ID: 1102383876

View in Genome Browser
Species Human (GRCh38)
Location 12:112490555-112490577
Sequence CTAACTACTCAGAGAGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2172
Summary {0: 1, 1: 0, 2: 106, 3: 667, 4: 1398}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102383876_1102383880 5 Left 1102383876 12:112490555-112490577 CCTCAGCCTCTCTGAGTAGTTAG 0: 1
1: 0
2: 106
3: 667
4: 1398
Right 1102383880 12:112490583-112490605 CAAATTTGTGGCTCCATGCCCGG 0: 1
1: 0
2: 2
3: 39
4: 783
1102383876_1102383879 -7 Left 1102383876 12:112490555-112490577 CCTCAGCCTCTCTGAGTAGTTAG 0: 1
1: 0
2: 106
3: 667
4: 1398
Right 1102383879 12:112490571-112490593 TAGTTAGGACTACAAATTTGTGG 0: 1
1: 0
2: 0
3: 18
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102383876 Original CRISPR CTAACTACTCAGAGAGGCTG AGG (reversed) Intronic
Too many off-targets to display for this crispr