGG + Intronic
905868857 1:41391626-41391648 CCGGCAGCCCCGATGATGGGAGG + Intergenic
906381739 1:45336794-45336816 CTGGCAAAACAGATTATGGGAGG - Intronic
906450568 1:45943199-45943221 CTTGGAGGCATGATGATGGGTGG + Intronic
913344266 1:117792597-117792619 CTGGGAGCCCTGGAGATGGGAGG + Intergenic
913454694 1:119019137-119019159 CCAGCAGACCAGATGATGGATGG + Intergenic
914940071 1:152014727-152014749 GTGGCAGCCCAGAGGATGGGAGG + Intergenic
916770706 1:167904789-167904811 CTGGCAGTCCTGAGTAAGGGAGG + Intronic
917239877 1:172936655-172936677 CTCGGAGGCCTGATGATGGCAGG - Intergenic
920862639 1:209723083-209723105 AAGGCAGACATGATGATAGGTGG - Intronic
1062774436 10:134490-134512 CTTGCAGGGCTGCTGATGGGTGG + Exonic
1063366996 10:5496914-5496936 CGGGCAGACCTGCGGGTGGGGGG - Intergenic
1064828893 10:19439413-19439435 CCTGCAGTCCTGATGGTGGGAGG + Intronic
1069058248 10:63866856-63866878 CTGGCAGTAATGATGGTGGGTGG + Intergenic
1069742740 10:70695868-70695890 CAGGGAGAGCTGATGATGGGAGG + Intronic
1070741520 10:78906347-78906369 CTGGCAGGGGTGCTGATGGGTGG - Intergenic
1071501320 10:86206287-86206309 CTGGGAGACCTGAGAGTGGGTGG - Intronic
1072198318 10:93136020-93136042 CTTGCAGAACTAATGATCGGTGG + Intergenic
1073100958 10:101006471-101006493 CTGGCACACCTGGGGGTGGGAGG - Exonic
1074113620 10:110439644-110439666 CCAGCAGACCTGCTGTTGGGTGG + Intergenic
1074983992 10:118641477-118641499 CTGGGAGACCAGAGGAAGGGAGG + Intergenic
1076607476 10:131698457-131698479 CAGGCACACCTGAAGAAGGGTGG - Intergenic
1077140221 11:1020930-1020952 CTGGCAGGCCTGGTGAGGGTAGG + Intronic
1077334570 11:1997683-1997705 CTGGCAGGAGTGATGACGGGTGG - Intergenic
1081159192 11:39732915-39732937 CTGGCAAAACAGATTATGGGAGG - Intergenic
1083077595 11:60057039-60057061 CTGCCAGCTCTGATGATGAGGGG + Intronic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1084491556 11:69481376-69481398 CTGGGAGACCTGAAGTTGGCTGG - Intergenic
1084859790 11:72010919-72010941 CTGGGAAACCCCATGATGGGTGG - Intronic
1085994414 11:81893520-81893542 CTGGCATCCCTGCTGCTGGGAGG + Intergenic
1089092556 11:115890244-115890266 CTGGCAGAACTGCTGATGAATGG + Intergenic
1089181005 11:116582806-116582828 CTGGCAGGCCTGGTGGAGGGTGG + Intergenic
1089572396 11:119419268-119419290 CTGGAACTCCTGATGAGGGGTGG + Exonic
1090395026 11:126413441-126413463 CTGGCAGAGATGATGGTGGGAGG + Intronic
1202817553 11_KI270721v1_random:52865-52887 CTGGCAGGAGTGATGACGGGTGG - Intergenic
1091416893 12:295673-295695 CTGGAAGAACTTATGATGGTTGG - Exonic
1091488575 12:913621-913643 ATGACAGACCTGCTGCTGGGAGG + Intronic
1092113980 12:5985477-5985499 CTGCCAGAGGTGAAGATGGGTGG + Intronic
1093803304 12:23400357-23400379 GTGGCAAACTTGATGATGGTAGG - Intergenic
1096088196 12:48880497-48880519 CTGGCAAAACAGAGGATGGGAGG - Intergenic
1097110155 12:56652122-56652144 CTCGCATCCCAGATGATGGGCGG + Intergenic
1102381325 12:112469094-112469116 CTGGCAGACCTGATGATGGGTGG + Intronic
1103459278 12:121090793-121090815 CTGGCAGAGGTGATGATGGGAGG + Intergenic
1104436435 12:128760578-128760600 CTGGAAGATCCGAAGATGGGCGG - Intergenic
1104788196 12:131464893-131464915 CTGGCAAAAATAATGATGGGGGG + Intergenic
1105304244 13:19157989-19158011 CTGGCAAACCCTATGATGGGAGG - Intergenic
1105430489 13:20332975-20332997 CAGGCAGACAGGATGATGGAGGG - Intergenic
1105891436 13:24685204-24685226 GTAGCAGCCCTGAGGATGGGAGG - Intronic
1105986642 13:25573691-25573713 GTGGCAGCCCTGGTGCTGGGTGG + Intronic
1112318658 13:98387753-98387775 CCGGTAGAACTGAGGATGGGAGG - Intronic
1113314525 13:109164115-109164137 TTGGCAGAGGTGGTGATGGGGGG + Intronic
1118631641 14:67709700-67709722 CTACCAGGCCTGAAGATGGGGGG + Intronic
1118930357 14:70234838-70234860 TTGGCAGACATGATGGGGGGCGG - Intergenic
1122258219 14:100495499-100495521 CTGGAAGACCTGATCATCAGTGG - Intronic
1122357885 14:101134987-101135009 CTGGCAGCGCTGATCAAGGGAGG - Intergenic
1123118774 14:105907482-105907504 CTGGCAGAACAGAGGAGGGGAGG - Intergenic
1123429302 15:20201365-20201387 CTGGCAGGACTGATGGTAGGTGG - Intergenic
1125351114 15:38768472-38768494 ATGGCAGATCTCATGATGGCAGG + Intergenic
1127981526 15:64038569-64038591 CTGGCTGACTGGATGGTGGGTGG - Intronic
1129701180 15:77769449-77769471 CTGGCAGACCTGATGGCTGATGG + Intronic
1133911545 16:10070643-10070665 CTGGAAAATCTGATGATGAGAGG - Intronic
1135771497 16:25221485-25221507 CTGGCAGCCATGCTGATCGGAGG + Exonic
1136398073 16:30003928-30003950 CTGGCAGGATGGATGATGGGGGG - Intronic
1138736534 16:59257565-59257587 CTGGATGACATGGTGATGGGTGG - Intergenic
1140549790 16:75852972-75852994 TTGTCAGACTTGATGATGGTTGG - Intergenic
1142482150 17:225681-225703 CTGGCAGAGATGCTTATGGGAGG + Intronic
1142593629 17:1019087-1019109 TGGGCAGACCTGGTGCTGGGAGG + Intronic
1143599953 17:7938442-7938464 CTGACAGTCCTGATGATGATGGG + Intronic
1144717876 17:17446952-17446974 CTGGCAGCCCTGCTGACGTGGGG + Intergenic
1144789254 17:17848289-17848311 CTGGCAGACCTGGGGAGAGGAGG + Intronic
1147665072 17:42141758-42141780 CTGGCAGTCCTGGAGACGGGTGG - Intronic
1150945638 17:69742995-69743017 CTGGCTGGCCTTCTGATGGGAGG + Intergenic
1152276243 17:79359233-79359255 CTGGCAGCCCTGGGGAGGGGCGG - Intronic
1153739081 18:8104172-8104194 CTGACAGACTTGCTGAAGGGAGG + Intronic
1153843511 18:9028297-9028319 CTTGCTGTCCTGAAGATGGGAGG - Intergenic
1157180294 18:45491866-45491888 CTGGCAGAGCTGGTGCTGGCTGG - Intronic
1158017161 18:52797746-52797768 CTGGCAGCAGTGGTGATGGGTGG + Intronic
1158183278 18:54742262-54742284 CTGGCAGTCGTAATGGTGGGTGG + Intronic
1162602201 19:11677417-11677439 CTCGCATCCCAGATGATGGGCGG + Intergenic
926418672 2:12675725-12675747 CTGGCAGAGCAGAGGGTGGGAGG - Intergenic
926564047 2:14450622-14450644 CTGATAGACCTGAGAATGGGAGG + Intergenic
926772928 2:16394150-16394172 CTGGCAGAACTGGAGCTGGGAGG - Intergenic
926805037 2:16700465-16700487 CTGGCACAACTGATGATCTGGGG + Intergenic
927252249 2:21006952-21006974 CTGGCAGCTCTAATGATGGCAGG + Exonic
927533335 2:23831665-23831687 TTGGCACACATGCTGATGGGTGG - Intronic
933967636 2:87442971-87442993 CAGCCAGACCTAATGATAGGTGG + Intergenic
936326161 2:111507525-111507547 CAGCCAGACCTAATGATAGGTGG - Intergenic
936469228 2:112783794-112783816 CTGGCTGAGCTGATGGTGGCTGG - Intronic
938292986 2:130160165-130160187 CTGGCAAACCCCATGGTGGGAGG - Intronic
939599752 2:144174256-144174278 CTGGCAGACCTCTTGATTTGCGG - Intronic
940068162 2:149653165-149653187 GATGCAGACCTGATGATGTGTGG - Intergenic
948270796 2:236671857-236671879 CTGGGTGACCTGAGGATGGAAGG + Intergenic
948701953 2:239766118-239766140 CTGGCGGTCATGGTGATGGGAGG + Intronic
948921528 2:241068128-241068150 TTGGCAGCCCTGATGAGGTGAGG - Intronic
1170885124 20:20334057-20334079 CTGGCAGCACTGGTGCTGGGAGG - Intronic
1173443330 20:43096587-43096609 CAGGCAGAGCTGTGGATGGGGGG - Intronic
1176372508 21:6070862-6070884 CAGTCAGACCTGATGGTGGCTGG + Intergenic
1177019879 21:15840937-15840959 CTGGAAGACTTCATGATAGGTGG - Intronic
1178745995 21:35250810-35250832 CTGGCAGATTTGATGTTGGGTGG - Intronic
1179750968 21:43467383-43467405 CAGTCAGACCTGATGGTGGCTGG - Intergenic
1180697896 22:17765036-17765058 CTAGCAGATCTGATGAGGGGTGG + Intronic
1181609871 22:24005204-24005226 CTGGCAGGCCTGGTCCTGGGGGG - Intergenic
1182117128 22:27763276-27763298 CTGGCAGACCCATGGATGGGGGG - Intronic
1183335626 22:37244337-37244359 CTGGCAGAGCAGCTGGTGGGAGG + Intronic
1183703506 22:39463073-39463095 CTGGCAGGCCTGGTGGTGGATGG + Intronic
950076949 3:10194028-10194050 CTGGCAGAACTGAAGGAGGGTGG + Intronic
951115249 3:18853479-18853501 CTGGGAGACCAAAAGATGGGGGG + Intergenic
954220908 3:49153353-49153375 CTGGCAGCTCTGAGGTTGGGTGG + Intergenic
954318466 3:49814084-49814106 GTGTCAGACCTGAGGGTGGGAGG + Intergenic
961117049 3:124339312-124339334 CTGGCAGACCCAAAGTTGGGTGG - Intronic
961594179 3:128004144-128004166 CTGGAAGACTTGAACATGGGTGG + Intergenic
962476426 3:135759127-135759149 CTGACAGACCTGATGAGTTGAGG - Intergenic
962640999 3:137386256-137386278 CTGGCAGCCCTGATGATCTCTGG + Intergenic
962888664 3:139652013-139652035 CTGGCAGGCCTGAAGCTGGGTGG - Intronic
964760077 3:160127087-160127109 CTGGAAAACATCATGATGGGAGG + Intergenic
970377716 4:15475755-15475777 CTGGCAGACCCCAGGATTGGTGG - Intronic
971149172 4:24012918-24012940 GTAGCAGACAGGATGATGGGTGG - Intergenic
971501410 4:27322188-27322210 ATTGCAGACCTGATGCTAGGGGG + Intergenic
975908738 4:79245197-79245219 CTCGCATCCCAGATGATGGGCGG - Intronic
978225936 4:106335080-106335102 CTGGCTGCTCTGTTGATGGGAGG + Intronic
980592177 4:134904637-134904659 CTGGAAGACCTGAGGATTAGGGG + Intergenic
985495032 5:199523-199545 CTGGCAGGCATCAAGATGGGGGG - Exonic
991046840 5:62231802-62231824 CTGGCAGGACTGATGGTAGGTGG - Intergenic
995792314 5:115902897-115902919 CTTGCAGAAATGGTGATGGGGGG + Exonic
999241516 5:150130554-150130576 CAGGCAGACCAGATGATGTTCGG + Exonic
1000788640 5:165577226-165577248 CTTGGAGACCTGATGATAGTAGG - Intergenic
1001117905 5:168955072-168955094 CTGGCCTTCCTGATGTTGGGGGG + Intronic
1003324553 6:5082781-5082803 CTGGCGGAGCTGAGGATGGGAGG - Intergenic
1005359077 6:25013525-25013547 CTGGCAGAGCTGATGAAGGTGGG - Intronic
1005427703 6:25720674-25720696 ATGTAAGACTTGATGATGGGGGG + Intergenic
1005449508 6:25959212-25959234 CTGGCAAAACAGATTATGGGAGG - Intergenic
1005864822 6:29929242-29929264 CTGGGGGACCTGATGTGGGGGGG + Intergenic
1006451560 6:34108625-34108647 ATGGCAGACCTGATTTGGGGTGG + Intronic
1006727048 6:36207053-36207075 CTGGCATACCTGGGGATAGGGGG + Intronic
1006929915 6:37681324-37681346 CTAGGAGACCTGAAGAGGGGGGG - Intronic
1007391406 6:41551519-41551541 CAGCCAGGCCTGATGGTGGGTGG + Intronic
1007764465 6:44152585-44152607 CTCGTAGGCCTGATGCTGGGGGG - Exonic
1007840495 6:44712285-44712307 CTGGCATTTCAGATGATGGGTGG + Intergenic
1015398932 6:132767014-132767036 CTGCCAGAAGTGAAGATGGGAGG + Intergenic
1018482685 6:164207583-164207605 CTTGCAGAACTCATGAGGGGAGG - Intergenic
1018741072 6:166729052-166729074 CTGGCACACCTGCTGTGGGGTGG - Intronic
1019452506 7:1107031-1107053 CAGGCAGAGCTGATGCTGGGCGG - Intronic
1019710278 7:2515291-2515313 CTGGTTGAACTGATGGTGGGGGG - Intronic
1022818457 7:33935656-33935678 CTGGTTGTCCTTATGATGGGAGG - Intronic
1023162236 7:37308745-37308767 CTGGCTGCCCAGATGATGAGTGG + Intronic
1023466180 7:40457638-40457660 CTGGCATAGCTGAAGATGGAAGG + Intronic
1023856628 7:44188194-44188216 CTGGCAGAGCTAATGATGTTAGG - Intronic
1027933678 7:84574412-84574434 CTGGCATTCCTGATAATGTGGGG - Intergenic
1029437766 7:100572522-100572544 CTGGCAGACATGATGGGGGGCGG + Exonic
1032324701 7:130916277-130916299 CTGGCAGACATGCTGAGGGCAGG - Intergenic
1033317845 7:140313238-140313260 CTGGAAAACCTCATGAAGGGAGG + Intronic
1033429205 7:141273697-141273719 CTGGCAGACCTGCTTATAGCTGG - Intronic
1034411057 7:150942403-150942425 CTGGGAGCCCAGATGAGGGGAGG + Intergenic
1034671014 7:152858523-152858545 CAGGCAAATGTGATGATGGGTGG + Intergenic
1034706736 7:153152451-153152473 CTGGGAGCCCTGAAGCTGGGTGG + Intergenic
1038050774 8:23808674-23808696 CTGACAAACCTGAAAATGGGTGG - Intergenic
1039870266 8:41540034-41540056 CTGGGACACCTGAGGATGGGTGG - Intronic
1039906270 8:41788743-41788765 CTGGCAGGGCTGATGAAGAGGGG - Intronic
1041201708 8:55455766-55455788 ATGGCAGACTTGAGAATGGGAGG + Intronic
1044630107 8:94270383-94270405 CAGGCAGGCATGATGAGGGGCGG - Intergenic
1048800140 8:138187481-138187503 CTGGCAAACCAGGTTATGGGAGG - Intronic
1050465112 9:5914166-5914188 CTCGCAGACATGATGATGCATGG - Intronic
1053536312 9:38929959-38929981 TTGACAGACCTGAGGATGAGTGG + Intergenic
1054629822 9:67433989-67434011 TTGACAGACCTGAGGATGAGTGG - Intergenic
1055248782 9:74277648-74277670 CTGCCAGGCCTCATGCTGGGTGG - Intergenic
1055934041 9:81588648-81588670 CTAGCAGAGCTGCTGAGGGGAGG + Intronic
1058349030 9:103999535-103999557 CTGGGAGACCCGGTGTTGGGTGG - Intergenic
1058574679 9:106387839-106387861 AGGACAGACCTCATGATGGGAGG - Intergenic
1058655556 9:107217363-107217385 CTGGGAGAGATGAAGATGGGAGG + Intergenic
1062628961 9:137455143-137455165 CTGGCAGACCTGATGGGGGAAGG - Intronic
1188253004 X:27922769-27922791 AAGGCTGAGCTGATGATGGGAGG - Intergenic
1188809701 X:34638186-34638208 CTGGCAGACCTGGGCCTGGGAGG - Intronic
1190058986 X:47198942-47198964 CTGGCAGACGAGGTGGTGGGTGG + Intronic
1199628420 X:149760463-149760485 TTTGGAGACCTGATCATGGGTGG + Intergenic
1200316595 X:155138996-155139018 CTTGCATACTTGATGAGGGGAGG - Intronic