ID: 1102410821

View in Genome Browser
Species Human (GRCh38)
Location 12:112716744-112716766
Sequence TAGGGGAGGAAAGATGTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 361}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102410813_1102410821 5 Left 1102410813 12:112716716-112716738 CCAGCTAAAACTTTGGATTATTA 0: 1
1: 0
2: 1
3: 52
4: 1852
Right 1102410821 12:112716744-112716766 TAGGGGAGGAAAGATGTTGGGGG 0: 1
1: 0
2: 1
3: 35
4: 361
1102410811_1102410821 13 Left 1102410811 12:112716708-112716730 CCATGTTTCCAGCTAAAACTTTG 0: 1
1: 0
2: 1
3: 30
4: 304
Right 1102410821 12:112716744-112716766 TAGGGGAGGAAAGATGTTGGGGG 0: 1
1: 0
2: 1
3: 35
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102410821 Original CRISPR TAGGGGAGGAAAGATGTTGG GGG Intronic
900539734 1:3196786-3196808 TAGGGGAGGAAGGAAGTTCAGGG - Intronic
901037996 1:6347945-6347967 ATGGGGAGGAAAGATGAAGGAGG - Intronic
901137766 1:7009005-7009027 GAGGGGCGGGAAGATGCTGGAGG - Intronic
902529957 1:17084616-17084638 CACGGGAGGCAGGATGTTGGGGG + Exonic
902641968 1:17772630-17772652 TAGTGGTGGGAAGAGGTTGGGGG + Intronic
903173088 1:21565574-21565596 GAGGGGAGGGAAGATGTTTCAGG + Intronic
903787404 1:25870445-25870467 TTGGGGAGGAGAGGTGTGGGAGG - Intronic
904025011 1:27497152-27497174 TGGGGGAGGAAATAGGGTGGGGG + Intergenic
904315298 1:29656215-29656237 GAGGAGAGGAAAGCTGTCGGGGG - Intergenic
904870307 1:33613527-33613549 GAGGGGAGGAGAGAGCTTGGTGG - Intronic
904973948 1:34441733-34441755 CAGGGGAGGGAAGATGGAGGTGG + Intergenic
905799927 1:40836895-40836917 AAGGGGAGGAAAGGAATTGGAGG + Intronic
905944495 1:41890340-41890362 TAGGGTAGAAAAGATGCTCGGGG + Intronic
906102421 1:43272045-43272067 TAGGGGAGGGAGGGTGTTAGGGG + Intronic
906515399 1:46436076-46436098 TCAGGGAGGAATGATGGTGGGGG - Intergenic
906977572 1:50592103-50592125 TAGGGGAGCATAGATAATGGGGG - Intronic
907375243 1:54032583-54032605 TAGGAGAGCTAAGATGTTGAAGG - Intronic
908343322 1:63205299-63205321 AAGGGGAGAATAGATATTGGAGG - Intergenic
909199943 1:72678478-72678500 TAAGGGAGGCAAGAAGGTGGGGG - Intergenic
909721450 1:78775688-78775710 TAGGCCAGGATATATGTTGGTGG + Intergenic
909819335 1:80041132-80041154 GATGGGAGGAAAAGTGTTGGAGG - Intergenic
910767503 1:90797056-90797078 TAAGGTAGGAAATATGTTTGAGG + Intergenic
911124712 1:94330377-94330399 CAGGGAAGGAAAGAAGTGGGTGG - Intergenic
912384094 1:109262782-109262804 TGGGGGAGCAAAGATGGTGGCGG - Intronic
912536763 1:110379613-110379635 TAGGGGGGGCAAGTTTTTGGAGG + Intronic
913251459 1:116915179-116915201 TAGGTGAAGAAAGATGATAGTGG + Intronic
913552409 1:119928411-119928433 TAGGGGTGGAAAGATCATGGTGG + Intronic
914806282 1:150994550-150994572 TAGGGGAAGAAAGAGATGGGGGG - Intronic
915023461 1:152804474-152804496 TGAGGGAGGAAGGATATTGGTGG + Intronic
919438787 1:197600253-197600275 AAAGGGAGAATAGATGTTGGTGG - Intronic
919659917 1:200234252-200234274 TAGTGTAGGAGAGATTTTGGGGG - Intergenic
919872036 1:201829197-201829219 GAGGGGAGAAAAGATGGCGGCGG + Exonic
920096863 1:203492097-203492119 TTGGGGAGGAACGATGGTGGGGG + Intergenic
920672918 1:208018247-208018269 GAGGGGAGCAAAGAGGCTGGAGG - Intergenic
921993183 1:221389535-221389557 TAGGGGAATAAAGATTTTGGGGG + Intergenic
922572868 1:226644185-226644207 CAGGAGAGGAAAGAGGCTGGGGG + Intronic
922707145 1:227795643-227795665 GAGGGAAGGAAGGAGGTTGGGGG - Intergenic
923518231 1:234715531-234715553 GAGGGGAGGACAGATTTTGGTGG + Intergenic
1063638633 10:7809947-7809969 AAGGAGAGGACAGAAGTTGGGGG - Intergenic
1063949299 10:11207537-11207559 AAAGTGAGGAAGGATGTTGGTGG + Intronic
1063954976 10:11257272-11257294 CAGGAGAGGAAAGACGATGGGGG - Intronic
1064482902 10:15757308-15757330 TAGGGGAGGTTATATGTGGGTGG - Intergenic
1064587341 10:16852069-16852091 GAGGGAGGGAAAGATGATGGAGG - Intronic
1065320611 10:24505657-24505679 TTGGGGATGAAAGAAGTAGGAGG - Intronic
1065386311 10:25136982-25137004 TGGGGGAAGAAAGATGTTGGGGG + Intergenic
1065818491 10:29503901-29503923 AAGGGGAAGAAAAAAGTTGGAGG + Intronic
1065865022 10:29907281-29907303 TGGGGAATGGAAGATGTTGGTGG - Intergenic
1065954429 10:30680598-30680620 AAGGGGAAGAAAAAAGTTGGAGG - Intergenic
1066043900 10:31579806-31579828 TAGGGTAGGAAAGAGGTGGATGG + Intergenic
1067018731 10:42776617-42776639 TAGGGTAGGAAATATGTAAGAGG - Intergenic
1069206630 10:65697177-65697199 TATGGGAGGAAAGAGGTAAGCGG + Intergenic
1069617569 10:69815930-69815952 TGGGGGAGGAAGAATTTTGGAGG + Intronic
1070163682 10:73881818-73881840 AAGGAGAGGAAGGATGTTGGTGG + Intergenic
1070328042 10:75400598-75400620 GAGGGCAGGAAAGATGCTGCTGG - Intronic
1070627701 10:78062947-78062969 AAGGGAAGGAAAGATGATGAGGG - Intergenic
1071973343 10:90930490-90930512 AAGGAGAGCAAAGATCTTGGAGG - Intergenic
1072081186 10:92033705-92033727 TAGGAGAGGCAAGGTGGTGGTGG - Intergenic
1072258004 10:93639201-93639223 TAAAGGAGGAGAGATGCTGGAGG - Intronic
1073046512 10:100642280-100642302 GAGGGGAGGGAAGAGGTTTGAGG + Intergenic
1073093278 10:100963157-100963179 GTGGGGGGGAAAGATGATGGAGG + Intronic
1073101265 10:101007929-101007951 TTGGGGAGAAAAGGTGATGGAGG + Intronic
1073130311 10:101184328-101184350 TAGGGCAGCAAAAATTTTGGGGG + Intergenic
1073870521 10:107858567-107858589 AAAGGCAGGAAAGATTTTGGGGG + Intergenic
1074343296 10:112655564-112655586 AAGGGGAGGAAGTGTGTTGGTGG + Intronic
1075669282 10:124252755-124252777 GAGGGGATGAGAGATGATGGTGG - Intergenic
1078587335 11:12603865-12603887 GAGGGGAGAAAAGATGTTAGTGG - Intergenic
1079305152 11:19315353-19315375 TTGGGGAGGGTAGATGTTGGTGG + Intergenic
1079395584 11:20060302-20060324 TAGTGGAGGAATTATGTTGGAGG - Intronic
1079709506 11:23664259-23664281 TCGGGGAGGAAGGAGGTTGTGGG - Intergenic
1079967616 11:26997669-26997691 GTGGGGAGGAAAGATGTGAGTGG - Intergenic
1080049973 11:27849487-27849509 CAGGTGAGGCAAAATGTTGGAGG - Intergenic
1080389338 11:31829880-31829902 TAGAGGAAGAATGATGTTTGTGG - Intronic
1081126263 11:39326814-39326836 TAGGGGAGGAAACTAGTAGGAGG - Intergenic
1081739784 11:45430726-45430748 GAGGGGAGGGATGATGTGGGAGG + Intergenic
1083800878 11:65045660-65045682 GAGGGGAGGAAAGTTGCTTGAGG - Intronic
1083842623 11:65313574-65313596 TGGGGGAGGCAGGATGCTGGGGG - Intergenic
1085057187 11:73412046-73412068 GAGGGGAGGGAACATGATGGAGG - Intronic
1085262207 11:75213202-75213224 TGGGGGTGGGAGGATGTTGGTGG - Intergenic
1085861447 11:80240900-80240922 CATGGGAAGGAAGATGTTGGTGG - Intergenic
1086193326 11:84107069-84107091 AAGCAGAGGAAAGATTTTGGAGG + Intronic
1087977955 11:104573779-104573801 AAGGATAGGAAATATGTTGGAGG + Intergenic
1088182377 11:107127304-107127326 CAGGGGTGGAGGGATGTTGGGGG - Intergenic
1088324389 11:108586651-108586673 TAAGGGAGGAAAGGGGATGGGGG - Intronic
1088394400 11:109350630-109350652 TAGAGGAGGAAAGTTATAGGAGG - Intergenic
1088409372 11:109516572-109516594 TAGGAGAGTAAAGGTGTTAGAGG - Intergenic
1089337931 11:117737984-117738006 TAGAGGTGGAAAGAAATTGGAGG + Intronic
1089396662 11:118140635-118140657 AAGGGGAGGGAAGATGGGGGAGG - Intronic
1093204230 12:16227828-16227850 TAGAATAGGAAAGATATTGGAGG + Intronic
1095200017 12:39372967-39372989 TGGGGGAGGAAATAACTTGGTGG - Intronic
1095398560 12:41789139-41789161 AAGGGGTGGAAAAATGTGGGGGG + Intergenic
1095655265 12:44661234-44661256 AAAGGGGGGCAAGATGTTGGAGG + Intronic
1096373831 12:51090992-51091014 AAGGGGAGGGAAGTTGTTGCAGG - Intergenic
1096518558 12:52171542-52171564 TAGGGGAGGGAAGGGGCTGGAGG + Intronic
1096845899 12:54406370-54406392 TAGGGGAGAAATGGTGTTTGTGG - Intronic
1097013481 12:55969337-55969359 TGGGAGGGGAAAGATGATGGAGG + Intronic
1097348920 12:58526031-58526053 TAGGAGAGGGGAGATGATGGAGG - Intergenic
1098713446 12:73798443-73798465 TAGGAGATGAAGGATGTTGGTGG + Intergenic
1101654162 12:106705426-106705448 TAGGGAAGGAAAGAGGTGGAGGG + Intronic
1101668723 12:106846256-106846278 AAGGGGAAGAAATAGGTTGGAGG - Intronic
1102410821 12:112716744-112716766 TAGGGGAGGAAAGATGTTGGGGG + Intronic
1102929596 12:116852122-116852144 TAGGGCAGGCAAGATTCTGGTGG - Intronic
1103283416 12:119779700-119779722 TCAGGGAAGAGAGATGTTGGGGG - Intronic
1103517025 12:121514715-121514737 TAGGGGAGTGAAGATATTAGGGG - Intronic
1103635697 12:122303403-122303425 TAAGGTAGGAAGGGTGTTGGGGG - Intronic
1103971465 12:124675459-124675481 CTGGGGAGGAAAGATGTTCGTGG + Intergenic
1104770925 12:131363782-131363804 TGGGGGAGGTAACATGTTTGTGG + Intergenic
1105683398 13:22752472-22752494 GAGTGGGGAAAAGATGTTGGGGG - Intergenic
1107996306 13:45864601-45864623 AAGGGGAGGAAAGAAGGAGGAGG - Intergenic
1110752425 13:79130571-79130593 AAGGGGAGGAAGGATGTTCCAGG - Intergenic
1111517063 13:89348424-89348446 TAGGGGAGGAACGTTGTGGGAGG - Intergenic
1111653055 13:91116786-91116808 GAGGGTGGGAAAGATGTTTGGGG - Intergenic
1112203404 13:97300680-97300702 TAGTGGAGTAAAGATGTTGAAGG - Intronic
1113002163 13:105653399-105653421 TAGTGGAAGAAATATGTTGTTGG - Intergenic
1113274603 13:108714866-108714888 GAGGGGATGAGAGATGGTGGTGG - Intronic
1113388776 13:109875607-109875629 TAGGGGAGGAAAGATAGGGAAGG + Intergenic
1114039850 14:18667751-18667773 AAGGAGAGCAAAGATGGTGGTGG - Intergenic
1114044891 14:18866300-18866322 AAGGAGAGCAAAGATGGTGGTGG - Intergenic
1114119332 14:19653222-19653244 AAGGAGAGCAAAGATGGTGGTGG + Intergenic
1116660493 14:47704467-47704489 CAGGGGAGAAAAGAGGATGGGGG + Intergenic
1117251403 14:53943052-53943074 AAGGGGAAGAGGGATGTTGGTGG + Intergenic
1117979495 14:61328495-61328517 TTGGAGAGGAATGAGGTTGGTGG + Intronic
1118618088 14:67589226-67589248 TTGGGGAGGAGAGAGGGTGGGGG - Exonic
1119137261 14:72232310-72232332 CAGGAGAGGGAAGATGGTGGAGG + Intronic
1120242077 14:81960936-81960958 TAAGGCAGGGAAGCTGTTGGCGG + Intergenic
1124173241 15:27396907-27396929 TAGGAGAAAAAAGAGGTTGGTGG + Intronic
1124898437 15:33799328-33799350 TAGGGGAGGGTAAATGGTGGTGG - Intronic
1125560003 15:40622806-40622828 TGGGGAAGGAAAAGTGTTGGTGG + Exonic
1126371326 15:47950246-47950268 CAGGGGAGGACAGATGTTCCAGG - Intergenic
1126579189 15:50227594-50227616 TTGGGGATGAAAGGGGTTGGGGG - Intronic
1126696756 15:51332829-51332851 TAGGGGAAGAAGGATCATGGGGG - Intronic
1127786846 15:62363130-62363152 TTGGGGAGGAAAAATGTGTGGGG + Intergenic
1127995998 15:64153384-64153406 CAGGTGAGGAAAGGTGTTGGAGG + Intronic
1128389564 15:67173939-67173961 TTGGGGGTGAAAGATGGTGGTGG + Intronic
1128698574 15:69787718-69787740 TAGTGCGGGAAGGATGTTGGGGG + Intergenic
1128893895 15:71355625-71355647 TAGGAGAGGAAAGAGGCTGCAGG + Intronic
1130927147 15:88394189-88394211 GAGGGGAGGAGGGATGTTGGGGG + Intergenic
1131791987 15:95975115-95975137 TAGGGAAGGATAGATTTTTGTGG - Intergenic
1131901407 15:97092067-97092089 CAGGGCAGAAAAGATGATGGTGG - Intergenic
1132025754 15:98403330-98403352 CAGGTGAGGGAAGAGGTTGGGGG - Intergenic
1133076729 16:3285780-3285802 CAGGGGAGGAAGGGTGCTGGGGG - Intronic
1134904592 16:17969487-17969509 TAGGGTAGGAAGGAAGTTGTAGG - Intergenic
1135247419 16:20869014-20869036 CAGGGGAGGAAAGAGTCTGGAGG - Intronic
1135724757 16:24845925-24845947 GAGGGGAGGAAAAATGCTGGCGG - Exonic
1135848646 16:25942058-25942080 TAGGGGTTGAAAGAATTTGGGGG + Intronic
1135983745 16:27168562-27168584 TAGGGGAAGAAAGATGAAGGAGG + Intergenic
1135999941 16:27284760-27284782 CAGGGGAAGAAAGAGGCTGGGGG + Intronic
1136018795 16:27426497-27426519 TGGGAGGGGAAAGGTGTTGGAGG + Intronic
1137752759 16:50879257-50879279 CAGGGGAGGAAAGGTCTTGAGGG - Intergenic
1138431023 16:56969350-56969372 GAAGTGAGGAAGGATGTTGGGGG - Intronic
1141612866 16:85192971-85192993 TAGGGCAGGAGGGCTGTTGGAGG + Intergenic
1142776592 17:2144855-2144877 TAGGTGAGGAATGATGTAGGAGG - Intronic
1143358415 17:6348077-6348099 TATGGGAGGAAAGATGGCTGGGG - Intergenic
1143634950 17:8159281-8159303 AAGGGTAGGAGAGATGCTGGAGG - Exonic
1144374802 17:14628287-14628309 AAGGGAAGGAAGGATGGTGGCGG + Intergenic
1146934599 17:36804974-36804996 TAGTAGAGGAGGGATGTTGGGGG - Intergenic
1147612650 17:41811067-41811089 TAGAGGAGGGGAGATGTTGGGGG - Intronic
1147671203 17:42177904-42177926 TAGGGATAGAAGGATGTTGGGGG + Intronic
1147788065 17:42994551-42994573 GAGGGGAGGAATGAGGGTGGTGG - Intergenic
1148139629 17:45318878-45318900 TAGGGGTGGAAAGAGATTTGGGG - Intergenic
1149066451 17:52486108-52486130 TAGGGGAGAGAAAATTTTGGGGG - Intergenic
1150645711 17:66976386-66976408 GAGGGATGGAAAGAAGTTGGAGG - Intronic
1150888220 17:69112289-69112311 CAAGGGAGAAAAGATATTGGGGG + Intronic
1152189592 17:78880280-78880302 GAGGATTGGAAAGATGTTGGTGG - Intronic
1152217319 17:79041335-79041357 CAGGGGAGGAGAGAGGTTCGGGG + Intronic
1152244829 17:79179875-79179897 TAGGAGGGGTCAGATGTTGGGGG + Intronic
1153405578 18:4734903-4734925 TAAGGCAGGGAAAATGTTGGTGG - Intergenic
1153527899 18:6015036-6015058 GCGGGGAGGAAAGATGATGAGGG + Intronic
1154193008 18:12245933-12245955 AAGGGCAGGAAGGAGGTTGGTGG - Intergenic
1154203596 18:12318267-12318289 AAGGGGTGGAGAGAAGTTGGTGG + Intronic
1154389749 18:13926197-13926219 CAGGTGAGAAAAGATGCTGGTGG + Intergenic
1155344969 18:24848857-24848879 TAGGGAAGAACAGATGTTGAGGG - Intergenic
1155489208 18:26382518-26382540 TAGGTGAGGTAAGATGTTAGAGG + Intronic
1156215228 18:34991169-34991191 GAGGGGAGGAAAGAGGCAGGAGG - Intronic
1159553098 18:69917388-69917410 GAGGGAAGGAAAGATGGTGCTGG - Intronic
1159685219 18:71410504-71410526 GTGTGGAGGAAAAATGTTGGAGG + Intergenic
1159939474 18:74395877-74395899 CAGGGGAGGGAGGATTTTGGTGG - Intergenic
1159978376 18:74744575-74744597 TAGGGGAGAAAACAAGTTTGTGG + Intronic
1163279053 19:16304037-16304059 TTGGGGAGGGAAGATGCTTGGGG + Intergenic
1163294103 19:16401175-16401197 TATGGGAGGAAAGAGGGAGGCGG + Intronic
1163701666 19:18789513-18789535 GAGGGGAGGAAGGATGAGGGCGG + Intronic
1164442292 19:28288465-28288487 TAGAGGAGGAAAAATGTTTGTGG + Intergenic
1164695705 19:30241971-30241993 TAAGGTTGGAAAGATCTTGGTGG + Intronic
1165663366 19:37602791-37602813 TATGGCAGGAAAGAAGCTGGTGG + Intronic
1165926998 19:39333019-39333041 GAGGGGAGGGGTGATGTTGGAGG - Intronic
1166142803 19:40814146-40814168 TAGGGGAGGACAGAATATGGAGG - Intronic
1166758796 19:45212026-45212048 CAGGAGAGGAAGGAGGTTGGGGG - Intronic
1167623446 19:50571129-50571151 TTAGGGAGGAGAGAAGTTGGTGG + Intergenic
1167633131 19:50638288-50638310 TAGGGTAGGAAAGCAGTTGGAGG + Intronic
1168689837 19:58369582-58369604 TTGGGGAGGAACGGTGATGGCGG - Intronic
925449350 2:3954708-3954730 CTGGGAAGGAAAGAGGTTGGAGG - Intergenic
925997425 2:9304623-9304645 TAGTGGAGTATAGATATTGGTGG + Intronic
925997508 2:9305000-9305022 TAGTGGGGTAAAGATATTGGTGG + Intronic
925997569 2:9305303-9305325 TAGTGGGGTATAGATGTTGGTGG + Intronic
926118402 2:10227616-10227638 TGGGGGAGGGAAGATGCTGAAGG + Intergenic
926313497 2:11692627-11692649 TGGGGGAGGAAAGAAGGAGGTGG - Intronic
927143754 2:20146989-20147011 GAGGTCAGGAAAGATGTAGGAGG - Intergenic
927615503 2:24589609-24589631 AGGGAGAGGAAAGAGGTTGGTGG + Intronic
927717654 2:25362945-25362967 AAGGAGAGGTGAGATGTTGGGGG + Intergenic
928268178 2:29830381-29830403 TAGGGCTGGAAAGGTGATGGTGG - Intronic
928603927 2:32926851-32926873 CAGGGGAGGAATGCTGATGGGGG - Intergenic
928901503 2:36323141-36323163 TACTGGAGGAAAGAATTTGGTGG + Intergenic
929035197 2:37684020-37684042 AAGTGGAGGAAACAAGTTGGTGG + Intronic
929443057 2:41980686-41980708 GAGGGAAGGAAAGATGGAGGAGG + Intergenic
930225890 2:48792658-48792680 TAGGAGAAGAAAGATGATGATGG - Intergenic
930781775 2:55230944-55230966 TAGGGGATGAAAAATGTTCCAGG + Intronic
931580358 2:63765276-63765298 TAGGGAAGGCAAGAGGGTGGGGG + Intronic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
932571806 2:72942209-72942231 TAGAGGAGGAAAAAGGCTGGTGG - Exonic
932601901 2:73133411-73133433 GAGGGAAGGAGAGATGGTGGAGG + Intronic
933792411 2:85893685-85893707 GGCGGGAAGAAAGATGTTGGTGG + Intergenic
937667313 2:124501857-124501879 TAGGAGAGAAAATATGTGGGTGG - Intronic
938270699 2:129967849-129967871 AAGGAGAGCAAAGATGGTGGTGG + Intergenic
938811969 2:134862122-134862144 AAGGGGAGGACAGTTGTTGGGGG - Intronic
939762502 2:146199911-146199933 TAGGGAAGGACAGAAATTGGTGG + Intergenic
939965253 2:148604368-148604390 CATGGGAGAAAAGAAGTTGGGGG + Intergenic
939987256 2:148842265-148842287 TAGAGGAGGAGAGAGGTTGGGGG - Intergenic
940512947 2:154642107-154642129 TAGGGGAGGATAGAGGCTGGTGG - Intergenic
941028665 2:160486832-160486854 AAGGGGAGGAAATAAGTTTGGGG - Intronic
941118043 2:161494230-161494252 TAGTCCAGGAAAGATGATGGTGG + Intronic
941157259 2:161994919-161994941 AAGGGGAGGGAAGTTGCTGGTGG - Intronic
942471468 2:176265081-176265103 AAGGGGAGGAAAGGAGTTGAGGG + Intergenic
942505416 2:176637482-176637504 AAGGGGAGGCAAGACTTTGGTGG + Intergenic
942683568 2:178507232-178507254 TGGGGGAAGAAAAATGTGGGAGG - Exonic
942884891 2:180911199-180911221 TTGGGGAGGAAAGCGGATGGAGG - Intergenic
942913265 2:181271878-181271900 GAGGGGAGGAAAGAGGTAGATGG - Intergenic
943301623 2:186209874-186209896 TAGGAGAAGAAAAAAGTTGGAGG - Intergenic
943507173 2:188775795-188775817 GTGGGGAGGAAGGATATTGGAGG - Intronic
943801500 2:192064596-192064618 AAAGGGAGGAAAGATAATGGGGG - Intronic
943831571 2:192470817-192470839 TAGGGGAGGCAAGATGATGATGG + Intergenic
946173446 2:217908832-217908854 TAGTGGAGGAGAGGTGTGGGAGG - Intronic
947048894 2:226019821-226019843 TATGGGAGGAATGCTGTGGGAGG - Intergenic
947214347 2:227736430-227736452 AAGGGGAGCAAAGATGCTTGAGG + Intergenic
947534509 2:230932249-230932271 GAGGGCAGGAAACATGTTAGAGG + Intronic
948112219 2:235465079-235465101 GAGGGGAGGACAGATTTGGGAGG + Intergenic
1169460498 20:5790229-5790251 TAGGGGAGGAAGGAAGTTTCAGG - Intronic
1169892050 20:10463958-10463980 TGGGGAAGGAAACATGTGGGAGG + Intronic
1169975954 20:11328231-11328253 TAAGGGTGGAAAGATGAAGGAGG + Intergenic
1170471664 20:16674113-16674135 AAGGGGAGGAAACAAGTGGGAGG - Intergenic
1171209361 20:23304860-23304882 TTGGGGAGGCAGGATGCTGGTGG - Intergenic
1171453800 20:25255285-25255307 TGTGGGAGGAGAGATGTTGAGGG - Intronic
1172428932 20:34874692-34874714 TAAGGGAGCACAGATGTTGCTGG - Intronic
1172852951 20:37979743-37979765 CAGCGGGGGAAAGATGTTGCTGG + Intergenic
1172993009 20:39049880-39049902 TAGGGTAGGAGGAATGTTGGGGG + Intergenic
1173914251 20:46694873-46694895 GAGGGGAGGAATGATATTGGGGG + Intergenic
1176071019 20:63226526-63226548 AAGAGGAGGAAAGAGGTGGGAGG - Intergenic
1177139541 21:17343485-17343507 TAGTGGAGCAGAGATGCTGGTGG - Intergenic
1178108870 21:29350731-29350753 GAGGGGAGCAAAGAGGTTGAGGG + Intronic
1178231185 21:30786480-30786502 CAATGGAGGAAAGATGATGGAGG - Intergenic
1178898827 21:36583054-36583076 TTTGGGAGGAGAGATGATGGAGG - Intergenic
1178949552 21:36974974-36974996 TAGAGGAGGCCAGAAGTTGGGGG - Intronic
1179808631 21:43855958-43855980 GAGAGGAGGAGAGATGCTGGTGG - Intergenic
1180463414 22:15588860-15588882 AAGGAGAGCAAAGATGGTGGTGG - Intergenic
1181999464 22:26908496-26908518 TAGGGAAGGAAATATATTAGAGG + Intergenic
1182153026 22:28043719-28043741 TTGGGGAGGATTGCTGTTGGGGG + Intronic
1184657720 22:45950203-45950225 GAGTGGGGGAAAGGTGTTGGGGG - Intronic
1185109067 22:48890694-48890716 CAGGGGAGGGAAGATGGAGGTGG + Intergenic
950383169 3:12634694-12634716 GAAGGGAGGAAAGTGGTTGGAGG + Intronic
950636143 3:14316340-14316362 TAAGGGAGGAAATAGGTTGAGGG - Intergenic
950853318 3:16083153-16083175 GAGGGGAGTGAAGATGGTGGTGG + Intergenic
952573287 3:34743441-34743463 ATGGGGAAGGAAGATGTTGGTGG - Intergenic
953372450 3:42400794-42400816 TAGGGGAAGAAGGAAGTTTGTGG + Intronic
954255182 3:49400266-49400288 TAGACTAGGGAAGATGTTGGGGG - Intronic
956492998 3:69794078-69794100 TAGGAGAGGAAAGAGGTCGTTGG - Intronic
957041080 3:75336038-75336060 TAGGGGAGGTAGGAATTTGGAGG + Intergenic
959611977 3:108305433-108305455 CACGGGAGGAAAGAAGATGGGGG + Intronic
959832418 3:110880472-110880494 TAAGGGAGGAAATATGTCTGTGG - Intergenic
961538460 3:127584568-127584590 AAGGGAAGGGTAGATGTTGGGGG - Intronic
962417563 3:135197012-135197034 TCAGGGAGGAAAGAGGCTGGAGG + Intronic
964775687 3:160274172-160274194 TAGGGAAGTAAAGATGAGGGAGG + Intronic
965122490 3:164579954-164579976 TAGAAGAGAAAATATGTTGGTGG - Intergenic
966172323 3:177095892-177095914 AAGGGGAAGAAAAATGTTTGAGG + Intronic
966916552 3:184587478-184587500 GAGGGGAGGAGAGAGATTGGAGG + Intronic
970777246 4:19690178-19690200 TTTGGGAGGAAAGTTGTGGGGGG - Intergenic
973298342 4:48552157-48552179 TGGGGTAAGAAGGATGTTGGGGG - Intronic
975292896 4:72697577-72697599 TTGGGGAGCAGAGATGTGGGAGG - Intergenic
975540836 4:75510148-75510170 AAGGAGAGGATAGATTTTGGTGG - Intronic
975786954 4:77900927-77900949 CAGATGAGGAAAGATGTTGTTGG + Intronic
977177437 4:93834502-93834524 CAGGGGAGGAGAGAAGTCGGAGG + Intergenic
977520286 4:98073972-98073994 TAGGGGAGCAAAGATCTGAGGGG - Intronic
981194470 4:141902736-141902758 TGGGGGAGGGAGGGTGTTGGGGG - Intergenic
981558745 4:146024048-146024070 TGGGGGAGGGGAGATATTGGTGG + Intergenic
981753649 4:148118200-148118222 TATGGGAGGAGAGAAGTTAGTGG - Intronic
981780983 4:148428729-148428751 TTCTGGAGTAAAGATGTTGGGGG - Intronic
982343554 4:154331328-154331350 TAGGGGAGGGAAGATCACGGGGG + Intronic
982603433 4:157482732-157482754 TACAGGAGGAAAGATGGTTGAGG - Intergenic
984175546 4:176412379-176412401 TAGTTGAGGAAAAATTTTGGAGG - Intergenic
984522018 4:180813394-180813416 TAGGGGAGAAAAGAGAATGGGGG + Intergenic
984926375 4:184810745-184810767 AAGGGGAAGGAAGATGTTTGGGG + Intronic
985783975 5:1884816-1884838 GAGGGGAGGAAGGAGGGTGGGGG - Intronic
986673620 5:10165069-10165091 AAGGGGAGAAAGAATGTTGGAGG - Intergenic
988249419 5:28736328-28736350 AAGGTGAGGACAGATGCTGGAGG + Intergenic
989669567 5:43899682-43899704 AAGGGTAAGAAAGTTGTTGGTGG - Intergenic
990563322 5:57004901-57004923 TAGTTAAGGAAAGCTGTTGGTGG - Intergenic
990691355 5:58367780-58367802 TAGGTAGGGAATGATGTTGGAGG + Intergenic
991273583 5:64816309-64816331 GAAGGAAGGATAGATGTTGGAGG - Intronic
992164996 5:74040704-74040726 TAGGGGAGGAAAGACATTGAGGG - Intergenic
992347532 5:75895503-75895525 TTGGGGAGGAAGCATGATGGTGG + Intergenic
993007229 5:82441657-82441679 TAGGGGAGTAAAGGTGGTGGAGG + Intergenic
993401430 5:87457457-87457479 TAGTGGAGGAAATAAGTTGATGG + Intergenic
995036030 5:107535259-107535281 TTTGGGAGAAAAGAGGTTGGAGG + Intronic
995725749 5:115179357-115179379 TAGGGAGGGGAAGATGCTGGAGG - Intronic
996021456 5:118595029-118595051 CAGGGGAGGAGAGATAGTGGAGG + Intergenic
997926488 5:138035108-138035130 TAGGGTAGGAATGCTGCTGGAGG - Intronic
998142518 5:139708320-139708342 TAGCGAGGGAAAGATGGTGGTGG - Intergenic
998389864 5:141780455-141780477 TAGGGGAGGAAAGGAGTCTGGGG - Intergenic
999231901 5:150066675-150066697 CAGGGTGGGAAGGATGTTGGGGG - Intronic
999263700 5:150253162-150253184 TTGGGGAGGAGAGATGGCGGAGG + Intronic
1000185105 5:158851482-158851504 AAGGGGAGGAAAGAAGAGGGGGG + Intronic
1000942848 5:167383573-167383595 GTGGGGAGGGAAGATGTTGGGGG - Intronic
1001558556 5:172653985-172654007 TAGGGGAAAAAAAAAGTTGGGGG - Intronic
1003525306 6:6892068-6892090 GAGGGGAGGAAAAAGGCTGGCGG - Intergenic
1004000750 6:11594668-11594690 TAGGGGAGGAAAGATAGGGGAGG + Intergenic
1004319828 6:14623743-14623765 TCCGGGAGGAAAGATGTTTGAGG - Intergenic
1005353793 6:24962377-24962399 TTGGGGAGGAGAGAGTTTGGAGG + Intronic
1007493731 6:42244533-42244555 TTTGTGAGGAAAGATGGTGGGGG - Intronic
1007995592 6:46304604-46304626 TAAGAGAGGAAAGATGTGGAGGG + Intronic
1008109853 6:47479868-47479890 TAGAAAAGGAAAGATGATGGGGG - Intronic
1008623113 6:53291364-53291386 TAGGGGAGGAAGGAAGTGGGTGG - Intronic
1008802437 6:55386041-55386063 TAGGAAAGGAAAGTTATTGGTGG - Intronic
1009620677 6:66072031-66072053 AAAGGGAGGAAAGAAGGTGGTGG + Intergenic
1012610777 6:101216663-101216685 TTGGGGGTGAAATATGTTGGGGG + Intergenic
1012948070 6:105488893-105488915 GAGGCAATGAAAGATGTTGGCGG + Intergenic
1014019829 6:116574605-116574627 AAGGGCAGGAGAGATGTTAGGGG - Intronic
1014131239 6:117836752-117836774 AAGGGGAGGACAGATACTGGGGG - Intergenic
1014673692 6:124338939-124338961 TAGGTGGGGAGAGATTTTGGTGG + Intronic
1015022215 6:128490467-128490489 AAGGGGAGGAAAGATGCCAGAGG + Intronic
1015637760 6:135295712-135295734 GAAGGGAAGAAAGATGTAGGAGG + Intronic
1016779762 6:147944495-147944517 TAGGGGAGGAAACCGGTGGGAGG - Intergenic
1016799662 6:148156025-148156047 TAGGGGAGGAAAGAACTTCCTGG - Intergenic
1016922200 6:149306802-149306824 CAGGGCAGGAAAGTTGTGGGTGG + Intronic
1017263515 6:152415482-152415504 GAGGAGAGGGCAGATGTTGGAGG - Intronic
1017428479 6:154346809-154346831 TGGGGGAGGAAACTTGTGGGAGG - Intronic
1017476859 6:154804146-154804168 TAGTAGGGGGAAGATGTTGGAGG + Intronic
1017788310 6:157774270-157774292 TAGTGGAGGAGGGATGTGGGAGG + Intronic
1020340239 7:7102088-7102110 TAGCGAAGGATAGAGGTTGGGGG - Intergenic
1021048335 7:15951213-15951235 GAAGGGAAGAAAGATTTTGGTGG + Intergenic
1021575901 7:22105630-22105652 TAGGTGAGGAATGATGATTGGGG - Intergenic
1022958146 7:35400277-35400299 AAGGAGAGAAAAGATGTTAGTGG + Intergenic
1026352106 7:69526413-69526435 TTGGGGAAGAAAAATGCTGGTGG + Intergenic
1026518479 7:71093989-71094011 TAGGTGAGGAATGATGGTGATGG + Intergenic
1028343269 7:89748367-89748389 TAGGGTGGGAGAGCTGTTGGGGG + Intergenic
1028569918 7:92275713-92275735 AAGTGGAGGAAAGAAGCTGGGGG - Intronic
1028889217 7:95968115-95968137 TAGGCGTGGAAAGAGGTTAGAGG + Intronic
1028986533 7:97013379-97013401 AAGTGGAGGAAAGATGTCGAAGG + Intergenic
1030039860 7:105439860-105439882 TTGGGAAGGAAAGAAGATGGAGG + Intronic
1031382377 7:121102788-121102810 TGGGGGAGGGGAGTTGTTGGAGG - Intronic
1032016617 7:128384118-128384140 AAGGGGAGGGAGGAGGTTGGTGG + Intergenic
1032116367 7:129121100-129121122 CAGGGAAGGAAAAAGGTTGGTGG + Intergenic
1032307557 7:130750540-130750562 AAGGGCAGGAATGATTTTGGAGG + Intergenic
1032610573 7:133408228-133408250 TGGGGAGGGAATGATGTTGGTGG + Intronic
1033443730 7:141402583-141402605 AAGGGGAGGAGAGAGGATGGAGG + Intronic
1034349302 7:150405915-150405937 CATGGGAGGAAAGAACTTGGGGG + Intronic
1034708909 7:153173112-153173134 ATGGGGAGCAAAGATATTGGTGG + Intergenic
1036005446 8:4656876-4656898 TAGGACAGATAAGATGTTGGGGG - Intronic
1038479027 8:27888839-27888861 TAGGAGAGGAAAGTGGTTTGAGG + Intronic
1039133419 8:34293629-34293651 TAGGCAAGGAGAGATGCTGGAGG + Intergenic
1039253936 8:35697965-35697987 TTGGAGAGGGAAGATGGTGGGGG - Intronic
1040725147 8:50373886-50373908 CAGTGGAGTAAAGGTGTTGGTGG - Intronic
1040808175 8:51418941-51418963 TAGGGAAGGAAAGACGAGGGAGG + Intronic
1041142365 8:54836204-54836226 AAAGGGAGAAAAGATGTTGCAGG + Intergenic
1042975011 8:74458977-74458999 TATGGGAGAAAAAATTTTGGTGG + Intronic
1043375286 8:79642036-79642058 CTGGGCAGGAAAGATCTTGGAGG - Intronic
1045149845 8:99392211-99392233 AAGGGGAGGAAAGATGATTAAGG - Intronic
1045763868 8:105644425-105644447 TTTGGGAGGCAACATGTTGGAGG - Intronic
1047521617 8:125599399-125599421 CAGGGCAGGACAGATGCTGGTGG - Intergenic
1047651535 8:126927951-126927973 TAGGGCAGGAAAGATTTGGTTGG + Intergenic
1050225067 9:3444405-3444427 TAGGGAGGGATAGATCTTGGTGG + Intronic
1052417904 9:28201759-28201781 GAGGGGAGAAAGGATGTGGGGGG - Intronic
1054777592 9:69136890-69136912 GAGGAGAGGGAAGAGGTTGGGGG + Intronic
1054965621 9:71023825-71023847 TAGGGAAGGGAAGATGCAGGAGG + Intronic
1055617742 9:78090687-78090709 TAGGGGAGGGAGGTAGTTGGCGG + Intergenic
1055671018 9:78606261-78606283 ATGGGGAGGCAAGATGTTGTGGG + Intergenic
1056441618 9:86627621-86627643 TCTGGAAGGAAAGATGTTGCTGG + Intergenic
1056483964 9:87035536-87035558 TAGGGGATCATAGATGCTGGGGG - Intergenic
1058607963 9:106743726-106743748 TAGGGGAGGGAAGATGGAAGAGG - Intergenic
1058666129 9:107317622-107317644 CAGAGGGGTAAAGATGTTGGTGG + Intronic
1059114984 9:111593158-111593180 TACAGGAGGAAAGCTGTTAGAGG + Intronic
1059754125 9:117276503-117276525 TAGGGAGTGAAATATGTTGGTGG - Intronic
1060661481 9:125407762-125407784 GAGGGGCGGAAAGAGGTTGCAGG + Intergenic
1062324163 9:136004473-136004495 TTGGGGAGGAACCATGGTGGGGG - Intergenic
1062516214 9:136937874-136937896 CAGGGGAGGAAAGCTAATGGGGG + Intronic
1188304092 X:28541257-28541279 TAGGGGAGGAGTGGTGGTGGAGG + Intergenic
1188551508 X:31369578-31369600 TAGGGAGGGAAAAATGTTGAGGG + Intronic
1188978859 X:36708089-36708111 TGAGGGAGCAAAGATGGTGGAGG + Intergenic
1189230891 X:39451515-39451537 TAGGGGAGGGAAGGTGGTGGGGG - Intergenic
1189296399 X:39921353-39921375 AAGGGGAGGAACGATGGGGGCGG - Intergenic
1189866169 X:45329470-45329492 TAGGGGCTGAAAGCTGTTAGTGG + Intergenic
1190254618 X:48753342-48753364 TGGGGAAGGAATGATGCTGGAGG - Intergenic
1190427387 X:50345909-50345931 TGGGGGAAGAAAGCTGTTGCGGG + Intronic
1193263620 X:79440842-79440864 TGGGGGAGAAAAGATGGTGGTGG + Intergenic
1195280186 X:103325559-103325581 TATGGTAGGAAAGAAGTGGGTGG - Intergenic
1195971073 X:110474129-110474151 TGGGGGAGGAAGGATGGGGGTGG - Intergenic
1196815448 X:119662037-119662059 GGGGACAGGAAAGATGTTGGGGG - Intronic
1197202654 X:123761785-123761807 AAGGGGAGAATAGATTTTGGAGG + Intergenic
1197597751 X:128487332-128487354 AAAGGGAGGAGAGATGTTAGAGG - Intergenic
1197655850 X:129115194-129115216 TATGGGAGAATAGATTTTGGAGG - Intergenic
1197969279 X:132098058-132098080 GAAGGGAGGAAAGAGTTTGGAGG + Intronic
1201226061 Y:11820234-11820256 GAGGGGAGGAAGGAGGTGGGAGG + Intergenic