ID: 1102401347

View in Genome Browser
Species Human (GRCh38)
Location 12:112632355-112632377
Sequence TTGGAGACTCAGAAAGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 676
Summary {0: 1, 1: 4, 2: 17, 3: 121, 4: 533}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102401347 Original CRISPR TTGGAGACTCAGAAAGATGG AGG (reversed) Intronic
901179782 1:7333661-7333683 TTGGAGAATCTGCAACATGGCGG - Intronic
901430418 1:9210778-9210800 TGGGAGACTCATACAGAAGGTGG - Intergenic
901444728 1:9301187-9301209 TTGGTGACAAAGAAAGCTGGGGG + Intronic
902302585 1:15512562-15512584 TTGGAGACCAGGAAAGCTGGTGG - Intronic
903542358 1:24103934-24103956 TTAAAGAATCAGAGAGATGGAGG - Intronic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
904280355 1:29414370-29414392 TTGGGGACTCAGTCAGAGGGAGG + Intergenic
906673918 1:47679500-47679522 TTGGAGACACAGGAAGAGGCAGG - Intergenic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
907639400 1:56170932-56170954 CTGGAGGCACAGAAGGATGGAGG + Intergenic
907960361 1:59274148-59274170 TTAGAGACTCAGAAGGCAGGGGG + Intergenic
908771778 1:67603921-67603943 TTGGAGACTCAGAAATGGGGAGG + Intergenic
909416265 1:75409168-75409190 CTGGAGACTCTAAAAGATGGGGG + Intronic
909872202 1:80755732-80755754 TTGGAGACTCAGGAGGTTGGGGG - Intergenic
911057822 1:93722926-93722948 TGGGAGATTCAAATAGATGGGGG + Intronic
911268444 1:95772066-95772088 TAGAAGACTCAGAAAGCTGGTGG - Intergenic
911382646 1:97135060-97135082 AGGGAAACTCAGAAAAATGGTGG - Intronic
911595332 1:99793289-99793311 ATGAAGACACAGCAAGATGGTGG - Intergenic
913613589 1:120533027-120533049 TTGAAGACTGAGAAAGTTGAAGG + Intergenic
913665588 1:121045348-121045370 TTGGAGATTGAGCAAGAAGGAGG - Intergenic
914016986 1:143828618-143828640 TTGGAGATTGAGCAAGAAGGAGG - Intergenic
914160799 1:145132380-145132402 TTGGAGATTGAGCAAGAAGGAGG + Intergenic
914577483 1:148988224-148988246 TTGAAGACTGAGAAAGTTGAAGG - Intronic
914655595 1:149737160-149737182 TTGGAGATTGAGCAAGAAGGAGG - Intergenic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916274062 1:162974802-162974824 TTTGAGCCTCAGCAAAATGGAGG + Intergenic
916282389 1:163066148-163066170 ATGGAGCCTCAGAAGGATGAGGG - Intergenic
916451557 1:164925862-164925884 TTGGAGTGTCAGAAAACTGGGGG + Intergenic
916453244 1:164941860-164941882 TTGGAGACTCTGAAGGGAGGAGG - Intergenic
917932373 1:179831768-179831790 TTGTAGAATCACAAAGATGTAGG - Intergenic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
919038986 1:192357411-192357433 AGGGAGACACAGAAAGAGGGAGG + Intronic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
919711255 1:200731604-200731626 ATGGAGGCTCAGAAAGACTGAGG - Intergenic
919894641 1:202001823-202001845 ATTGACACTCGGAAAGATGGTGG + Intronic
920268121 1:204742208-204742230 AAGGAGACTCTGAAAGGTGGAGG - Intergenic
920293365 1:204939902-204939924 TCTCATACTCAGAAAGATGGTGG + Intronic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
922279001 1:224104828-224104850 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
922371512 1:224915528-224915550 TTGGACATTCAAAAAAATGGAGG + Intronic
922860832 1:228814946-228814968 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
1063281520 10:4634289-4634311 TTGGAGACTGAGAAGGAGGGAGG + Intergenic
1063288539 10:4716137-4716159 TTGGAGACCCAGAAGCGTGGAGG - Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064151049 10:12865351-12865373 TTTGAGTCTCAGAGAAATGGAGG - Intergenic
1064235569 10:13571079-13571101 TTAGAGATTCAGAAGGAAGGAGG + Intergenic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064594216 10:16926984-16927006 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1064662825 10:17623423-17623445 GTGGAGACTCAGAAGCAGGGAGG - Intergenic
1064832409 10:19485162-19485184 TTGGAAACTCAGAAAGAGGGAGG + Intronic
1065306543 10:24374496-24374518 TTAAAGACTCAGAGAAATGGTGG - Intronic
1065954569 10:30682545-30682567 ATGGTGACTCAGAAAGATGGTGG - Intergenic
1066597788 10:37071062-37071084 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1067010882 10:42712521-42712543 TTGGAGACTCATAAGCAGGGAGG - Intergenic
1067312627 10:45128652-45128674 TTGGAGACTCATAAGCAAGGAGG + Intergenic
1067784394 10:49233229-49233251 TGGGAGACTCAGAATGGGGGAGG + Intergenic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1069238184 10:66104601-66104623 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1070103495 10:73411284-73411306 TTAGAGACTCAGAAAGGGGAGGG + Intronic
1071187486 10:83060973-83060995 TTTAAGACACAGAAAGAGGGTGG - Intergenic
1071435965 10:85648506-85648528 ATGGTGACTCAGAGAGAGGGAGG - Intronic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072270471 10:93771504-93771526 TGGGAGACTGAGAAGGGTGGGGG + Intronic
1072324894 10:94288232-94288254 TTGGAGACTCAGAATGAGAGTGG - Intronic
1073688975 10:105786486-105786508 ATGGAGACACAGAGAGAAGGTGG - Intergenic
1073763605 10:106657442-106657464 TTGGAGAGTCAGAAAGGGTGAGG + Intronic
1074370547 10:112897736-112897758 ATGGGGACTCAGAGAGGTGGAGG + Intergenic
1074409959 10:113219829-113219851 CTGGAGTGTGAGAAAGATGGAGG - Intergenic
1075469847 10:122679930-122679952 TGAAACACTCAGAAAGATGGAGG - Intergenic
1075987653 10:126801404-126801426 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1076514107 10:131033533-131033555 CTGGATACGCAGAAAGATGGAGG + Intergenic
1076520926 10:131080800-131080822 CTGGAGATTCAGAAATGTGGAGG + Intergenic
1076787086 10:132755834-132755856 TTGGAGACTGAGGAAGACTGGGG + Intronic
1077320836 11:1941000-1941022 TTGGGGACACAGGGAGATGGTGG - Intergenic
1077351802 11:2096585-2096607 TTGGAGAATCCGTGAGATGGGGG + Intergenic
1079123647 11:17702982-17703004 ATGGAGGCTCAGAGAGATTGAGG + Intergenic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1080103385 11:28485558-28485580 TTGGAAACTCAGATACATGCTGG + Intergenic
1080510706 11:32967310-32967332 TTGGAGACTCAGAAGGGGAGAGG + Intronic
1080536837 11:33230244-33230266 GTGGAGACTCAGAGGGATGAAGG + Intergenic
1080609292 11:33890128-33890150 CTGGAGACTCAGAAGGGTGGGGG + Intronic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1080730512 11:34946933-34946955 CTGGAAACTCAAAAATATGGAGG - Intronic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1082202983 11:49396303-49396325 TTTGAGACTCAGAAGGTGGGAGG - Intergenic
1082697351 11:56385730-56385752 TTAGAGACTCAGAAAAGGGGTGG + Intergenic
1084740527 11:71136475-71136497 CAGGAGACTCAGAAGGGTGGTGG + Intronic
1084912532 11:72402537-72402559 ATGGAAACTAAGAAAGATGGGGG - Intronic
1087140837 11:94764332-94764354 TTAGAGATTCAGAAATTTGGAGG + Intronic
1087705591 11:101487536-101487558 TTGGAGACTTAGAAAAGTGGGGG - Intronic
1088059020 11:105622842-105622864 TTGTAGACTCTGAATAATGGGGG - Intronic
1088447302 11:109945868-109945890 ATGGAGAAACAGAAACATGGAGG - Intergenic
1088554126 11:111044332-111044354 AAGGAGACTCAGAAGGGTGGGGG - Intergenic
1089074708 11:115728878-115728900 TTTGAGAATTAGAAAGATGTGGG - Intergenic
1090855071 11:130603691-130603713 GTGGAGACTCAGGATGATGGTGG + Intergenic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091131609 11:133151403-133151425 CTGGAGATGCAGGAAGATGGGGG + Intronic
1091152537 11:133342201-133342223 TGGGAGTCTCTGAAAGATGGAGG - Intronic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092614378 12:10203050-10203072 TAGGAGTCTCAGAGAGATGATGG - Intergenic
1092660344 12:10732030-10732052 TCCGAGGCTCAGAAATATGGAGG + Intergenic
1092769549 12:11884274-11884296 ACGGAGGCCCAGAAAGATGGAGG - Intronic
1092846927 12:12592260-12592282 TTGGAGTCTTGGAAAGCTGGTGG - Intergenic
1093105750 12:15084889-15084911 TTGAAGACACAGTAAGAAGGCGG - Intergenic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093705501 12:22270640-22270662 ATGGAGACTCAGAAAGGTAAAGG + Intronic
1093826717 12:23700260-23700282 TTGGATAATCCAAAAGATGGTGG - Intronic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094408152 12:30140930-30140952 TTGGGGAAGCAGAAAGGTGGTGG - Intergenic
1094415903 12:30214547-30214569 TTGGAAACTCAGAAGGGTGGTGG - Intergenic
1094591267 12:31823214-31823236 TTGGAGACTCAGGAAAAGGTGGG - Intergenic
1094619895 12:32069979-32070001 ATGGGGACTCAGAAGGGTGGCGG - Intergenic
1095523078 12:43091659-43091681 TGGGAGAGGGAGAAAGATGGGGG - Intergenic
1095739179 12:45588375-45588397 CTGGAGAGCCAGAAAGCTGGTGG - Intergenic
1096470466 12:51872212-51872234 CTGGATCCTCAGCAAGATGGGGG + Intergenic
1096629719 12:52918345-52918367 TTGGAGCCTCAGAAACATGCAGG + Intronic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097850974 12:64409401-64409423 TTGAAGACTAAGAAAGCTTGAGG + Intronic
1097924736 12:65114866-65114888 GTGGAGATTCAGAAAAATGAAGG + Intronic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098480314 12:70950286-70950308 TTGGAGACTCAGAAGGGATGAGG - Intergenic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1100354316 12:93814691-93814713 CTGGAGGCTCAGAGAGTTGGTGG - Intronic
1100845150 12:98650587-98650609 TAAGAGACTTAGAAATATGGAGG + Intronic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101411494 12:104472564-104472586 ATGGAGACTCAGAAGGATTTAGG + Intronic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101520439 12:105477550-105477572 TTAGAGACTCAGAAAGGGGAAGG - Intergenic
1101531518 12:105577393-105577415 TTGGAAACTGAGACACATGGGGG + Intergenic
1101946738 12:109143129-109143151 TTGGAGACTCAGAGAGGGGAAGG - Intronic
1102401347 12:112632355-112632377 TTGGAGACTCAGAAAGATGGAGG - Intronic
1103222373 12:119256539-119256561 ACTGAGACTCAGAAAGATTGGGG + Intergenic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1107283071 13:38758329-38758351 TTAGACATTCAGAGAGATGGAGG - Intronic
1107724198 13:43281317-43281339 TTGGAGTCTATGCAAGATGGTGG - Intronic
1107959191 13:45543621-45543643 TTGGAGCCTCTGGAGGATGGTGG + Intronic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108605344 13:52031812-52031834 TCTGAGACTCAGAAAGATAAAGG - Exonic
1108976642 13:56452319-56452341 TTGGAGACTCAGAATAGGGGAGG - Intergenic
1109019221 13:57063423-57063445 GTGGAGTCTCGGTAAGATGGTGG + Intergenic
1109131154 13:58587401-58587423 TTGAAAACACAGAAAGATGGTGG + Intergenic
1110438962 13:75506951-75506973 TAAGAGACAAAGAAAGATGGAGG + Intergenic
1110796944 13:79649952-79649974 TTGGAGACTCGGAAGTAGGGAGG - Intergenic
1111164542 13:84441853-84441875 TTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1111691846 13:91573730-91573752 TTGGACACTAAGCAATATGGAGG + Intronic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1115371366 14:32618351-32618373 TTGGCGACTCAGAAGCAGGGAGG - Intronic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116754774 14:48933362-48933384 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1116762786 14:49035343-49035365 CTGGAGATTCAGAAGGGTGGGGG + Intergenic
1117061634 14:51969999-51970021 TTGGGGACAGAGAAAGGTGGGGG + Intronic
1117207162 14:53455300-53455322 CTGGAGACTCAGAAAGAGTGAGG + Intergenic
1118433557 14:65747739-65747761 TTAGAGACTCAGAAAGAGGAGGG + Intergenic
1118480916 14:66164589-66164611 TTGGAGACCCACAAAGGAGGAGG + Intergenic
1118918136 14:70125330-70125352 TTGGAGACTCGGAAGGGTGGGGG - Intronic
1119153567 14:72387896-72387918 GTGGAGACTCAGTGAGAAGGCGG - Intronic
1120139588 14:80913755-80913777 GTGGAGACTCAGAAGGGAGGAGG + Intronic
1120918864 14:89736083-89736105 TTGGAGACTCAAAAGGTTTGTGG - Intergenic
1123414752 15:20087133-20087155 TCTGAGACTCAGAAAGGTTGAGG + Intergenic
1123524094 15:21094247-21094269 TCTGAGACTCAGAAAGGTTGAGG + Intergenic
1124064913 15:26333387-26333409 CTGGAGACTCTAAAGGATGGGGG + Intergenic
1124938492 15:34195416-34195438 ATGGAGACTCAGAGAGGTAGGGG + Intronic
1126138531 15:45416393-45416415 GAAGAGACTCAGAAAGAGGGAGG - Intronic
1126304046 15:47234501-47234523 TTGGAGACTCAGGAAGGGGAAGG - Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1127052475 15:55099250-55099272 CGGGAGACTCAGAAACGTGGCGG + Intergenic
1127349649 15:58137757-58137779 TCCAAGAATCAGAAAGATGGAGG - Intronic
1127714545 15:61636719-61636741 TTGGGGACTCAGAAGGGAGGTGG + Intergenic
1127767425 15:62200508-62200530 TTGGAGACTCCAAAAGTGGGAGG + Intergenic
1128092024 15:64925787-64925809 GTGGAGGCTCAGAGAGGTGGAGG + Intronic
1128691618 15:69728440-69728462 TTGAAGACTCAGAAGCAGGGAGG - Intergenic
1129488722 15:75903381-75903403 ATGTAAACTCAGAAATATGGCGG + Intergenic
1129673988 15:77622488-77622510 AGGGAGACTCAGAAAGGTGAGGG + Intronic
1130043073 15:80421240-80421262 TTGGAGACTCAGAAGGGTGGAGG + Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130374418 15:83315522-83315544 TTGGAGACTCAGAAGCGGGGAGG + Intergenic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1130963415 15:88680280-88680302 TTGGCGACTCAGTGAGCTGGCGG + Intergenic
1131080837 15:89533476-89533498 ATGGAGACTCAGAATGCTGAGGG - Intergenic
1131299718 15:91186696-91186718 CTGGAGACTCAGAAGGCTGTGGG + Intronic
1131329377 15:91482519-91482541 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1131476358 15:92743551-92743573 TTGGAGAGTCTGAAGGAAGGAGG + Intronic
1131513328 15:93061680-93061702 TCTGAGAATCAGAAAGATAGGGG + Intronic
1131572089 15:93548780-93548802 TTGGAGACTCAGAAGGGTACAGG + Intergenic
1132345649 15:101107199-101107221 TTGGAGACTCAAAACAATGATGG + Intergenic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1133542090 16:6765962-6765984 TTGGAGACTCAGAAGATGGGAGG + Intronic
1133578486 16:7118412-7118434 TCAGAGACTCAGAAGGAGGGAGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133712036 16:8410780-8410802 TTGGAGACTCAGAAGCAGAGAGG + Intergenic
1133886942 16:9838894-9838916 CTGGAGACTCAGAAAGGGAGAGG + Intronic
1134380914 16:13725097-13725119 TTGGAGACTCAGAAATGGGGAGG + Intergenic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135376469 16:21951882-21951904 ATGGAGACTCCGAAAGGTGGAGG + Intergenic
1135871301 16:26153256-26153278 CTGGAGATACAGAAAGATGGCGG + Intergenic
1135948590 16:26889844-26889866 TTCCAGACTCAGAAAGAGGAGGG - Intergenic
1137067998 16:35869753-35869775 TTGAAGATTCACAAATATGGTGG + Intergenic
1138719673 16:59064883-59064905 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1138862997 16:60781861-60781883 TTTGAGGCTCAGAAAGATGACGG - Intergenic
1139500534 16:67360712-67360734 TTAGAGCCTCAGATGGATGGAGG + Intronic
1140451802 16:75076866-75076888 TGTGAGACACAGCAAGATGGTGG + Intronic
1140705238 16:77622657-77622679 TTGGAGACTGAGAAAGGGGAAGG - Intergenic
1140951679 16:79824465-79824487 TTGGAGACTTAGGGAGAAGGTGG + Intergenic
1141030387 16:80582631-80582653 TTAGAGACTCAGAAGGAGGAAGG + Intergenic
1143293124 17:5848113-5848135 CTGAAGACTCAGAAAGGAGGAGG - Intronic
1143816674 17:9522031-9522053 TTGGAGACCCAAAAAAATGATGG - Intronic
1143857391 17:9862288-9862310 TTGAAGACCCAGAGAGAAGGAGG - Intronic
1143965584 17:10754541-10754563 ACGCAGACTCAGAAAGATGCTGG - Intergenic
1144504274 17:15817023-15817045 ATGGGGACTCAAAAAGTTGGGGG + Intergenic
1144634028 17:16892690-16892712 CTGGGGACTCAAAAAGTTGGGGG + Intergenic
1144899400 17:18569931-18569953 TCTGAGAATCAGAAAGATAGGGG - Intergenic
1145168129 17:20632530-20632552 GTGGGGACTCAAAAAGTTGGGGG + Intergenic
1146402080 17:32507819-32507841 GTGAGGACTCAGAAAGAAGGTGG + Intronic
1146542442 17:33709093-33709115 ATGGAGACCCAGAAAGATGTAGG - Intronic
1147566828 17:41541609-41541631 TGGGAGAGGCACAAAGATGGAGG + Intergenic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1149020235 17:51955195-51955217 TTCGAGATGCAGAAAGATGAAGG - Intronic
1149235135 17:54580859-54580881 TTGGAAATTCAGATAGCTGGTGG + Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1149623012 17:58060263-58060285 ATGGAGTCCAAGAAAGATGGAGG + Intergenic
1149857992 17:60101474-60101496 TTTGAGAGTCCGAAAGATGATGG - Intergenic
1152334570 17:79693173-79693195 ATGGAGACTCTGAATGATGGTGG + Intergenic
1152401029 17:80066208-80066230 GTGGAGACTACGAAAGGTGGAGG - Intronic
1153067588 18:1063491-1063513 TTGGAGACTGAGAACCCTGGTGG - Intergenic
1153499597 18:5734651-5734673 CTGGAGACTCAGAAGGGTGGAGG + Intergenic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1154382682 18:13866927-13866949 CTGGATAATTAGAAAGATGGTGG - Intergenic
1155641321 18:28019129-28019151 TTGGAGACTCAGGGAAAGGGTGG + Intronic
1156020120 18:32589943-32589965 AAGGAGTCTCAGAAAGAGGGTGG + Intergenic
1156178855 18:34579919-34579941 TTGGAGCCTCAGAAAAGTAGCGG - Intronic
1156399755 18:36729590-36729612 TTGAAGACACAGCAAGAAGGTGG - Intronic
1156422850 18:36974327-36974349 TTGGAGACTCAGAAGAGTGGAGG - Intronic
1158294312 18:55977936-55977958 TTGGAGATTCAGAAGGGAGGAGG + Intergenic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1158859440 18:61578030-61578052 GTGGACACTCAGAAGGGTGGAGG + Intergenic
1159768984 18:72526662-72526684 TTGGAGACTCAGATGCAGGGAGG - Intergenic
1159801301 18:72903244-72903266 TTGGAGAATCAGAAGAAGGGAGG - Intergenic
1159838845 18:73372888-73372910 TTGTAGTCTCTGAAGGATGGTGG - Intergenic
1159950258 18:74477986-74478008 TTGGAGACACAGAACTATGGGGG - Intergenic
1162154563 19:8668475-8668497 TAGGTGACTCAGAAAGATAAAGG - Intergenic
1163207373 19:15813581-15813603 GTGGAGACACAGAGAGATGTGGG + Intergenic
1163379599 19:16956374-16956396 TGGGAGGCAGAGAAAGATGGTGG - Intronic
1163688507 19:18725662-18725684 TGGGAGGCTCAGGAAGAGGGAGG - Intronic
1164773295 19:30830039-30830061 TTGGATACTCAGAAGGTAGGAGG - Intergenic
1164901388 19:31928515-31928537 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1165076942 19:33284800-33284822 TTGGAAAGACAGAAAGATGAAGG - Intergenic
1165258148 19:34592402-34592424 AGGGAGACTCAGAGGGATGGAGG + Intergenic
1166302651 19:41921215-41921237 TCAGAGACCCAGAGAGATGGAGG + Intronic
1166880603 19:45927627-45927649 CTGGAGAGTGAAAAAGATGGGGG + Intergenic
1167220510 19:48195754-48195776 TTGGAGGGTGAGAAAGATTGGGG + Exonic
1167359069 19:49020319-49020341 CTGGAGACCCAGAAAGATAGGGG - Intergenic
1167366756 19:49058556-49058578 CTGGGGACCCAGAAAGATGGGGG - Exonic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167793385 19:51693966-51693988 ATGGAGACTCAGAGAGGGGGAGG + Intergenic
1168084190 19:54033319-54033341 GTGGAGACACAGCAAGAAGGCGG - Intergenic
1168430732 19:56277739-56277761 ATAGAGACTCAGAAGGAAGGAGG + Intronic
1168504856 19:56924945-56924967 TGTGAGACCCAGAAATATGGCGG - Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
926995626 2:18732422-18732444 CTGGAGACACAGAAGGATTGGGG + Intergenic
927144662 2:20154947-20154969 TTGGAGTCTCAGAAAGAGGTGGG + Intergenic
928870123 2:35965977-35965999 CTGGAGACCCAGGAAGCTGGTGG - Intergenic
929567522 2:42999197-42999219 TTGGAGACCAAGATAGAGGGAGG + Intergenic
930349695 2:50234805-50234827 TCGGAGATTCAGAAAGAAGAAGG + Intronic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930528325 2:52559784-52559806 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
930950131 2:57131332-57131354 TTGGAGACTCAAAAAGGAGGAGG - Intergenic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933296481 2:80496914-80496936 TTGGTGAGTCATAAACATGGGGG - Intronic
933458335 2:82545669-82545691 ATGGAGACTAAGAAGGGTGGAGG - Intergenic
933574642 2:84053757-84053779 TTGGAGCCAGAGAAAAATGGGGG + Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934055242 2:88246070-88246092 GTGGAGAAACAGAAACATGGAGG - Intergenic
934894039 2:98097253-98097275 TTGGAGACTCAGAAGTGGGGAGG - Intronic
936336284 2:111593480-111593502 TAGCAGCCTGAGAAAGATGGGGG - Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
937922719 2:127143225-127143247 TTGGAGGAGCAGAAGGATGGTGG - Intergenic
938132817 2:128732063-128732085 CTGGAGACACAGAAAGACAGAGG + Intergenic
938733855 2:134168259-134168281 TTTTAGACACAAAAAGATGGGGG + Intronic
938947860 2:136229863-136229885 TTGGGGACTCAGGGAAATGGTGG + Intergenic
939027417 2:137030758-137030780 CTGGAGACTCAGAAATGGGGAGG + Intronic
942478041 2:176349976-176349998 TTAGAGGCTGAGAAGGATGGGGG - Intergenic
942829380 2:180221619-180221641 TTCCTGACTCACAAAGATGGAGG - Intergenic
942981130 2:182083408-182083430 TTGGAGACTCAGAAATGGGCAGG - Intronic
943265258 2:185722669-185722691 TTGGAGACTTAGAAGTAGGGAGG - Intergenic
944310194 2:198224601-198224623 TTTGAGCATCAGTAAGATGGTGG + Intronic
945327680 2:208501550-208501572 CTAGAGACTCAGAAAGGGGGAGG - Intronic
945373916 2:209056534-209056556 TTGGAGATTCAGAAAAGGGGAGG + Intergenic
946150517 2:217764156-217764178 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
946773920 2:223117877-223117899 ATGGAGACACAGGAAGAAGGAGG + Intronic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
946906740 2:224424621-224424643 TTTGAGACTGAGAAGGATGGAGG + Intergenic
947369410 2:229429098-229429120 TTGGAGGGTCACCAAGATGGTGG + Intronic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
948669853 2:239561306-239561328 CTGGAGACTCAGAAAGGAGGTGG - Intergenic
1168932837 20:1637839-1637861 CTGGAGAATCAGAAAAATGAGGG + Intronic
1168936833 20:1672983-1673005 TTAGAGAATCAGAAAAATGAAGG + Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1169812341 20:9620729-9620751 TGGGAGAGTCTGAGAGATGGTGG + Intronic
1170092018 20:12599739-12599761 TTGGAGACTCAGAAAGCTGGAGG + Intergenic
1170388036 20:15841738-15841760 GAGGAGACTTAGAATGATGGTGG + Intronic
1170443012 20:16397778-16397800 TGAGAGACTCACAAAGATAGGGG + Intronic
1170809195 20:19660292-19660314 TTGGAGACTTAGAAGGTGGGGGG - Intronic
1171374537 20:24683374-24683396 CTGGAGACTCAGAACGGTGGGGG + Intergenic
1173532437 20:43780717-43780739 ATGGAGGCTCAGAGAGATGATGG - Intergenic
1174421547 20:50402232-50402254 GTGGAGGGTGAGAAAGATGGAGG + Intergenic
1174921978 20:54713098-54713120 ATGGGGACACAGAAAGAAGGTGG + Intergenic
1175003254 20:55653373-55653395 TAGGAGACTCAGAGGGCTGGTGG - Intergenic
1175033747 20:55980211-55980233 TTGGGGACTCAGGAAGGTTGGGG - Intergenic
1175750333 20:61492591-61492613 ATGAAGACTCAGATAGATGGTGG + Intronic
1176673663 21:9757309-9757331 CTCGAGACTCAGAAAGCTGCCGG + Intergenic
1177112192 21:17042023-17042045 ATGGAGGCTCAGAAGGATTGGGG + Intergenic
1177864798 21:26500084-26500106 GTGAAGACACAGCAAGATGGTGG - Intronic
1178755710 21:35347479-35347501 TTGGGGACTCAGAAAGGTGAGGG - Intronic
1179182413 21:39057169-39057191 CTGAAGACTCAGTAAGATGAAGG + Intergenic
1179313248 21:40215640-40215662 TTGGAGACTCAGAAGTGGGGAGG + Intronic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1181447690 22:22990823-22990845 TTGGATAATGATAAAGATGGAGG - Intergenic
1181885192 22:26016627-26016649 ATGGAGGAACAGAAAGATGGGGG - Intronic
1182208144 22:28649196-28649218 TTGGAGACTCAGGAGGTAGGAGG + Intronic
1182545355 22:31072433-31072455 TCTGAGACTCAGAAAGGTTGAGG - Intronic
1184644176 22:45887171-45887193 CTGGAGAGTCAGGGAGATGGAGG + Intergenic
1184776670 22:46626853-46626875 TTGGAGACTCCGCTAGATCGAGG - Exonic
1184920736 22:47603929-47603951 GTGAAGACTCAGGAAGAAGGTGG - Intergenic
1185108918 22:48890004-48890026 TTCGGGACTCAGACACATGGAGG + Intergenic
950199374 3:11032291-11032313 CTGGAGACTCAGAAGGGTGGGGG - Intronic
951438519 3:22693951-22693973 TTGGAGACTCGGAAAGGGGATGG - Intergenic
951465902 3:23000239-23000261 TTGGAGTATGAGAAAAATGGAGG - Intergenic
951514730 3:23545989-23546011 TTGGAGACTCAGAAGAGAGGAGG + Intronic
951823662 3:26843109-26843131 TTGGAGACTTTGAAGGGTGGGGG + Intergenic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952372152 3:32732744-32732766 TTAGAGACTTAGAATGAAGGGGG + Intronic
953028974 3:39163967-39163989 TTGAAGACTCAGAAGTAGGGGGG - Intergenic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
953466348 3:43123531-43123553 TTGCAGCCTCAGAGAGATGGGGG + Intergenic
953869811 3:46616484-46616506 TTGGAGACTCAGAAGGAAAGAGG - Intronic
954517205 3:51189418-51189440 TTAGAGACTCAGAAAGGGGAGGG - Intronic
954712532 3:52512258-52512280 CTGGACAGGCAGAAAGATGGGGG + Intronic
955168533 3:56539976-56539998 TTGGAGACAGAGAATGAAGGAGG - Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
955663582 3:61327186-61327208 GTGGAGAAGCAGAAAGCTGGTGG + Intergenic
955893861 3:63678120-63678142 TTGGGGCCTGAGAAATATGGTGG + Intronic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956314503 3:67919515-67919537 TTGGAGACTCTGAAAGTGGGAGG - Intergenic
956390480 3:68767628-68767650 TTTGGGACACAGAAAGATGAGGG + Intronic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
956856093 3:73276273-73276295 TTGGAGACTCAGAAGTAGGCTGG - Intergenic
957973741 3:87416928-87416950 GTGGAGACACAGCAAGAAGGTGG + Intergenic
958811821 3:98868610-98868632 TCGGAGACTCAGAAAGGGGGAGG - Intronic
959019120 3:101169103-101169125 TAGAAGACCCAGAAAGGTGGTGG - Intergenic
959352290 3:105281090-105281112 TTGGAGGCTCAGAAGGATGTGGG + Intergenic
959614516 3:108332206-108332228 TTCCAGACTCAGAAAAATGGAGG + Intronic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960509716 3:118534493-118534515 ATGGAGCCTCAGAGAGATGATGG + Intergenic
960752283 3:120968711-120968733 TTGGATACTCAGAACGGGGGAGG - Intronic
961085350 3:124062687-124062709 TTGGTGCCTTAGAAAAATGGAGG + Intergenic
961715149 3:128852870-128852892 GTGTAGACTCAGAAGGCTGGGGG + Intergenic
961994431 3:131226664-131226686 TTGGAGACTCAGAAGGGAGGAGG + Intronic
962704961 3:138034139-138034161 ATGGAGACTCAGAAAGTTTAAGG - Intergenic
962757004 3:138472679-138472701 TGGGACAGTCAGGAAGATGGTGG - Exonic
963866449 3:150367204-150367226 TTAGAGACAAGGAAAGATGGAGG - Intergenic
964635497 3:158853822-158853844 TTGGAAACTCAGAAGGAAGGTGG - Intergenic
965045632 3:163573347-163573369 AAGAAGACTCAGAAACATGGTGG - Intergenic
966674960 3:182575280-182575302 TTAGAGACTGGGAAGGATGGGGG + Intergenic
967728501 3:192884336-192884358 TTGGAGACTCAGGTAGGTGGAGG + Intronic
967790523 3:193543941-193543963 TCTGAGACTCAGAAAGAGGCTGG + Intronic
967940934 3:194766063-194766085 TTGGAGACTCAGATGCAGGGAGG + Intergenic
969897174 4:10316274-10316296 TTGGAGACTCAGAAGGGTCATGG - Intergenic
970165722 4:13235849-13235871 TTGGAGACTCAGAAAAGGGGAGG + Intergenic
970221422 4:13815836-13815858 ATGGAGACTCAGAAGGGTGTGGG - Intergenic
970497914 4:16645807-16645829 ATTGAGACTTAGAAAGATGAAGG - Intronic
971428266 4:26537236-26537258 TAGGAGACAAAGAGAGATGGCGG - Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
971921753 4:32949526-32949548 TTGGGGACTCAGGGAAATGGGGG + Intergenic
971975679 4:33683311-33683333 TTGGAGACTCAGAATGGGGGAGG - Intergenic
972446038 4:39144713-39144735 CTGGAGACTCAGAAATGGGGAGG - Intergenic
972972034 4:44588726-44588748 TTGGAGACTACAAAAGGTGGCGG + Intergenic
973156296 4:46957671-46957693 ATGGAGGCTGAGATAGATGGTGG - Intronic
973192408 4:47400727-47400749 TTGGAGACTCAGAAGTGGGGAGG - Intronic
973695061 4:53482688-53482710 TTGGAGACTCAGAAAAGGGGAGG + Intronic
974490058 4:62553146-62553168 TTAGAGACTCAGAAAGGAGAGGG - Intergenic
974962980 4:68726646-68726668 TTAGAGACTCAGAAAGGAGAGGG - Intergenic
975952925 4:79796163-79796185 TTGGAGATACAGAAATATGTAGG - Intergenic
976191084 4:82487698-82487720 TTGGAAAATCAGCAAAATGGTGG + Intronic
976249490 4:83035452-83035474 TGGGAGAAGCAGAAAGCTGGAGG + Intronic
976277553 4:83292845-83292867 TTGGAGACTCAGAAGGGAAGAGG + Exonic
976563987 4:86532720-86532742 TTGGAGATTCAGAAAAGTGGAGG - Intronic
977069468 4:92366242-92366264 TGGGAAACTAAGAAACATGGAGG - Intronic
977198948 4:94092490-94092512 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
977509533 4:97945214-97945236 TTGGAGACTTAGAAAGGGGAGGG - Intronic
977608358 4:99005905-99005927 TTGGAGACTCAGAAAGGGGGAGG + Intronic
977910285 4:102526325-102526347 ATGGAGATTCAGAAAGGTGAGGG + Intronic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
978102318 4:104857503-104857525 TTTTAGAGACAGAAAGATGGGGG + Intergenic
978523196 4:109637736-109637758 TTGGGGACTCGGGAAAATGGTGG + Intronic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
979760787 4:124401229-124401251 TTGGAGACTCAGAATAGTGGGGG - Intergenic
980548569 4:134302958-134302980 TTGGAGACTCAAAAGCATGGAGG - Intergenic
980747638 4:137040303-137040325 TTGGAAACTCAGAATGGGGGAGG - Intergenic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981730553 4:147892670-147892692 TTGGAGACTCAGAGGAAGGGGGG + Intronic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
982039455 4:151381337-151381359 TTGGAGACTCAGAAGGGTATAGG + Intergenic
982188387 4:152826458-152826480 TTGGAGACTCAGAAGAGGGGAGG + Intronic
982195098 4:152903912-152903934 TTAGAGAGTCAGAAAGAAAGTGG - Intronic
982422447 4:155213116-155213138 TTGGAGACTCATAAAGGAGAGGG + Intronic
982431777 4:155330889-155330911 TTGGAGACTCAGAAAGGTGGAGG + Intergenic
982812293 4:159841056-159841078 TTGGAGGTTCAGAAAGGAGGAGG - Intergenic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983732123 4:171008695-171008717 TTGGAGACTCAGGAATTTGTAGG + Intergenic
983845138 4:172508561-172508583 TTGGGGACTCAGGGAGAAGGGGG - Intronic
983898523 4:173107108-173107130 TAGGAGACTCAGGAAGAAGAAGG + Intergenic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984475424 4:180228880-180228902 TTGGAAACACAGTAAGATGAAGG - Intergenic
984477443 4:180255254-180255276 TTTCATTCTCAGAAAGATGGAGG + Intergenic
985042795 4:185908752-185908774 TAGGAGACCCACAATGATGGAGG + Intronic
985401045 4:189594360-189594382 CTCGAGACTCAGAAAGCTGCCGG - Intergenic
985671573 5:1209494-1209516 TTGGAGACTCAGGGAGAGGCTGG - Intronic
985849604 5:2379010-2379032 CTGGAGACTCTGCAAGATGCTGG + Intergenic
986408586 5:7452252-7452274 TTGGAAACTCAGAAATGGGGAGG - Intronic
986879008 5:12147283-12147305 TTGAAGACTCAGAAGGGTGGGGG - Intergenic
986991206 5:13554804-13554826 ATGTAGAGTCAGAGAGATGGAGG + Intergenic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987625555 5:20395428-20395450 CTGGAGACTCAGAAATAGAGAGG + Intronic
987822961 5:22990391-22990413 TTGGAGGCAGAGCAAGATGGTGG + Intergenic
988113599 5:26854874-26854896 TTGGAAACTCAGAAGTAGGGAGG + Intergenic
988222331 5:28364241-28364263 ATGGAGACTCAGAAGGGTAGGGG + Intergenic
988559940 5:32271988-32272010 TTGGATATTAAGAAAAATGGGGG + Intronic
988979029 5:36545905-36545927 TTGGAGACTCAGAAGTAAGGAGG + Intergenic
989191939 5:38678869-38678891 CTGGTCACTCAGAAAGAGGGAGG - Intergenic
989392227 5:40912957-40912979 TTGGAGACTCAGAAGAGTTGGGG - Intronic
989407748 5:41080303-41080325 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
989427672 5:41315468-41315490 TGGGAGGCTGAGCAAGATGGTGG + Intronic
989723583 5:44559568-44559590 TTGGGGACTCAGGGAGAGGGTGG + Intergenic
990709972 5:58569709-58569731 TTGGAGGCGCAGGAAGATGAAGG - Intergenic
991963805 5:72071534-72071556 ATGGAGACTAACCAAGATGGTGG + Intergenic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992276388 5:75124803-75124825 CTGGAGACTCAGAAGGGTAGGGG + Intronic
992333913 5:75745760-75745782 ATTTAAACTCAGAAAGATGGAGG + Intergenic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
993165064 5:84342401-84342423 ATGGAGACTCAGAAAGGTGGGGG + Intronic
993172594 5:84438429-84438451 TTGGAGATTAACAAAGATAGTGG - Intergenic
993262598 5:85679015-85679037 TTGGAGACTTAGAAGTCTGGGGG + Intergenic
993698541 5:91091641-91091663 TTGGAGACTGAAGAAGCTGGTGG + Intronic
994028028 5:95107608-95107630 TGAGAGACTCAGAAAAGTGGAGG - Intronic
994388675 5:99163524-99163546 TTGGAGACTCAGAAATGGGAAGG + Intergenic
996077568 5:119214930-119214952 TTGGCGACAGAGAAAGATGATGG - Intronic
996288077 5:121818639-121818661 TAGGAGACACAGAACCATGGTGG - Intergenic
996512513 5:124332797-124332819 TAGGAGAATAAGAAAGATAGGGG + Intergenic
996810845 5:127515071-127515093 TTTGAGACACAGAGACATGGGGG + Intergenic
997886729 5:137637115-137637137 GTTGAGACTCAGAGAGGTGGTGG - Intronic
998296168 5:140970962-140970984 TTGTAGATTAAGAAAAATGGGGG + Intronic
999496361 5:152102713-152102735 TTGCAGACTCTGATAGAAGGAGG + Intergenic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
1000160175 5:158589800-158589822 TTAGAGACTCTGAAAGGTTGGGG - Intergenic
1000250450 5:159489763-159489785 TAGAAGACTCTGAAAGCTGGAGG + Intergenic
1000441347 5:161267432-161267454 TTGGAGACTCAGAAGTGAGGAGG + Intergenic
1000459779 5:161500237-161500259 TCTGAGTCTCAGAAAGATGGAGG - Intronic
1000641073 5:163702265-163702287 TTAGAGACTCAGAAGGGTGAAGG - Intergenic
1000821004 5:165983167-165983189 TTGGAGACTCTGAATGGGGGAGG + Intergenic
1001018369 5:168162148-168162170 TTTAAAACTCTGAAAGATGGCGG + Intronic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001425399 5:171619141-171619163 TTGGAGACACAGAAAAGTGATGG + Intergenic
1001427018 5:171629392-171629414 ATGGAGGCTCAGAGAGAGGGAGG + Intergenic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1002787749 6:417332-417354 TTGGAGACCCAAACAGAGGGTGG - Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1003539148 6:7002922-7002944 TTGGAATCTCAGAGAGATGTAGG - Intergenic
1004985277 6:21074974-21074996 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1005183125 6:23129848-23129870 TGGGAGACTCAACAAAATGGAGG + Intergenic
1005259595 6:24043547-24043569 TGGGAGTCTAAGGAAGATGGCGG - Intergenic
1005285184 6:24318558-24318580 TTAGAGACTCAGAAGGATGCTGG - Intronic
1005422816 6:25670484-25670506 TTGGAGAGTCAGATAGATGAAGG + Intronic
1005454224 6:26003653-26003675 CTGGAAACTCAGAGAGATGATGG + Intergenic
1006241288 6:32681328-32681350 TTGGAGACTCAGAAGAGGGGAGG - Intergenic
1006339011 6:33435766-33435788 TGGGGGACTCAGAATAATGGGGG - Intronic
1008117523 6:47569240-47569262 ATGGAAACTCAGAAGAATGGTGG + Intronic
1009278340 6:61714881-61714903 ATGGAGACTCAGAAGAGTGGGGG + Intronic
1009709998 6:67305925-67305947 CTGGAGACTCAGAAAGGAGGAGG - Intergenic
1010977008 6:82326572-82326594 TTGGAGACTCAGAAGAAAGGAGG - Intergenic
1011500018 6:87977874-87977896 TTTGAGAATAAGTAAGATGGTGG + Intergenic
1011505860 6:88043211-88043233 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1012700028 6:102444390-102444412 TTGGAGACTCACAAGGGAGGAGG - Intergenic
1012823142 6:104114154-104114176 ATGGAAACTCAGAATGATGAGGG - Intergenic
1013496156 6:110699563-110699585 TTGGAGATTCAGAAGAAGGGAGG + Intronic
1013983303 6:116159782-116159804 TTGGGGACTCCAAAAGGTGGGGG - Intronic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014246491 6:119075900-119075922 TTGTAGAAACAGAAAGATGTTGG + Intronic
1015236525 6:130977636-130977658 TTGGAGACTTAGAATTTTGGGGG - Intronic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1016150628 6:140737554-140737576 TTGGAGACTCAGAAAGGAGAGGG - Intergenic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1016741318 6:147532297-147532319 TTGGGGACTCAGGGAGGTGGGGG - Intronic
1016756542 6:147693663-147693685 TGAGAGAATCAGAAAGATTGGGG + Intronic
1016927446 6:149365717-149365739 TTGGAGATTCAGAAGGAAAGGGG - Intronic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017589585 6:155964361-155964383 TTGGGGATTCAGAAATATGAGGG - Intergenic
1017938360 6:159027334-159027356 TTGGAGACTCAGAATGGGGGAGG + Intergenic
1018049108 6:159992370-159992392 CTGGAGACTCAGAAAGGTTGGGG - Intronic
1019098440 6:169607612-169607634 CTGGAGACTCAGAAGGGTAGAGG + Intronic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1019805392 7:3119959-3119981 TGGGAGACTCACAAAGATTTAGG + Intergenic
1019978215 7:4601483-4601505 CTGGAGACTCTGAAGGGTGGGGG + Intergenic
1020970252 7:14928831-14928853 ATGGAGACTCAGATGGATGAGGG - Intronic
1021118134 7:16766797-16766819 TTGGTGACTTAGTAAGAAGGGGG + Intronic
1021466500 7:20949987-20950009 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
1022180843 7:27917891-27917913 GTGGAGAGTCAGAAATATGTGGG - Intronic
1024094568 7:45973720-45973742 TGGGAGACTCAGAAAAGTGAGGG + Intergenic
1024272458 7:47652864-47652886 AGGGAGACTCAGAAGGGTGGAGG + Intergenic
1024979719 7:55147080-55147102 CTGGAGACTCAGAAGCATGTAGG - Intronic
1025164067 7:56695403-56695425 TTTGAGATTCAGAAAGAAGGTGG + Intergenic
1025706219 7:63866675-63866697 TTTGAGATTCAGAAAGAAGGTGG - Intergenic
1026086560 7:67267853-67267875 TTCCAGACTCAGCAGGATGGAGG - Intergenic
1026228568 7:68463642-68463664 TTGGTTACACAGAAACATGGAGG - Intergenic
1026690579 7:72547005-72547027 TTCCAGACTCAGCAGGATGGAGG + Intergenic
1027364136 7:77439897-77439919 TTAGAGACTCAGGGTGATGGAGG - Intergenic
1027622687 7:80510617-80510639 TTGGTGACTTTGAAAGATGTGGG - Intronic
1027823996 7:83087287-83087309 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1027918956 7:84365478-84365500 TTGGAGACAAAGAGAGATGAGGG - Intronic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028607593 7:92671969-92671991 TTGGAGACTCAGAAAGGGGGAGG + Intronic
1028967498 7:96818269-96818291 TTGGAGACTCAGAAGAGGGGTGG - Intergenic
1028974139 7:96893261-96893283 TTTGAGACAAAGAAAGATGTAGG - Intergenic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1031395205 7:121265310-121265332 TTTGAGGGTCAGGAAGATGGAGG - Intronic
1033023502 7:137750767-137750789 TTGGGGACTCAGGAAGATAAAGG + Intronic
1033398318 7:140996593-140996615 TAGGAGAGACAGAAGGATGGAGG - Intergenic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1034071701 7:148192259-148192281 GTGGAGACTCAGAAGGGTGTAGG - Intronic
1035522910 8:289833-289855 ATGGAGACTCTGAAAGAGGGAGG - Intergenic
1036075195 8:5491053-5491075 TTGGAGACTAAGATTGCTGGAGG - Intergenic
1036986961 8:13543828-13543850 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1037712393 8:21365314-21365336 TTGGAGACTTGGAAGGGTGGAGG - Intergenic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038932233 8:32206791-32206813 CTGGAGACTCAGAAGGGTGGAGG - Intronic
1039020197 8:33196827-33196849 CTGGAGACTAAGTATGATGGCGG - Intergenic
1039052428 8:33507044-33507066 GTGGAGACTCAGGAATGTGGAGG + Intronic
1039208294 8:35182250-35182272 TTGCAGACTCAGAATGGGGGAGG + Intergenic
1039800409 8:40949802-40949824 GTGAAGACACAGAAAGAAGGTGG + Intergenic
1039859912 8:41448207-41448229 TTGGAGACCCAGTAAGATCAAGG - Intergenic
1039945647 8:42126766-42126788 TTGGAGACAGAGAAGGAGGGAGG - Intergenic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040691774 8:49947439-49947461 TTGGACCCTCATAAAGATAGTGG - Intronic
1040883920 8:52238842-52238864 TGGGAGACTCGGAAGGGTGGGGG + Intronic
1040970397 8:53130002-53130024 TTGGAGACTCAGAAACAGGAGGG - Intergenic
1041319254 8:56596363-56596385 TAGGAGACTCAGAAGGTGGGAGG - Intergenic
1041744988 8:61198722-61198744 TTGGAGACTTAGAAGAAGGGAGG - Intronic
1041893551 8:62898545-62898567 TTGGAGACTCAGAAGGGAGGAGG + Intronic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1043355621 8:79408858-79408880 TTGGAGACTCAGAAGGGGAGAGG - Intergenic
1043366521 8:79539454-79539476 TTGGAGACTCAGAAGGGTAGTGG - Intergenic
1043480097 8:80644159-80644181 TAGGAGACTAAGGCAGATGGAGG + Intronic
1043488706 8:80725523-80725545 TTGGAGTCTCAGATACATAGGGG + Intronic
1043736315 8:83749771-83749793 TTGGAGACTCAGAAGGGTAAAGG - Intergenic
1044505936 8:93019397-93019419 TTGGACAGTAAGAAAAATGGAGG + Intergenic
1044718292 8:95121478-95121500 TTGAAGAGGCACAAAGATGGTGG + Intergenic
1044918700 8:97145189-97145211 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1046232951 8:111381475-111381497 TTGGAGACTCAGAAGGGGGCAGG - Intergenic
1046730569 8:117721263-117721285 TTGGAGACTCAGAAGGGTTGGGG - Intergenic
1046927890 8:119812478-119812500 TTGGAGACTCAGAAGCGGGGAGG - Intronic
1047022640 8:120792333-120792355 TTGGAGACTCAGAAAAGGGGAGG + Intronic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047504099 8:125465224-125465246 TTGGAGACACAGAGAGGTGATGG - Intergenic
1047508445 8:125497856-125497878 ATGGAGAGTCAGCAAGGTGGGGG + Intergenic
1047979491 8:130165766-130165788 TTGGAGAACCAGAAAAATAGAGG + Intronic
1048589696 8:135809998-135810020 CTGGTCACCCAGAAAGATGGAGG - Intergenic
1048666274 8:136664992-136665014 TTAGAGACTCACAAAGAAAGAGG + Intergenic
1048669333 8:136698934-136698956 TTTGAGTATCAGAATGATGGTGG + Intergenic
1050475621 9:6037824-6037846 TTGGAGACTCAGAAGAATGTAGG - Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1050625347 9:7498314-7498336 TTGTAGACTGAGGAAGAAGGAGG - Intergenic
1051875054 9:21784015-21784037 TTAGAGATTGATAAAGATGGAGG - Intergenic
1052178688 9:25498682-25498704 GTAGAGACTCAGAAAAATGTGGG + Intergenic
1052208163 9:25869004-25869026 GTGAAGACTCAGAAAGGAGGAGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053478883 9:38401523-38401545 CTGGAGTCTGAGAAATATGGAGG + Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054866087 9:70003215-70003237 TTGGATTCTCAGAAAGATGGTGG - Intergenic
1056281703 9:85047846-85047868 TTGGATACTCAGAAAGGGGGAGG - Intergenic
1057559153 9:96113838-96113860 TTGGAGATCCATAAAGCTGGAGG - Intronic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1058348043 9:103988003-103988025 TTGGAGACTCAGAAGTAGGTAGG + Intergenic
1059218410 9:112589238-112589260 TGGGAGAATCAGAAAAATGAGGG - Intronic
1059580731 9:115545800-115545822 TTGGAGACTCAGTCAGAAGGGGG + Intergenic
1059580914 9:115547326-115547348 TTGGAGACTCAGTCAGAAGGGGG + Intergenic
1059638106 9:116190429-116190451 TTCAAGATTCAGAAAGATGAAGG + Intronic
1059643904 9:116245144-116245166 ATGGACACTCAGAAGGGTGGGGG + Intronic
1060045429 9:120336711-120336733 GTGGGGAGTCAGAAAGATGAGGG + Intergenic
1060573019 9:124660571-124660593 TTGGAGCTGCAGAAAGATGGGGG + Intronic
1060790643 9:126483323-126483345 TTGGAGACTTAAAAAAATGCTGG - Intronic
1061213672 9:129207953-129207975 ATGGAGACTCAGAGAGGTGGCGG + Intergenic
1062175452 9:135159605-135159627 ATTGAGGCACAGAAAGATGGGGG + Intergenic
1185913671 X:4010375-4010397 CTGGAGACCCAGGAAGCTGGTGG + Intergenic
1185962466 X:4560176-4560198 ATGGAGACTCAGAGAGCTCGAGG - Intergenic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186046491 X:5542371-5542393 TTGGAGACTCAGAAAAAGCCTGG - Intergenic
1186202552 X:7169061-7169083 TTGTAGAACCAGACAGATGGTGG - Intergenic
1186226193 X:7401459-7401481 TAGGAGACTCTGAAAAATTGTGG - Intergenic
1186792424 X:13011940-13011962 TCTGAGGCTCAGAAAGATGAAGG - Intergenic
1186826308 X:13343548-13343570 TTGGAGACTCAGAAGGGAGGAGG - Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1187206523 X:17186911-17186933 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
1187716601 X:22108342-22108364 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1187834710 X:23420146-23420168 GTGGAGACTCAGAAGTATGGGGG + Intergenic
1188154577 X:26725021-26725043 TTGGAGACTCAGACATGGGGAGG - Intergenic
1188158113 X:26767124-26767146 TTGGAGATGCAGAAGCATGGGGG + Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188181439 X:27060815-27060837 ATGGAGGCTCAGAAGGGTGGAGG - Intergenic
1188188771 X:27148250-27148272 TTGGAGACTCAAAAAGTGGGAGG + Intergenic
1188206828 X:27370206-27370228 TTGGAGACTCAGAAACAGAAGGG + Intergenic
1188780209 X:34273961-34273983 TTGGACACTCAGAAAGGTGAGGG - Intergenic
1188964293 X:36531897-36531919 TTGGAGACTCAGAAAGCGTTGGG - Intergenic
1189167478 X:38874955-38874977 TTGAAGACTCAGAATGGGGGAGG - Intergenic
1189237580 X:39499558-39499580 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1189268921 X:39736686-39736708 TTGGAGGCTCAGAGAGTGGGTGG - Intergenic
1189584915 X:42449264-42449286 TTGGAGGTGCAGCAAGATGGTGG + Intergenic
1190633380 X:52411131-52411153 TGGGACACTCAGAATGAAGGAGG - Intergenic
1191178398 X:57531987-57532009 TTGGAGACTCAAAAGAAAGGAGG + Intergenic
1191834546 X:65449839-65449861 TTGGAGACTCAGAAGCATGAGGG + Intronic
1192097084 X:68223534-68223556 TTGGAGACTCAGAAAAAGGGTGG + Intronic
1192284389 X:69719505-69719527 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1192805720 X:74506691-74506713 GGAGAGACTCAGAAAGATGAGGG + Intronic
1192851881 X:74965498-74965520 GTGTAGAATGAGAAAGATGGAGG - Intergenic
1193465984 X:81848383-81848405 ATAGAAAATCAGAAAGATGGTGG + Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193525852 X:82587911-82587933 ATGGAGACTCAGACAGGTGGAGG - Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1193736839 X:85167234-85167256 CTGGGGAATCAGAGAGATGGGGG + Intergenic
1193979184 X:88159897-88159919 ATGGAGACTCAGAATGATGGTGG - Intergenic
1194047497 X:89026546-89026568 TTGGAGACTCAGAAGAGAGGAGG - Intergenic
1194453931 X:94079529-94079551 TTGGAGACTCAGAAGCAGGGAGG - Intergenic
1194465139 X:94225357-94225379 TTGGAGACTCAGAAACGGTGAGG + Intergenic
1194615312 X:96093651-96093673 TTGGAGACTCAGAAGGGAGGAGG + Intergenic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1195966715 X:110435596-110435618 TTGGAGACTCAGAAAGAAAGTGG - Intronic
1195969856 X:110461343-110461365 TTGGAGACTCAGAGAAATGTTGG + Intergenic
1196399048 X:115294660-115294682 TGGGAGACTGAGAGAGATGGTGG + Intronic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1196814493 X:119654158-119654180 GTGGAGACTCAGTGAGCTGGCGG - Intronic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197645952 X:129016681-129016703 TTGGAGACTCAGAAGGGGGTAGG - Intergenic
1198000466 X:132430165-132430187 TTTGAGGCTCAGAAATATTGTGG - Intronic
1198038327 X:132823431-132823453 TTAGAGACTCAGAAGGAGGAGGG - Intronic
1199134383 X:144233565-144233587 TTGAGGGCTCAGAAAGATGAGGG + Intergenic
1199816107 X:151397802-151397824 TTGGGGAATCAGTAAGATAGAGG + Intronic
1200377259 X:155796259-155796281 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1202033491 Y:20605058-20605080 TTGGGGACTCAGAATGTAGGAGG + Intergenic