ID: 1102410679

View in Genome Browser
Species Human (GRCh38)
Location 12:112715639-112715661
Sequence CTGTGAGCTCACCATGTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102410679_1102410684 6 Left 1102410679 12:112715639-112715661 CCAACTACATGGTGAGCTCACAG 0: 1
1: 0
2: 0
3: 11
4: 157
Right 1102410684 12:112715668-112715690 GGGACCAGTCATATACCCCTTGG 0: 1
1: 0
2: 0
3: 3
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102410679 Original CRISPR CTGTGAGCTCACCATGTAGT TGG (reversed) Intronic
901181026 1:7341956-7341978 GTGTAAGCACACCATGGAGTGGG + Intronic
901535298 1:9878836-9878858 CTGTGCCCTCACCATTTATTGGG - Intronic
901685102 1:10939394-10939416 CTGTGAGCACACCAAGGAGAGGG - Intergenic
903028333 1:20445136-20445158 CCGTGGGCTCACCATCTAGTTGG - Intergenic
904855603 1:33495947-33495969 CTGTGAGCTCAGCACAGAGTAGG + Exonic
905664544 1:39755035-39755057 CTGTGAGCTCAGCAGGGGGTGGG - Intronic
906424579 1:45699847-45699869 CTGTGAGTTTTCCATGTATTTGG - Exonic
907362557 1:53930724-53930746 CTCAGAGCTCAGCATCTAGTGGG - Intronic
907396895 1:54197240-54197262 CTGTGAGCACTCCATGCACTTGG + Intronic
907666529 1:56438017-56438039 TTGAGAGTTCACCATGTACTAGG + Intergenic
907945654 1:59134039-59134061 CTGTGAGCTCAATATGCAGGAGG + Intergenic
908440122 1:64145168-64145190 TTGAGAGCCCACCATGGAGTAGG + Intronic
908677437 1:66621033-66621055 CATGGAGCTCACCATCTAGTGGG + Intronic
910275017 1:85440422-85440444 CTGTGAGCTCACAATGTGAGTGG - Intronic
912067569 1:105763305-105763327 CTGTGAGATCACCAACTTGTGGG + Intergenic
912746513 1:112249762-112249784 CTTTGAACTTACCATGTAGGAGG + Intergenic
914434422 1:147647698-147647720 CTGGAAGCTCACCGGGTAGTGGG - Intronic
916755506 1:167766170-167766192 TTGGGAGCTTACTATGTAGTGGG + Intronic
916850417 1:168697339-168697361 CTGAGTGCTCACCATGCACTGGG + Intronic
917099852 1:171434140-171434162 CTGAGAGCTCATAAAGTAGTAGG + Intergenic
920740632 1:208578161-208578183 CTGTGAGCTCAGTATACAGTAGG - Intergenic
922193150 1:223337716-223337738 CTGTAAACTGACCATGTAGTCGG - Intronic
1063841451 10:10076478-10076500 CTGTGACCTTACCAGGTACTAGG - Intergenic
1069652026 10:70055810-70055832 CCGTGAGCTCAGCATGTATAAGG + Intronic
1070673812 10:78398190-78398212 CTGGGAGGACACGATGTAGTTGG - Intergenic
1071251418 10:83823499-83823521 TGCTGAGCTCACCATCTAGTAGG + Intergenic
1071387099 10:85132415-85132437 CTGTGAGCTCCTCATGGAGGTGG + Intergenic
1072216487 10:93291545-93291567 CTGTGAGCCCAGCATGCAGGTGG - Intergenic
1073920689 10:108454813-108454835 CCTTGAGCTCACCATCTGGTTGG - Intergenic
1074642232 10:115399287-115399309 CTGTGAACTCATCATGTCCTGGG + Intronic
1077445258 11:2587769-2587791 CTGGGATCTCACCATGCATTTGG + Intronic
1077773583 11:5247596-5247618 CTGTGAGATCAAAATGTAGTGGG - Intergenic
1079319947 11:19443349-19443371 CAGTCAGCTCTCCATGGAGTTGG + Intronic
1081116848 11:39213153-39213175 CTAGGAGCTCACAATCTAGTGGG - Intergenic
1084693739 11:70741731-70741753 CTGTGTGCTCAACACATAGTAGG - Intronic
1085303006 11:75469293-75469315 GTGTGAGCTCACCATGGCATTGG + Intronic
1085709859 11:78819528-78819550 CTGTCAGCTCACCATGGCATGGG + Intronic
1086564272 11:88207301-88207323 TTGTGAGTTCAATATGTAGTTGG + Intergenic
1088121313 11:106373900-106373922 CCTTGAGCTCACAATCTAGTGGG + Intergenic
1089027241 11:115283854-115283876 CTGAGACCTCACAGTGTAGTGGG - Intronic
1091769958 12:3145103-3145125 CTGTGTGCTCACAAGGGAGTGGG - Intronic
1092207943 12:6627699-6627721 CTAGGAGCTTACCATCTAGTTGG - Intronic
1092470772 12:8778167-8778189 CTGTGAGCTCACTGTGTATTCGG - Intronic
1094486409 12:30928875-30928897 TGGTGAGCTCACATTGTAGTAGG - Intronic
1096357550 12:50954247-50954269 CTGGGGGCTTACCATGTATTAGG - Intronic
1096547169 12:52348063-52348085 CTGGGAGCTCAACATGGACTTGG + Intergenic
1098290327 12:68951787-68951809 CTGTGAGCACACCCTGGACTGGG + Intronic
1099236379 12:80086859-80086881 CTGTTATCTCAACAGGTAGTTGG + Intergenic
1100200710 12:92295063-92295085 CTGTGAGTTCAGTATTTAGTTGG + Intergenic
1100763958 12:97842765-97842787 CTGTGAGCTCAGCATTCATTTGG + Intergenic
1101254395 12:102963507-102963529 CAGGGAGGTTACCATGTAGTAGG - Intergenic
1102410679 12:112715639-112715661 CTGTGAGCTCACCATGTAGTTGG - Intronic
1104079472 12:125417442-125417464 CTGTGAGCTGACCACCCAGTAGG - Intronic
1119523133 14:75301153-75301175 TTGAGAGCTCACCATGTGCTGGG - Intergenic
1119892038 14:78190082-78190104 CTGAGTGCTCACCATGTACAAGG - Intergenic
1121405839 14:93718987-93719009 CTGTAAGCTCAAAATCTAGTGGG + Exonic
1122243895 14:100387539-100387561 CTGAGTGCTTACCATGTACTAGG + Intronic
1122688753 14:103521909-103521931 CCGCGAGCTCAGCACGTAGTTGG + Exonic
1125292955 15:38169912-38169934 CTAGGAGCTCACACTGTAGTGGG - Intergenic
1126733856 15:51712189-51712211 CTGTGTGCTTATCATGTACTGGG - Intronic
1127161026 15:56186259-56186281 CTGTGCCCTCACAAAGTAGTTGG - Intronic
1128798723 15:70483236-70483258 GTGTGAGTTCACCATGTACCTGG - Intergenic
1132744000 16:1429189-1429211 CTGTGAGCTCACCGGGGCGTCGG + Intergenic
1135927808 16:26710652-26710674 CTGTGTGCTCACCCTGTACTGGG - Intergenic
1140510451 16:75503819-75503841 CTGTGAGCTTACCAAGTGATAGG + Intergenic
1141673976 16:85507921-85507943 GGCTGAGCTCACCATGTAATGGG + Intergenic
1142193444 16:88728413-88728435 CTGTGAGTTCAGCATGTCCTGGG - Intronic
1142193480 16:88728583-88728605 CTGTGAGATCAGCATGTCCTGGG - Intronic
1142193511 16:88728753-88728775 CTGTGAGTTCAGCATGTCCTGGG - Intronic
1142193527 16:88728838-88728860 CTGTGAGTTCAGCATGTCCTGGG - Intronic
1142193543 16:88728923-88728945 CTGTGAGTTCAGCATGTCCTGGG - Intronic
1142193655 16:88729433-88729455 CTGTGAGATCAGCATGTCCTGGG - Intronic
1142193762 16:88729944-88729966 CTGTGAGATCAGCATGTCCTGGG - Intronic
1146249699 17:31327970-31327992 CTGTGACCTCATCAAGTTGTGGG + Intronic
1146384086 17:32353848-32353870 CTGTGAGTCTAACATGTAGTAGG - Intronic
1146633087 17:34484628-34484650 CTCTGAGCTCACCCTCTAGGTGG + Intergenic
1146715136 17:35079607-35079629 CTGTGAGCCCACCAATTAATGGG - Intronic
1150360404 17:64528011-64528033 CTGTGATATCTCCATCTAGTAGG + Intronic
1154941246 18:21114613-21114635 CTGAGTGCTCACCATGTGCTAGG + Intergenic
1154977828 18:21476138-21476160 GTTTGTCCTCACCATGTAGTGGG + Intronic
1157103326 18:44749921-44749943 CTTTGAGCTCACAATGAAGAAGG + Intronic
1157684015 18:49628585-49628607 CTGGGAGCTTACCATCTTGTTGG + Intergenic
1160364621 18:78313632-78313654 CTGTGGGGTCCCCATGTAGGTGG - Intergenic
925804799 2:7637601-7637623 ACGAGAGCTCTCCATGTAGTTGG - Intergenic
926378455 2:12259711-12259733 CTGTGAAATCACCAGGGAGTTGG + Intergenic
932221417 2:70002384-70002406 CTGTGAACTTGCTATGTAGTAGG - Intergenic
932516777 2:72359356-72359378 CTGTGATCTCACAAGGTAGAAGG - Intronic
932593098 2:73078873-73078895 CTGTGACCTCACCAGGTGGCTGG - Intronic
933462351 2:82604411-82604433 CTGAAGGCTCACCATGTAATAGG - Intergenic
934811449 2:97281672-97281694 CTGTGATCTCAGTATGTATTTGG - Intergenic
934826242 2:97426268-97426290 CTGTGATCTCAGTATGTATTTGG + Intergenic
935347325 2:102120833-102120855 TTGTGCGCACACCATGTACTAGG - Intronic
935682769 2:105652270-105652292 CTGGGAGCTGACCTAGTAGTTGG - Intergenic
937876078 2:126826489-126826511 CTGGGGGCTCACCATGATGTTGG + Intergenic
939016130 2:136905331-136905353 CTCTGAGTTTACCATCTAGTTGG + Intronic
939574507 2:143880015-143880037 CTGTGAGATCACTATAGAGTCGG - Intergenic
941647306 2:168054974-168054996 CAGAGAGCTTACCATGTAGGCGG - Intronic
943101954 2:183497662-183497684 CTGTGAGCTCACATGGTAGAAGG - Intergenic
943764682 2:191648060-191648082 CATTGTCCTCACCATGTAGTGGG - Intergenic
946154557 2:217798924-217798946 CACTGAGCTCACCATGTGGCTGG - Intergenic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
946317612 2:218928130-218928152 CTGAAAGGTCACCATGTGGTTGG + Intergenic
947570162 2:231227670-231227692 CTGTTTGCTCACCAGGGAGTTGG + Intronic
1170956955 20:20990165-20990187 ATGTGAGCTTACCATGTTCTAGG + Intergenic
1174378919 20:50144033-50144055 CTGTAAGCTCAGCTTGTGGTTGG - Intronic
1175112186 20:56656378-56656400 CTGTGATCTCACCATGGGGCAGG - Intergenic
1175576060 20:60061613-60061635 CTGTGCGCCCACCCTCTAGTGGG - Intronic
1178127779 21:29534106-29534128 CTGGGAGCTATCCTTGTAGTGGG - Intronic
1184776965 22:46628100-46628122 CTGTGTGCTGAGCATGTGGTGGG + Intronic
950159580 3:10750139-10750161 CGTGGAGCTCGCCATGTAGTAGG + Intergenic
952719441 3:36516823-36516845 CTGTGACCTCACTTTGTACTGGG - Intronic
954337572 3:49928764-49928786 CTGTGATCTCAGCATGGAGTAGG - Intronic
955723210 3:61905276-61905298 TTGTGAGCTCACCACATACTTGG - Intronic
956107338 3:65833764-65833786 CTGGGAGCTCAGATTGTAGTAGG - Intronic
960098577 3:113713709-113713731 CTGAGAGCTTACCATGTATCAGG - Intergenic
961332082 3:126148368-126148390 CTGTGGGCTCGGCAGGTAGTGGG - Intronic
963591594 3:147267492-147267514 CTGTGAGTTCTGCATGTAGACGG - Intergenic
971502723 4:27333914-27333936 CTGCAAGCTCACCACATAGTTGG - Intergenic
973700203 4:53529642-53529664 CTGGGAGCTCACAATGTACATGG - Intronic
975660295 4:76681875-76681897 CTGCGAGCCCAGCATGGAGTGGG - Intronic
977393221 4:96439964-96439986 CTAGGAGCTTACCATCTAGTGGG - Intergenic
978195841 4:105970890-105970912 CAGTGAGCTCAGCATTTGGTGGG - Intronic
978872107 4:113591894-113591916 CTGGGAGCTCACCTTGTCTTAGG + Intronic
980853416 4:138411080-138411102 CTCTGAGCTCACAGTCTAGTGGG - Intergenic
981848751 4:149202258-149202280 ATGTGATCTCATCCTGTAGTTGG + Intergenic
985499188 5:230805-230827 CTGTGATCTCACCAGATAGGAGG + Intronic
988543023 5:32129352-32129374 CTGAGAGCTTACCATGTGTTAGG - Intronic
989807406 5:45626380-45626402 CTGAGTGCTCACCATGTGGCAGG + Intronic
993603013 5:89952531-89952553 CTGAGAGTTGTCCATGTAGTTGG - Intergenic
997481108 5:134185177-134185199 CAGGGAGCTTACCATCTAGTGGG + Intronic
1000174091 5:158733460-158733482 CTGTGAGCTGGCCATATAGCCGG - Intronic
1001102840 5:168828378-168828400 CTGTGGCCTCACAATGTACTGGG - Intronic
1001309995 5:170603730-170603752 CTCTCAGATCACCATGTGGTTGG + Intronic
1002295824 5:178230707-178230729 CTGAGAGCTCACCATGTGCCAGG + Intronic
1004324375 6:14661197-14661219 TTTTGAGCTTACAATGTAGTAGG + Intergenic
1007493778 6:42244967-42244989 CTCTCATCTCACCATGTAGGTGG - Intronic
1007968181 6:46023241-46023263 CTTAGAGCTCACCATGTGTTGGG + Intronic
1010037877 6:71346932-71346954 TTGAGAGCTCACAGTGTAGTGGG + Intergenic
1012811275 6:103961566-103961588 ATATGAGCTTACCATGTATTAGG - Intergenic
1020506855 7:9001532-9001554 CTAGGAGTTCACCATCTAGTGGG - Intergenic
1021227315 7:18043318-18043340 CTTTAGGCTCACCATCTAGTGGG - Intergenic
1023968068 7:44973650-44973672 CTCTGAGCTCCCCATGAGGTGGG - Intronic
1024540292 7:50470521-50470543 CAGTGAGCTCACCATCCAGTGGG + Intronic
1030414848 7:109230218-109230240 CTGAGATCTCACCAGGAAGTTGG + Intergenic
1031889014 7:127272838-127272860 CTTTGTTGTCACCATGTAGTTGG - Intergenic
1039568496 8:38567555-38567577 CAATGAGCTCACCATCTAGTTGG + Intergenic
1041102977 8:54415266-54415288 CTGTGTGCTCACCATGTAACAGG - Intergenic
1041813611 8:61940854-61940876 CTATGAGATCACCTTGGAGTTGG + Intergenic
1045229719 8:100291688-100291710 CTGTTATTTGACCATGTAGTAGG - Intronic
1047207703 8:122816987-122817009 CTGGGAGCTCTCCATGCAGATGG + Intronic
1047733235 8:127743806-127743828 CTGTGAGCTCTCTAAGTATTAGG - Intergenic
1049466449 8:142753128-142753150 CTCTGAGCACACCCTGTAGCTGG - Intergenic
1049952498 9:659147-659169 CTGAGAACTCAGCATGTAATAGG - Intronic
1050828003 9:9973634-9973656 CTGTGAGTGCCCCATGTACTTGG - Intronic
1055130526 9:72769294-72769316 CGGTGAGCTCACAATCTTGTTGG - Intronic
1057425741 9:94947985-94948007 CTGTAAACTCAACATGTAGCAGG - Intronic
1059960768 9:119562408-119562430 CAGTGAGCTCAGCCTGTGGTAGG + Intergenic
1060698331 9:125729303-125729325 CCTTGAGCTCAGCATGCAGTGGG + Intergenic
1061513221 9:131073328-131073350 GTGTAAGCTCACCATGTCTTGGG - Intronic
1185697877 X:2209005-2209027 CTGTGTGCTCACAAGGCAGTGGG + Intergenic
1187137464 X:16561871-16561893 CTGTGAATTCACAATGTAGTTGG + Intergenic
1187352549 X:18534094-18534116 CAGTGAGGTTACCAGGTAGTAGG - Intronic
1187615597 X:20990508-20990530 CAGTGAGCTGACTATGTATTGGG + Intergenic
1189682196 X:43528084-43528106 CTTTGAGCTCAGCATGCAGGGGG + Intergenic
1190290784 X:48990823-48990845 CTGTGACATCACCATCTTGTGGG - Intronic
1192211721 X:69132106-69132128 CTCCGAGCTCACCATCTGGTGGG - Intergenic
1192416042 X:70981583-70981605 GCCTCAGCTCACCATGTAGTTGG - Intergenic
1198870609 X:141174609-141174631 CTGAGTGCTCACCATGTAGCAGG + Intergenic
1199456226 X:148032276-148032298 CTGTAATCTCACGATGTACTAGG + Intergenic