ID: 1102402192

View in Genome Browser
Species Human (GRCh38)
Location 12:112639336-112639358
Sequence TGTCCTTTGCAGGCTATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 15, 3: 45, 4: 210}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102402185_1102402192 20 Left 1102402185 12:112639293-112639315 CCCACAAAGGAATCCTATGCAGC 0: 1
1: 0
2: 6
3: 59
4: 274
Right 1102402192 12:112639336-112639358 TGTCCTTTGCAGGCTATGGATGG 0: 1
1: 0
2: 15
3: 45
4: 210
1102402188_1102402192 7 Left 1102402188 12:112639306-112639328 CCTATGCAGCCATAAAAAGGAAC 0: 2
1: 26
2: 49
3: 135
4: 382
Right 1102402192 12:112639336-112639358 TGTCCTTTGCAGGCTATGGATGG 0: 1
1: 0
2: 15
3: 45
4: 210
1102402186_1102402192 19 Left 1102402186 12:112639294-112639316 CCACAAAGGAATCCTATGCAGCC 0: 1
1: 0
2: 5
3: 134
4: 282
Right 1102402192 12:112639336-112639358 TGTCCTTTGCAGGCTATGGATGG 0: 1
1: 0
2: 15
3: 45
4: 210
1102402184_1102402192 21 Left 1102402184 12:112639292-112639314 CCCCACAAAGGAATCCTATGCAG 0: 1
1: 2
2: 15
3: 128
4: 869
Right 1102402192 12:112639336-112639358 TGTCCTTTGCAGGCTATGGATGG 0: 1
1: 0
2: 15
3: 45
4: 210
1102402189_1102402192 -2 Left 1102402189 12:112639315-112639337 CCATAAAAAGGAACGAGATCATG 0: 121
1: 1644
2: 3424
3: 7013
4: 15665
Right 1102402192 12:112639336-112639358 TGTCCTTTGCAGGCTATGGATGG 0: 1
1: 0
2: 15
3: 45
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102402192 Original CRISPR TGTCCTTTGCAGGCTATGGA TGG Intronic
900119630 1:1042965-1042987 TGTCCACAGCAGGCTATGGGAGG - Intronic
902161011 1:14530365-14530387 TGTCCTTTTCTGGCTTAGGAAGG - Intergenic
902580266 1:17403624-17403646 TCTGCTATGCAGGCAATGGAGGG - Intergenic
903844786 1:26272532-26272554 TGGGCATTCCAGGCTATGGAAGG + Intronic
904774165 1:32896512-32896534 TGTCCTGAGCAGGCTGTGTATGG - Intronic
905167785 1:36093184-36093206 AGTCCTTTGGAGGCTATTGAAGG - Exonic
905414619 1:37795278-37795300 CCTCCTTCGTAGGCTATGGAGGG + Intronic
906160212 1:43642572-43642594 TATCCTATTCAGGCTAAGGATGG + Intergenic
906283294 1:44568586-44568608 ACTCCTTTGCAGGATTTGGAAGG + Intronic
906311531 1:44757896-44757918 TTCCCTTTGCAGACTATGGGCGG + Exonic
906476730 1:46174450-46174472 TGTCCTTTGCTGCCTGTGAAGGG - Intronic
906711110 1:47930539-47930561 TGTCCTTTGAAGCCTCTGCAGGG - Intronic
906870900 1:49479607-49479629 TGTCCTTTGCATGACATGGATGG - Intronic
906884865 1:49633296-49633318 TGGCTTTTGCAGGCTAATGAAGG - Intronic
907933697 1:59022972-59022994 TGTCCTTTGCAGGCAGGGGATGG + Intergenic
909794511 1:79716732-79716754 TGTTCTTGGCAGGCCCTGGAAGG + Intergenic
910612599 1:89161086-89161108 GATCATTTGCAGGGTATGGATGG - Intronic
911100491 1:94092205-94092227 TGGCCTCTGCAGGCTATGGAAGG + Intronic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
913440082 1:118887721-118887743 TGTCCTTAGCACACTGTGGATGG - Intronic
913715061 1:121525204-121525226 TGTCCTTTGTAGGAAATAGATGG + Intergenic
919204586 1:194405750-194405772 TGTTCTTTGCAGGACATGGATGG + Intergenic
919598744 1:199596594-199596616 TGTCCTTTGCAGGAAATGGATGG - Intergenic
920548282 1:206836948-206836970 TGTCCTTAGCTTGCTGTGGAGGG - Exonic
922183771 1:223256624-223256646 TGTCCCTGGCTGGCTCTGGAAGG - Intronic
922850576 1:228730302-228730324 TGGCCCTTGGAGGCTGTGGAAGG + Intergenic
923577935 1:235177901-235177923 TGACCTGTACAGGCTATGAAGGG + Exonic
1062826520 10:572953-572975 TGTCCTTTGTAGGATATTCAGGG - Intronic
1067528388 10:47052082-47052104 TGTCCTCTGCAGGCTGTGCTGGG + Intergenic
1070053985 10:72916476-72916498 TGTCCTTTGCAGGGAGTGGATGG - Intronic
1071328570 10:84540148-84540170 TGTCCTTTGCACGCTACAGGAGG - Intergenic
1073952948 10:108831848-108831870 TGTCCTTTCCAGGACATGGATGG + Intergenic
1074473733 10:113750715-113750737 TCTCTTTTGCATCCTATGGAGGG - Intergenic
1074923527 10:118044914-118044936 TGTCCTTTTAAGTTTATGGAAGG + Intronic
1075187598 10:120277033-120277055 TGTCCTTTGAAGGACATGGATGG + Intergenic
1075792912 10:125098334-125098356 TGTCATTAGCAGCCTAGGGAGGG - Intronic
1076021752 10:127079445-127079467 TGCCCTTTTCAGCCTATGCAAGG - Intronic
1076706479 10:132304813-132304835 AGGCCCTTGCAGGCTGTGGACGG - Intronic
1078517753 11:12039156-12039178 TGTCCTTTGCAGCACATGGATGG + Intergenic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1079908435 11:26278989-26279011 TCTCCATTGAAGGCTATGTAGGG - Intergenic
1081307330 11:41529538-41529560 TGTCCTTTGCATGAGATAGAAGG + Intergenic
1083919649 11:65775433-65775455 TGTCCTTTGAAGGATATGGATGG + Intergenic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1087224582 11:95583701-95583723 TGTTCTTTGCAGCCTAGGAAAGG - Intergenic
1088374170 11:109121670-109121692 TGGCCTTCTCAGGCTTTGGAGGG + Intergenic
1089144038 11:116311319-116311341 TGTCCTTTTCAGACCATGGAGGG - Intergenic
1090519297 11:127461286-127461308 TGTGGTTTGGAGGCTACGGAGGG - Intergenic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1091502755 12:1035176-1035198 TGACCTCTGAGGGCTATGGAGGG - Intronic
1093449517 12:19298944-19298966 TCTCCTCTACAGGCTATGGCTGG + Intronic
1098109044 12:67102317-67102339 GGTGCTTTGCAGGCTAAGGCTGG + Intergenic
1098341504 12:69456200-69456222 TGTCCTGTGCAGGCTGAGCATGG - Intergenic
1099837795 12:87929598-87929620 TGTCATTTGGAGGCTACGAAGGG + Intergenic
1101000555 12:100353436-100353458 TGTTCTTTGCAGGGACTGGATGG - Intergenic
1102137289 12:110586030-110586052 TGTCCTGTGCATGCGTTGGAGGG + Intergenic
1102402192 12:112639336-112639358 TGTCCTTTGCAGGCTATGGATGG + Intronic
1102681366 12:114692706-114692728 TGTCCTTTGCAAGCGAAGGGAGG - Intergenic
1102806916 12:115790120-115790142 TGTCATTTGCAGAACATGGATGG - Intergenic
1103733006 12:123041280-123041302 TGTCCCTAGCAGGGTCTGGAAGG + Intronic
1104372184 12:128233773-128233795 TCTCCTTTGGAGCCTCTGGAAGG - Intergenic
1104796459 12:131523204-131523226 TATCCTTTGCAGGACATGGATGG + Intergenic
1109759996 13:66815609-66815631 TGTCCTTTGCAGGATACTGTAGG + Intronic
1113747124 13:112752914-112752936 TGTCCTTTGGAGTTAATGGAGGG + Intronic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1115329079 14:32174669-32174691 TGTCTTTTGCAGCATGTGGATGG - Intergenic
1115764714 14:36611837-36611859 TGTTTTTTGCAGGACATGGATGG + Intergenic
1116035544 14:39622798-39622820 TGTCCTTGGCAGGACATGGATGG - Intergenic
1116533617 14:46004135-46004157 TCTTCTTTGCATGCTTTGGAAGG + Intergenic
1116900335 14:50356518-50356540 TGTCCTTTGCAGGGACAGGATGG + Intronic
1116943687 14:50816036-50816058 TGTCCTTTGCAAGACATAGATGG + Intronic
1119495868 14:75078420-75078442 TGTACTTTACAGGGTAGGGATGG + Exonic
1120058955 14:79959374-79959396 TGTCCTTTGAGGGACATGGATGG + Intergenic
1120576745 14:86190847-86190869 TGACCTTCTCAAGCTATGGAAGG - Intergenic
1124035741 15:26052355-26052377 CTTCCTTTGCAGGCAGTGGAAGG + Intergenic
1124940535 15:34213516-34213538 CTTCCTTTGCAGGCTGTGGAAGG + Intergenic
1125127658 15:36242859-36242881 TGTCCTTTGCAGGGACAGGAAGG - Intergenic
1126710679 15:51452423-51452445 TGTCCTTTGCTCGCTTTTGATGG - Intronic
1128565067 15:68695640-68695662 TGTTCTTTGCAGGCTGGGCAGGG + Intronic
1130181045 15:81628909-81628931 TGTCCTTTGCAGGGCGCGGATGG + Intergenic
1130394401 15:83489496-83489518 TGTCAAATGCTGGCTATGGATGG - Intronic
1130668870 15:85892704-85892726 CCTCCTTTAAAGGCTATGGAAGG + Intergenic
1131657804 15:94479666-94479688 GGTCCATTGCTGGCAATGGATGG + Exonic
1132245293 15:100291679-100291701 TGTCCTCTGCAGCACATGGATGG + Intronic
1133808143 16:9141063-9141085 TGTGCTTTGTAACCTATGGATGG + Intergenic
1136528364 16:30848329-30848351 TGTCCTTTGTAGGCCAAGTAAGG + Intronic
1141506296 16:84480698-84480720 CTTCCTTTGCAGGGTATGGGGGG - Exonic
1141810399 16:86371950-86371972 TGTCCTTCCCATGTTATGGATGG + Intergenic
1142306903 16:89290823-89290845 TGTCCACTGCAGGCCAAGGAGGG + Exonic
1144275881 17:13667775-13667797 GGTTCTTTGCAGTCTATTGAGGG - Intergenic
1145939650 17:28736077-28736099 TGTCCTTTGTAGGACATGGATGG - Intronic
1149477891 17:56978421-56978443 TGTCCTTTTCTGGCTCTGGGTGG + Intronic
1151232664 17:72695864-72695886 TGCTCTCTGCAGGCTCTGGAAGG - Intronic
1151362455 17:73596775-73596797 TGTCATCTGGAGGCCATGGAGGG - Intronic
1153198395 18:2625358-2625380 TCTCCTCTGCAGGCTGTGGGAGG + Intergenic
1153222230 18:2871692-2871714 TGTCATTTGGAGGTTATGGCAGG + Intronic
1153474841 18:5488260-5488282 TGTCCTTTTCAGGACATGGATGG + Intronic
1153881778 18:9427492-9427514 TGCCCTTTGAAGGCCAAGGAAGG - Intergenic
1154106829 18:11530894-11530916 TGTCCTTCGCAGGCCACGGCAGG - Intergenic
1154302811 18:13209246-13209268 TGTCCTTTGCAGGATGTGGATGG - Intergenic
1154370065 18:13752322-13752344 TCTCATTTGCAGGATATGGCTGG - Exonic
1158947804 18:62463000-62463022 TTTGCTTTGCTGGCTTTGGAGGG - Intergenic
1159409896 18:68058188-68058210 TGTCCTCTGCAGGCTGAGAATGG + Intergenic
1160067860 18:75594223-75594245 TGTCCTTTGCAGCTTCTAGAGGG - Intergenic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1161076402 19:2287970-2287992 TGTCCTCTGGAGGATGTGGAGGG + Intronic
1166720382 19:44992861-44992883 TGTCCTCTGCTGGCTTTGGAGGG - Exonic
1167524228 19:49973554-49973576 TTTCCTCTGCAGGCTTTGCATGG + Intergenic
927085124 2:19667536-19667558 TGTCTTTTGCAGGCCTTGAATGG + Intergenic
928185726 2:29108913-29108935 TGGACATTGCAGGCTGTGGATGG + Intronic
928270330 2:29849668-29849690 TGCCCTTCACAGGCTCTGGAGGG + Intronic
929460110 2:42097113-42097135 TCTCCTGGACAGGCTATGGAAGG - Intergenic
929819262 2:45260271-45260293 TTTCCTCTGCAGGGTATGGATGG - Intergenic
929863550 2:45699181-45699203 CGTCCTTAGCAGGCAAAGGAGGG + Intronic
929871579 2:45763519-45763541 GGTCCTTTGGAGACTAGGGAGGG - Intronic
930191593 2:48465723-48465745 TGTCCTTTGCAGTACTTGGATGG - Intronic
931288636 2:60853561-60853583 TGTACTGTGGAGGCTATGGTGGG - Intergenic
931502148 2:62881080-62881102 TGTTCTTTGCAGCACATGGATGG + Intronic
932647463 2:73518268-73518290 TGTCTTTTGCAGAACATGGATGG - Intronic
933466258 2:82656457-82656479 TGTCCTTTGTGGACTATGAAAGG + Intergenic
937577955 2:123447435-123447457 TTTCCTTTCCAGACTATTGAAGG - Intergenic
937735966 2:125289750-125289772 TGTCCTTTGCGGGACATGGATGG - Intergenic
940276645 2:151947142-151947164 TGCCTTCTGCAGGCTGTGGAGGG - Intronic
940898631 2:159105585-159105607 TGTCTTTTGCGGGGTATAGAGGG - Intronic
945947498 2:216008579-216008601 TGCCCTCTGCAGGCAATGAATGG + Intronic
947612720 2:231533706-231533728 TGTCCTTAGTAGGGTTTGGAAGG + Intergenic
948020972 2:234732909-234732931 GGTCTTTTCCAGGCTAGGGAGGG - Intergenic
1171035917 20:21712990-21713012 TGTCCTATGGAGGGAATGGAGGG + Intronic
1171091061 20:22286126-22286148 TGTCTTTCTCAGGCTATGCATGG - Intergenic
1172747476 20:37223661-37223683 TGTCTTTTTCTGGCTTTGGATGG - Intronic
1174431739 20:50475113-50475135 TGTCCTCTGCAGGGCATGGCAGG + Intergenic
1177513416 21:22119500-22119522 TTTCCCTTGAAGGCTATTGAGGG - Intergenic
1178710706 21:34913923-34913945 TGTCCTTTCCAGGCTGTCAATGG + Intronic
1179114918 21:38482110-38482132 GGTCCCTTCCAGGCCATGGATGG - Intronic
1179410128 21:41156120-41156142 GGCTCTTTGCAGGATATGGATGG + Intergenic
1181683074 22:24509263-24509285 TCTCCTATGCAGGGGATGGAGGG - Intronic
949237210 3:1823694-1823716 TATCTTTTGTAGACTATGGAGGG + Intergenic
950169304 3:10826628-10826650 TATCATTGCCAGGCTATGGAAGG + Intronic
951404344 3:22276742-22276764 TGGCCTTTGCTGCTTATGGATGG + Intronic
951520780 3:23609203-23609225 TGTCCTTTGAAGTCTGTGGCAGG - Intergenic
951755448 3:26086445-26086467 TGTCCTTTGCAGTGAAAGGATGG - Intergenic
953816016 3:46157387-46157409 TGTCCTTTGCAAGGAATGGATGG - Intergenic
956433302 3:69208761-69208783 TTTCCTTTGAAGTCTTTGGAGGG - Intronic
956687811 3:71847400-71847422 TATCATTTGCAGGAGATGGAGGG - Intergenic
959773740 3:110132074-110132096 TGTCCTTTGCAGGACATAGATGG + Intergenic
960265282 3:115614345-115614367 TGTCCTTTGCAGGGACTAGATGG + Intergenic
962089391 3:132227327-132227349 TGTCCTTTGCAGGGAATGGAGGG - Intronic
962316469 3:134362540-134362562 TGTTCTTTTCAGACCATGGAAGG - Intronic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
965075845 3:163974388-163974410 TGTCCTTACCAGGTTGTGGAAGG - Intergenic
966654800 3:182343833-182343855 TGTTCTTTGCAGCACATGGATGG - Intergenic
967580355 3:191145899-191145921 TGTCCTTTGCAGGGACAGGAGGG - Intergenic
967787605 3:193514384-193514406 TGTCCTTTTCAGGACATGGATGG - Intronic
969082570 4:4630667-4630689 TGTCCCCTGCAGGACATGGATGG + Intergenic
970173006 4:13307988-13308010 TGATCTTTGCAGGCCATGGTAGG - Intergenic
970457529 4:16239853-16239875 TGTCCTTTGCAAGGAATGGGTGG + Intergenic
970523570 4:16909458-16909480 TGTCCTTGGCAGGCTGTGTGAGG - Intergenic
971154389 4:24065873-24065895 TGCCCTTTAAAGGCAATGGAAGG + Intergenic
971477495 4:27086029-27086051 TCTCTTTTGCAGTCTAAGGAGGG + Intergenic
971620199 4:28845786-28845808 TGTTCTTTGCAGGACATGGATGG - Intergenic
972910663 4:43812649-43812671 TGTCCTTTGCAGAGCGTGGATGG + Intergenic
972984854 4:44750733-44750755 TGTCCTTTCCGGGACATGGATGG - Intergenic
974049226 4:56924873-56924895 TTTTCTTTGCCGGCTATGCACGG + Intronic
976273241 4:83250840-83250862 TCTCCTTTGCAGGCTACGTGTGG - Intergenic
976793270 4:88904456-88904478 TGTCCTTTCTAGGACATGGATGG + Intronic
977520153 4:98072248-98072270 TGTCCTTTGCGGGACATGAATGG + Intronic
980486323 4:133461792-133461814 TGTCCTTTACAGGCCCTGGGGGG + Intergenic
980857486 4:138456601-138456623 TGTGCTGTGCAGGACATGGATGG + Intergenic
983155620 4:164344063-164344085 TGTCCTTTGCACAGCATGGATGG + Intronic
984619589 4:181937255-181937277 TGGCCTTCCCAGACTATGGAGGG + Intergenic
984628016 4:182030384-182030406 TGTCTTTTGCAGGACAGGGATGG - Intergenic
985014328 4:185617816-185617838 TGAGCTTTGCAGGCTGAGGATGG + Intronic
986481163 5:8189620-8189642 TCTGCTTTCCAGGCTATGTAGGG - Intergenic
986904207 5:12473666-12473688 TGTTCTTTGCAGGATCAGGATGG + Intergenic
988075740 5:26352222-26352244 TATCCTTTGCAGGCTGGGCACGG + Intergenic
988994588 5:36702726-36702748 TCTCCTTTGGAGCCTCTGGAGGG - Intergenic
989962678 5:50435250-50435272 TGTCCTTTGTAGGAAATAGACGG - Intronic
990731664 5:58815489-58815511 TGTCCTTTGCAGACTGTGATGGG + Intronic
992994755 5:82321718-82321740 TGTCCTCTGTAGGCTATGGGTGG + Intronic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993247684 5:85471655-85471677 TGTCCTTTGCAAAACATGGATGG + Intergenic
993453145 5:88097208-88097230 TTTCCTATGACGGCTATGGAAGG - Intergenic
993795118 5:92257490-92257512 TGTCCTTTGCAGCATACGGATGG + Intergenic
993820605 5:92611011-92611033 TATCCTTTGCAGGACATGGATGG + Intergenic
993889903 5:93461172-93461194 TGTCCTTTGCAAGACATGGATGG + Intergenic
994543291 5:101128142-101128164 CGTCCTTTGCAGGGCATGGATGG + Intergenic
995059044 5:107794179-107794201 TGTCCTTTGCAAAACATGGATGG + Intergenic
995357641 5:111257835-111257857 TGTCCTTCGCAGGACATGGATGG + Intronic
995621904 5:114034868-114034890 TGTTCTTTGCAGAACATGGATGG - Intergenic
995865422 5:116685245-116685267 AGTCCTATGCAGACTGTGGAGGG + Intergenic
997785989 5:136714456-136714478 TGTCCTTTGCAGAAAATGGATGG - Intergenic
998046909 5:138995012-138995034 TGTCCTTTGCAGGACATGAATGG - Intronic
998604717 5:143621948-143621970 TGTCTTTTGCAGAACATGGATGG + Intergenic
999367726 5:151033829-151033851 TGTCCTTTGCAGCCTGTTGCAGG - Intronic
1000189600 5:158897255-158897277 TGTCCTTTGCGGGACATGGATGG + Intronic
1000588463 5:163129143-163129165 TGTCCTTTGCAGAACATGGATGG + Intergenic
1000668121 5:164024329-164024351 TGTCCTTTGCAGGAACTGGATGG - Intergenic
1001448862 5:171808654-171808676 TGTCCTTTGCAGAACGTGGATGG + Intergenic
1002967748 6:1984058-1984080 TGTCCTTTGTGGGACATGGATGG + Intronic
1005919240 6:30384100-30384122 TGTCCTTTGCGGAACATGGATGG - Intergenic
1007357440 6:41331887-41331909 TGTCTTCTGCAGGCACTGGATGG + Intergenic
1008208558 6:48692786-48692808 TGTCCTTTGCAGGACATAGATGG + Intergenic
1008573987 6:52841634-52841656 TTAACTTTGCAGGATATGGAAGG + Intronic
1013502441 6:110766282-110766304 TGTCATTTGCAGGCCAGGCATGG + Intronic
1014375300 6:120664774-120664796 TGTCCTTTGCAGGGCATGGATGG - Intergenic
1016624129 6:146145923-146145945 TGTCCTTTGCACACTAGTGAGGG - Intronic
1018445663 6:163855861-163855883 GGTCCTTTGCAGCCCAAGGAAGG - Intergenic
1018447129 6:163868012-163868034 TTTCCTTTCCAGGCGATGGCTGG + Intergenic
1018665421 6:166132450-166132472 TGTTATTTTCTGGCTATGGAGGG - Intergenic
1018810820 6:167296589-167296611 TGTCCTTTTTAGACTAAGGATGG + Intronic
1019098427 6:169607465-169607487 TGTCTTTTGCAGCACATGGATGG + Intronic
1021364247 7:19756750-19756772 GGTCTTTTGCAGGACATGGATGG - Intronic
1023085859 7:36569345-36569367 TCTCCTCTGCAGGCCATGGGTGG + Intronic
1028170354 7:87588484-87588506 CGTCCTTTGCAGGGCATGGCTGG - Intronic
1029160710 7:98549438-98549460 TGTCCATTGCAGGAGATGCAGGG - Intergenic
1030058973 7:105608005-105608027 TGCCCTTTGCTGGATATGGGAGG - Intronic
1032616830 7:133481973-133481995 TGCCCTTAGCAGGCTATCTAAGG + Intronic
1032782822 7:135177825-135177847 TCTCCTTTGCCTTCTATGGAAGG + Intergenic
1033745850 7:144316637-144316659 TGTCCTTTGATGGACATGGATGG - Intergenic
1034742250 7:153487149-153487171 TGGCCTTTTCAGGATGTGGATGG - Intergenic
1034937880 7:155211437-155211459 TGGCCTTTGCAGGTCATGGTGGG - Intergenic
1035414200 7:158669072-158669094 TGTTCTTTGCAGGGAATGGATGG - Intronic
1035581643 8:744081-744103 TGGCCGTGGCAGTCTATGGATGG + Intergenic
1036933256 8:12976763-12976785 TTTCCCTTTCAGGCTAAGGATGG - Intronic
1041572043 8:59348747-59348769 TGTCCTTTGCAGAACATGGATGG + Intergenic
1041577394 8:59414636-59414658 TCCCCTTTCCAGGCTGTGGAAGG - Intergenic
1042113263 8:65404235-65404257 TGTCCCTTAGAGGCTTTGGAGGG + Intergenic
1043001536 8:74766019-74766041 TGTCCTTTGCAGGAACAGGATGG + Intronic
1045680311 8:104652338-104652360 TGTTCTGTGCAGACTATTGATGG - Intronic
1046063992 8:109175237-109175259 TGACCTTTGGAGTCTTTGGAAGG - Intergenic
1048109350 8:131450838-131450860 TGTCTTTTGCAGGACATGGATGG - Intergenic
1048337122 8:133511194-133511216 TGTCCTTAGCAAGCTCTGGCTGG - Intronic
1048862128 8:138731331-138731353 TGTCCTTAGCAGCCAATGGTAGG + Intronic
1049081803 8:140449045-140449067 GGTGCTTTGCAGGGTCTGGAAGG - Intronic
1049283085 8:141760459-141760481 TGGGCTTCGCAGGCCATGGAAGG + Intergenic
1049318801 8:141984619-141984641 TGGCCAATGCAGTCTATGGATGG - Intergenic
1050194910 9:3071959-3071981 TGTCCTTTGCAGGGACAGGATGG - Intergenic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1052488979 9:29138908-29138930 TGTCCTTTCCATACTCTGGAGGG - Intergenic
1052618782 9:30878104-30878126 TGTCCTTTGCAGAACATGGATGG - Intergenic
1056485337 9:87051301-87051323 TGTCTTTTGCAGAGCATGGATGG + Intergenic
1058281074 9:103115498-103115520 TGGCCTTTGCAGGCATTGGAAGG - Intergenic
1058449386 9:105081827-105081849 TAAGCTTTGCAGGCTATGTAAGG + Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1058968255 9:110056881-110056903 CATCCTTTGGAGGCTATAGATGG - Intronic
1059010654 9:110455402-110455424 TGTCCTTTTCCGGTTATGTAAGG - Intronic
1059831700 9:118103394-118103416 TGTCCTTTGCAGGGCATGGGTGG + Intergenic
1060049382 9:120366733-120366755 TGTCCTTTGGAGCCTCTGGACGG - Intergenic
1061526635 9:131170342-131170364 TTTCCTTTGAAGGCTGAGGAAGG - Intronic
1062569520 9:137178721-137178743 TGTCCCTTGCAGCTTGTGGAGGG - Intronic
1062658385 9:137615564-137615586 TGTCCTTAGGCGGCTCTGGAAGG - Exonic
1203400626 Un_KI270519v1:90430-90452 TGACCATTGCAGCCTATGGTGGG + Intergenic
1187614004 X:20973195-20973217 TTTCCATTGCAGGGTAGGGAAGG - Intergenic
1187640241 X:21279763-21279785 TGTCTTTTGCAGGACATGAATGG - Intergenic
1187640561 X:21284263-21284285 TGTCCTTGGCAGGACGTGGATGG + Intergenic
1188090620 X:25960196-25960218 TTTCTTTTGCAGGGCATGGATGG - Intergenic
1188909176 X:35824296-35824318 TGTCTTTTGTAGAATATGGATGG - Intergenic
1190373915 X:49769975-49769997 TGTCCTTTGTGGGATATGGATGG - Intergenic
1191026762 X:55922302-55922324 TGTCCTTTGTAGGACATGGATGG + Intergenic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1195207668 X:102619246-102619268 TGTCCTTTGCAGCAAATTGATGG - Intergenic
1196486568 X:116217303-116217325 TGTCTTTTGCAGAACATGGATGG + Intergenic
1197759402 X:130016825-130016847 TGGTCTTGACAGGCTATGGATGG + Intronic
1197989384 X:132300841-132300863 TGTCCTTTTCAAGATGTGGAAGG - Intergenic
1198485830 X:137086796-137086818 ATTCCTTTTCAGGCTCTGGATGG + Intergenic
1198998341 X:142602866-142602888 TGTCCTTTGCAGAACATGGATGG - Intergenic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1202275668 Y:23117094-23117116 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202290360 Y:23303597-23303619 TGTCTTTTGCAGGAAGTGGATGG - Intergenic
1202428660 Y:24750813-24750835 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202442131 Y:24919276-24919298 TGTCTTTTGCAGGAAGTGGATGG - Intergenic