ID: 1102397620

View in Genome Browser
Species Human (GRCh38)
Location 12:112600803-112600825
Sequence CTTTATTAGCAGCATGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5829
Summary {0: 6, 1: 402, 2: 665, 3: 2357, 4: 2399}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102397620_1102397624 14 Left 1102397620 12:112600803-112600825 CCGTCCTCATGCTGCTAATAAAG 0: 6
1: 402
2: 665
3: 2357
4: 2399
Right 1102397624 12:112600840-112600862 TGATAATTTATAAAGAAAAGAGG 0: 11
1: 582
2: 5531
3: 11034
4: 9341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102397620 Original CRISPR CTTTATTAGCAGCATGAGGA CGG (reversed) Intronic
Too many off-targets to display for this crispr