ID: 1102401092

View in Genome Browser
Species Human (GRCh38)
Location 12:112630428-112630450
Sequence ACTTCAGCCTGATGCCGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102401092 Original CRISPR ACTTCAGCCTGATGCCGTGG GGG Intronic
900584147 1:3424477-3424499 TGCTCTGCCTGATGCCGTGGAGG + Intronic
901388064 1:8924187-8924209 AATTTAGCCAGATGCTGTGGTGG - Intergenic
901793615 1:11667650-11667672 AGCTCAGCCGGGTGCCGTGGGGG + Intronic
905350031 1:37339034-37339056 ACTTCAGCTTGTAGCCTTGGAGG + Intergenic
908276727 1:62480857-62480879 ACATAAGCCTGGCGCCGTGGCGG + Intronic
908702977 1:66922174-66922196 ACTTCAGCCTCATAAAGTGGTGG + Intronic
915335573 1:155139186-155139208 ACATTAGCCTGGTGGCGTGGTGG + Intergenic
915542306 1:156575386-156575408 ACTGCAGTCTCATGCCTTGGAGG - Intergenic
915859967 1:159433598-159433620 ACTTCAGCCTGATCTAATGGAGG - Intergenic
920180842 1:204130954-204130976 ACTTCAGCATGAAGCCCAGGTGG + Intergenic
922298724 1:224276317-224276339 ACTTGAGCCTGGGGGCGTGGAGG - Intronic
922813648 1:228433511-228433533 ACTGGAGCCTTATGGCGTGGTGG + Intergenic
1064835409 10:19523096-19523118 ACTTCAGCCTCATGGGGTTGTGG - Intronic
1071076486 10:81759664-81759686 ACTCCTGCCTGATGCTGTGTGGG - Intergenic
1074205893 10:111282370-111282392 ACTGCAGCCTGGTGCCGTCAAGG - Intergenic
1084325491 11:68397484-68397506 ACTCCAGCCGTATGCCATGGTGG + Intronic
1086534949 11:87833260-87833282 ACTTCAGCCTGATGAAGTGAAGG - Intergenic
1087038213 11:93774291-93774313 CCTGCAGCCTGCTGCCCTGGGGG - Intronic
1090005524 11:122998951-122998973 ACTACAGCCTGCTGTTGTGGTGG - Intergenic
1090496170 11:127214856-127214878 AAATTAGCCTGATGCAGTGGTGG + Intergenic
1102015341 12:109644616-109644638 CCTGCAGGCTGATGCTGTGGTGG - Intergenic
1102401092 12:112630428-112630450 ACTTCAGCCTGATGCCGTGGGGG + Intronic
1102994617 12:117339098-117339120 ACTTCAGCTTGATTCCTGGGTGG - Intronic
1103931435 12:124453020-124453042 TCCTCAGCCTGTTGCCATGGCGG - Intronic
1104508611 12:129355963-129355985 GCTTCACCCTGATCCCGTCGGGG - Intronic
1105465298 13:20634359-20634381 CTTTGAGCCTGATGCTGTGGTGG - Intronic
1105540144 13:21309218-21309240 ACTTCAGCCTGTGGCCATGTGGG + Intergenic
1108262801 13:48675516-48675538 ACTTCAGACTGCTGCTGTGCTGG + Intronic
1112039638 13:95533908-95533930 ACTCAAGCCTGGTGCCGGGGAGG - Intronic
1116947894 14:50853301-50853323 ACATTAGCCTGACGCGGTGGCGG - Intergenic
1117737107 14:58778756-58778778 CCTTCAGCCTGATGCTTTTGAGG + Intergenic
1118947284 14:70399320-70399342 ACTGGAGCCTGCTGCCCTGGGGG - Intronic
1119667286 14:76493956-76493978 GCTTCAGCCTGATCCCATGCAGG - Intronic
1125921386 15:43527748-43527770 ACTCCGGCCTGATTCCTTGGGGG - Exonic
1127094791 15:55501523-55501545 AAATCAGCCGGATGCGGTGGCGG - Intronic
1127833252 15:62769366-62769388 ACTTCAGCCAAATGCCTTTGTGG - Intronic
1128782220 15:70368115-70368137 ACTGCAGCCTGGTGGCGTGAGGG + Intergenic
1129799747 15:78405355-78405377 ACTGCAGCCTGCTGCCCTGGTGG + Intergenic
1131535253 15:93232091-93232113 ACTCCAGCCTCCTGCAGTGGGGG - Intergenic
1133178328 16:4033077-4033099 ACTTCAGACTGATGTCCTGGAGG + Intronic
1135474174 16:22759371-22759393 ACTTCACCCTGAGGGAGTGGTGG - Intergenic
1136099071 16:27980081-27980103 ACTTCAGCCTGAGCAGGTGGGGG + Intronic
1138060669 16:53886906-53886928 AATCCAGCCTGAAGCTGTGGTGG + Intronic
1138494822 16:57401818-57401840 GCTTCAGCCAGATTCCTTGGAGG - Intergenic
1139322798 16:66129077-66129099 ACCTCAGCCTGATCCCCTGGGGG + Intergenic
1139841971 16:69889021-69889043 AGTTCAGTCAGATGGCGTGGTGG + Intronic
1140756261 16:78070121-78070143 ACGTCAGCCTGATGTCCAGGTGG + Intergenic
1142263248 16:89052164-89052186 ACCTCCGCCTGATGCCCTGTGGG - Intergenic
1143017284 17:3897754-3897776 GCTTCAGCCTGGAGCCCTGGTGG - Exonic
1144152197 17:12459671-12459693 ACTCCAGCCTGAGTCCGTTGAGG - Intergenic
1145209777 17:21004469-21004491 GCATCAGCCTGAGGCCCTGGGGG - Intronic
1148554614 17:48570812-48570834 AATTCAGCCTGATCCCGATGTGG + Intronic
1148865824 17:50628098-50628120 ACTTCAGCCTCCTGCCTTGGGGG + Intergenic
1156055640 18:32999207-32999229 CCTTGAGCCTGGTGCAGTGGTGG + Intronic
1157120128 18:44901492-44901514 ACTTCAGCCTGTGGCCATGTGGG + Intronic
1159946302 18:74446966-74446988 ACAGCAGCCTGGGGCCGTGGTGG - Exonic
1160097476 18:75888554-75888576 ACTTCGGCCTAAAGCTGTGGGGG + Intergenic
1164505640 19:28858725-28858747 GCTGCAGCCTGATGCTGAGGAGG - Intergenic
1166610966 19:44195949-44195971 ACTACAGCCTCAGGCTGTGGTGG + Intergenic
926396820 2:12451790-12451812 ACTTTAGCTTAATGCCCTGGAGG + Intergenic
927082501 2:19644290-19644312 ATTTCAGCCACATGCCCTGGGGG - Intergenic
928518890 2:32068742-32068764 ACTTTAGCCGGATGTGGTGGCGG + Intronic
928674555 2:33637538-33637560 ACCTCAGCCAAATGCAGTGGTGG + Intergenic
930862392 2:56088418-56088440 ACTTCAGCCTGAGACCCAGGTGG - Intergenic
931122268 2:59233017-59233039 GCCTCAGCCTGATGCTGTGCTGG - Intergenic
931638906 2:64364176-64364198 GCTTCAGTCTGATGTGGTGGAGG + Intergenic
938571080 2:132562412-132562434 TCTTCAGCCTCATTCCGTGTGGG + Intronic
938765256 2:134456804-134456826 TCTTCAGCCCCATGCCATGGAGG - Intronic
939078020 2:137626312-137626334 AATTTAGCCAGGTGCCGTGGCGG + Intronic
944004731 2:194890759-194890781 GCCTCAGCCTTCTGCCGTGGTGG - Intergenic
946245389 2:218384335-218384357 TCTTCAGGCTGGCGCCGTGGCGG + Exonic
1173223543 20:41148021-41148043 AGTGCAGCCAGATGCTGTGGCGG + Intronic
1173281375 20:41631369-41631391 AATTTAGCCTGATGTGGTGGCGG + Intergenic
1174433244 20:50486377-50486399 AATTCAGCATGATGCTTTGGAGG - Intergenic
1176523331 21:7844043-7844065 TCTTCAGCCTGTTGGTGTGGTGG - Intergenic
1178657351 21:34474055-34474077 TCTTCAGCCTGTTGGTGTGGTGG - Intergenic
1182366735 22:29784239-29784261 ACTTGAGCCTGGTGGGGTGGAGG - Intergenic
949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG + Exonic
950142467 3:10624931-10624953 GCTCCAGCCTGGTGCCATGGTGG - Intronic
950261413 3:11545299-11545321 AATTCAGTCTGATGCCCTGTGGG + Intronic
952790571 3:37197338-37197360 GCCTCAGCCTGATCCGGTGGTGG - Intergenic
953920357 3:46947357-46947379 ACTGCAGCCCCATGCCGGGGTGG + Intronic
956279354 3:67540316-67540338 ACTTCAGACTGATGTGCTGGCGG - Intronic
957186349 3:76946585-76946607 AAATTAGCCGGATGCCGTGGTGG - Intronic
957287169 3:78231660-78231682 ACTGGAGCCTGAGGCTGTGGAGG - Intergenic
959804550 3:110535352-110535374 ACTTTAGCCAGACGTCGTGGTGG + Intergenic
960469269 3:118040655-118040677 ACTTGAGCCTGAGTCTGTGGGGG - Intergenic
968868969 4:3231612-3231634 CCTTCAGCCTGGTGCCATGCTGG + Intronic
976381546 4:84405124-84405146 ACTACAGCCTGATGCAGTCAGGG + Intergenic
978653038 4:111031027-111031049 ACTTCAGTCTGATTCTGTGATGG + Intergenic
982118797 4:152119348-152119370 CCTTCAGACTGATGCCCTGTGGG - Intergenic
985567413 5:626496-626518 CCTTCAGCCTGTTGCTGTGAAGG + Intronic
985850171 5:2382904-2382926 ACTCCAGCCTGCTGCCGTCCAGG + Intergenic
986774650 5:11002716-11002738 ACTTGACCCTGATGGGGTGGAGG + Intronic
992758882 5:79934191-79934213 ACTTCAACCCGCTGCCATGGAGG + Intergenic
993267864 5:85750818-85750840 AATTCAGCCTGACGTGGTGGTGG - Intergenic
993736807 5:91487172-91487194 ACCTGAGCCTGATGCCATAGTGG + Intergenic
994040622 5:95255895-95255917 ACTTCTGCCTGGTGCAGTGCTGG - Intronic
997795362 5:136804347-136804369 ACTTGAACCTGATCCTGTGGAGG + Intergenic
1002415323 5:179117447-179117469 ACATCAGCCTGGTACAGTGGTGG + Intronic
1010656133 6:78514061-78514083 ACTTCACCCTGATTCTGTAGGGG - Intergenic
1011898239 6:92259384-92259406 ACTGGTGCCTGATGCCCTGGTGG + Intergenic
1016426985 6:143945506-143945528 ACTTCAGCCTGGTGACAGGGTGG - Intronic
1018050911 6:160006623-160006645 CCATCAGCCTGGTGCTGTGGGGG + Intronic
1019406989 7:889106-889128 GCCTCAACCTGATCCCGTGGTGG - Intronic
1020118758 7:5491328-5491350 CCTCCAGCCCGATGCCGTGCTGG - Exonic
1023629662 7:42151518-42151540 ACTTCTGCCTGTTGCCATGGTGG - Intronic
1025243377 7:57296815-57296837 ACTTGAGCCTGGTGGGGTGGAGG + Intergenic
1029415787 7:100442341-100442363 TCCTCAGCCTGATGCTGGGGAGG - Intergenic
1029693937 7:102201148-102201170 ACTACAGCTTGATGACCTGGTGG - Intronic
1035320953 7:158028944-158028966 CCTTCAGCCTGGTGATGTGGTGG - Intronic
1045449781 8:102310780-102310802 ACTTCAGCCTGAAAGCGAGGAGG - Intronic
1048800955 8:138193482-138193504 TCTTCAGCCTGATCTCGTGATGG + Intronic
1054834178 9:69658947-69658969 GCTTCAGCCTGATCCTGTGTGGG - Intronic
1056505512 9:87254421-87254443 GCTTCAGCCTGGGGCCGGGGAGG - Intergenic
1057563484 9:96147291-96147313 ACTTCTGCCAGATGTGGTGGAGG - Intergenic
1060525494 9:124318484-124318506 ACTTCAGCCTCATGAAGTGCTGG + Intronic
1186495778 X:10012268-10012290 GCCTCAGCCTGATCCCATGGGGG + Intergenic
1195047313 X:101065926-101065948 CATTCAGCCTGATCCTGTGGAGG + Intergenic
1195968526 X:110450774-110450796 ACTTCAGCCTCAGACCCTGGAGG + Exonic