ID: 1102418640

View in Genome Browser
Species Human (GRCh38)
Location 12:112786531-112786553
Sequence CTCTTAAAGGAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 0, 2: 1, 3: 55, 4: 456}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102418632_1102418640 2 Left 1102418632 12:112786506-112786528 CCTGACAGTAGCATTTCCCTGGA 0: 1
1: 0
2: 1
3: 9
4: 127
Right 1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG 0: 1
1: 0
2: 1
3: 55
4: 456
1102418628_1102418640 14 Left 1102418628 12:112786494-112786516 CCCTTTTGTGTCCCTGACAGTAG 0: 1
1: 0
2: 0
3: 15
4: 179
Right 1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG 0: 1
1: 0
2: 1
3: 55
4: 456
1102418630_1102418640 3 Left 1102418630 12:112786505-112786527 CCCTGACAGTAGCATTTCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 152
Right 1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG 0: 1
1: 0
2: 1
3: 55
4: 456
1102418626_1102418640 30 Left 1102418626 12:112786478-112786500 CCCTGTGACATTTCTTCCCTTTT 0: 1
1: 0
2: 10
3: 70
4: 675
Right 1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG 0: 1
1: 0
2: 1
3: 55
4: 456
1102418629_1102418640 13 Left 1102418629 12:112786495-112786517 CCTTTTGTGTCCCTGACAGTAGC 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG 0: 1
1: 0
2: 1
3: 55
4: 456
1102418627_1102418640 29 Left 1102418627 12:112786479-112786501 CCTGTGACATTTCTTCCCTTTTG 0: 1
1: 0
2: 3
3: 61
4: 860
Right 1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG 0: 1
1: 0
2: 1
3: 55
4: 456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102418640 Original CRISPR CTCTTAAAGGAGAAGGAGGA GGG Intronic
900120394 1:1046376-1046398 CTCTGCAAGGAGAGGGAGGTTGG - Exonic
900715898 1:4143521-4143543 CTCTTACATAAGAAGGAGTAGGG + Intergenic
900877105 1:5350629-5350651 CATTTGAAGGAGAAGGTGGAGGG + Intergenic
901021336 1:6257484-6257506 CTCTTAGAGGAGAAGGTGCAGGG - Intronic
901674852 1:10877156-10877178 TTCTTGAGGCAGAAGGAGGAGGG + Intergenic
903020992 1:20394179-20394201 CTACAAAAGGAGAAAGAGGATGG + Intergenic
903045668 1:20562663-20562685 CTCTGAACAGGGAAGGAGGAAGG - Intergenic
903282407 1:22257460-22257482 CTCTGGATCGAGAAGGAGGAAGG - Intergenic
903483041 1:23668714-23668736 CTCTTAAAGGAAAACCAGGCTGG + Intergenic
903491079 1:23729081-23729103 ATCTTGAAGGAGGAGGAGGAAGG - Intergenic
904087196 1:27917146-27917168 TTTTTAAAGAGGAAGGAGGAAGG - Intergenic
904794046 1:33045433-33045455 CTCTTGAGGGAGAGAGAGGAAGG + Intronic
905385579 1:37601479-37601501 TTCTTAAAGAAAAAGGAGGGAGG - Intergenic
905836542 1:41127801-41127823 TTCTCACAGGAGAAGGAAGAAGG - Intronic
907845586 1:58203372-58203394 GTCTTAAAGGAGAAATATGAGGG - Intronic
908459031 1:64331258-64331280 TGCTTAAAGGTGAAGCAGGAGGG - Intergenic
908838481 1:68253613-68253635 ATCTTAATAGAGAAGAAGGAAGG - Intergenic
909168893 1:72268196-72268218 ATATTAAAGGAAGAGGAGGAAGG + Intronic
909237465 1:73171843-73171865 CCCTTTCAGCAGAAGGAGGAAGG - Intergenic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
909752889 1:79185791-79185813 GTCTTAAAGGGGAAAGAGGAGGG - Intergenic
910094468 1:83505247-83505269 CTCTGGAAGGAGGAGGAGGCAGG - Intergenic
910147093 1:84093141-84093163 TTCTTAAAGAAGACCGAGGAAGG - Intronic
911119140 1:94277715-94277737 ACCTTGATGGAGAAGGAGGAGGG - Intergenic
911584059 1:99669810-99669832 ATTAAAAAGGAGAAGGAGGAGGG + Intronic
912207286 1:107522670-107522692 CTCTTAAAGGAGCAAGAAAAAGG - Intergenic
912314459 1:108654402-108654424 CTCTAAAGGGAGATGGAGGAGGG + Intronic
912670021 1:111616887-111616909 CTATTAAAGGAGATAGAAGAAGG - Intronic
912985105 1:114419755-114419777 CTCTTACAGGAGCAGGGGGATGG + Intronic
913098608 1:115542576-115542598 CTATTAAAGGAGCTGAAGGAAGG + Intergenic
913137199 1:115903679-115903701 CTCTTATAGAAACAGGAGGAAGG - Intergenic
913424938 1:118717991-118718013 CTCCTAAAGGAGAAGCTGAAAGG + Intergenic
914258181 1:145977376-145977398 GTTTTAAAGGAGAGGAAGGAAGG - Intronic
914978334 1:152388143-152388165 CTCTAAAAGTAGAATGAGGTTGG - Intergenic
915366784 1:155321288-155321310 CCCTGAAAGGAGGTGGAGGATGG - Intronic
915999243 1:160598780-160598802 CTCTTCAAAGAGAAGAAGGATGG - Intergenic
916627069 1:166569944-166569966 CTCTTGTAGGAGAAGGCTGAAGG + Intergenic
916879316 1:169004108-169004130 CTCCTCAAGGGTAAGGAGGACGG - Intergenic
918434836 1:184500716-184500738 CAGTTAAAGGAGAAGGAGCTGGG + Intronic
919420653 1:197365879-197365901 CTCTGAAAGGTGGAAGAGGAAGG - Intronic
921514285 1:216070578-216070600 CTCATAAAGAAGGAGGTGGATGG + Intronic
923090971 1:230741051-230741073 CTCCTAGATGAGAAGGAGAAAGG + Intergenic
923405572 1:233655690-233655712 CTCACAAGGCAGAAGGAGGAAGG - Intronic
924673335 1:246150874-246150896 ATCCTAAAAGAGATGGAGGAAGG + Intronic
924699326 1:246435156-246435178 CTATTAAAGGAGAAGAGGAAAGG + Intronic
1065280743 10:24135182-24135204 CTCCAAGAGGAGAAGGAGGATGG + Intronic
1065806128 10:29395004-29395026 CTCAGAAAGGAGAAAGGGGATGG - Intergenic
1066679113 10:37919365-37919387 CTCTTCCAGGAGAAGGAACATGG + Intergenic
1067943828 10:50678255-50678277 AGCTTAAAGGAGAAGGACCAGGG + Intergenic
1068177129 10:53475811-53475833 ATCTGAAAGGAGAAGGGTGAGGG - Intergenic
1069071375 10:63993545-63993567 CACTTAAAGGAGAAGGAAAGAGG - Intergenic
1070616051 10:77969989-77970011 CTCAGAAAAGAGAAGCAGGATGG - Intronic
1070825149 10:79386457-79386479 CTCTGCAGAGAGAAGGAGGAAGG + Exonic
1071704449 10:87982183-87982205 CTCTAAAATGAGAGGGAGGCAGG - Intergenic
1071827790 10:89342429-89342451 TTGTTTAAGGAGCAGGAGGATGG - Intronic
1072285281 10:93908534-93908556 CTCTAGGAGGGGAAGGAGGAAGG - Intronic
1072943119 10:99785267-99785289 CACTCACAGTAGAAGGAGGAGGG + Intronic
1072946434 10:99813970-99813992 CTCTCAAAGGAGGAAGAGAAAGG - Intronic
1072982936 10:100114962-100114984 CTCTTTAAGGAGGAGTTGGACGG - Intergenic
1073165856 10:101450505-101450527 ATCTTAAAAGAGCAGGAGGCAGG + Intronic
1074079007 10:110152684-110152706 TTCTGAATGGGGAAGGAGGAAGG + Intergenic
1074186765 10:111104902-111104924 ATCTTAAAGGATAAGAAGAAAGG - Intergenic
1074202938 10:111256058-111256080 CTCTAGAAGGAGGAGGAAGAGGG + Intergenic
1075291976 10:121238482-121238504 AGCATAAAGGAGATGGAGGAAGG - Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075358073 10:121801821-121801843 CTCTAGCAGGAGTAGGAGGATGG - Intronic
1075475897 10:122733415-122733437 CTCATAAAGGAGAATGCTGAAGG - Intergenic
1076246347 10:128950283-128950305 GTCCTGAAGAAGAAGGAGGACGG + Intergenic
1076459346 10:130629200-130629222 CTATTAAGGGAGAAGGAGGGAGG + Intergenic
1076523282 10:131094346-131094368 CTCTGTAAGGAGAAGTGGGAGGG - Intronic
1076863495 10:133155122-133155144 TTCTTGAAGAAGAAGGAGGTGGG + Intergenic
1077067829 11:651638-651660 CTTTGAAAGGAGACTGAGGAGGG + Intronic
1078047120 11:7925084-7925106 CTATTAAAGAAAAAGGAGAATGG + Intergenic
1078120853 11:8507537-8507559 GTGGTAAAGGTGAAGGAGGAAGG + Intronic
1078740445 11:14060994-14061016 GGTTTAAAGGAGAAGGAAGAAGG + Intronic
1078795513 11:14588351-14588373 CTCTAACAGGAGTAGGTGGAGGG + Intronic
1080362280 11:31529683-31529705 CTCATATAGGAAAAGGAGGGGGG + Intronic
1080856628 11:36117197-36117219 ATCTGGAAGGAAAAGGAGGAAGG + Intronic
1080892447 11:36421171-36421193 CTTTTAAATGTCAAGGAGGAAGG - Intronic
1081982205 11:47274813-47274835 ATCTCTAAGGAGAAGGGGGAAGG + Exonic
1083779090 11:64909013-64909035 CTCTTAGAGGAGAAGGGCGAGGG + Exonic
1084934675 11:72580533-72580555 GCCTTAAAGGGGAAGAAGGACGG + Intronic
1085481087 11:76823604-76823626 CCCTTTCAGGAGAAGGAGGTGGG + Intergenic
1086187004 11:84030575-84030597 CTCTTAAAGGGGAAGAGAGAGGG + Intronic
1087904796 11:103683135-103683157 CTCTCAGAGGAGTAGGAGGAGGG - Intergenic
1088150708 11:106741478-106741500 GTATCAAAGGAGAAGGAAGAAGG + Intronic
1088390806 11:109312816-109312838 CTCTCAGAGGAGAAGGCCGAGGG + Intergenic
1088779945 11:113124206-113124228 CTCTAGACTGAGAAGGAGGAAGG + Intronic
1089225987 11:116922483-116922505 TTCTTAAAAAAGAAGGGGGAAGG + Intronic
1089361023 11:117886650-117886672 CCCGTGAAGGAGGAGGAGGAGGG + Intergenic
1089639139 11:119835716-119835738 TTCTTCAAGCAGAAGCAGGAGGG - Intergenic
1089718196 11:120384596-120384618 CTCTTACAGTAGAATGAGGGAGG - Intronic
1090347504 11:126083040-126083062 TTCTTACGGGAGGAGGAGGATGG - Intergenic
1092214176 12:6668986-6669008 CTCTTAGAGGACTATGAGGAAGG + Intronic
1092752597 12:11732689-11732711 CTCTAGAGGCAGAAGGAGGACGG - Intronic
1092914120 12:13174072-13174094 CTCTAAATGGAAAAGGAGGAAGG - Intergenic
1092930370 12:13309853-13309875 CTATTGGAGGGGAAGGAGGAAGG - Intergenic
1093446470 12:19265743-19265765 CTCTTAGATGAGAAAGAAGAGGG + Exonic
1094201878 12:27803417-27803439 CTGATGGAGGAGAAGGAGGATGG + Intergenic
1094813058 12:34160867-34160889 CTCTGAAATCAGATGGAGGAAGG + Intergenic
1095304674 12:40625748-40625770 CTCTTAAAAAGGAAGGGGGAGGG - Intergenic
1097860148 12:64510736-64510758 GTCTTGAAGGAGAATGGGGAGGG + Intergenic
1098021369 12:66159660-66159682 CTCTTAAGGGAGATGGCGGGTGG - Intronic
1098362718 12:69670577-69670599 TCCTGAAAGTAGAAGGAGGAGGG + Intronic
1098397998 12:70042625-70042647 TTCTTAAGGAAGAAGAAGGAAGG + Intergenic
1098826813 12:75306959-75306981 CACTCAGAGGAGAAGGAGTAAGG + Intronic
1099109938 12:78546180-78546202 CTCATAAAGAAGAAGAAGGTAGG - Intergenic
1099957738 12:89367652-89367674 CTCTTAAAGAAGAAGAAGAAGGG + Intergenic
1101856535 12:108448174-108448196 TTTTTAAAGGAGAAAGAGCAAGG - Intergenic
1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG + Intronic
1102437615 12:112937702-112937724 ATTTTGGAGGAGAAGGAGGAAGG - Intergenic
1102454658 12:113064030-113064052 CTCTCAAGGGAGAAGGGGGAAGG - Intronic
1103024286 12:117560879-117560901 GTCTTATAGCAGAAGGAGAAGGG - Intronic
1103522848 12:121547935-121547957 CTCTGAAAGGGGAAAGAGGCCGG - Intronic
1103669700 12:122603301-122603323 ATCTTTAAGGAGAAGCAGGATGG + Intronic
1104213733 12:126715267-126715289 CTCTAAAACGGGAATGAGGAAGG + Intergenic
1104599746 12:130144632-130144654 GTCTTAAAGGAGAGGGATGTTGG + Intergenic
1104901686 12:132192787-132192809 TCCTTAGAGGAGGAGGAGGAGGG - Intergenic
1105687373 13:22797883-22797905 CTCTTTAAGGATAAGGAGCTTGG + Intergenic
1105846901 13:24301198-24301220 CTTTTAAAGTAGAAAGATGACGG - Intronic
1106067965 13:26376291-26376313 ATCTTAAAGGAGAAGTATCAAGG - Intronic
1108264580 13:48693648-48693670 CTCTGAAAAGAGAGGGAGGAAGG + Intronic
1109127950 13:58542172-58542194 CTATTAATGGAGAAGTAGGCAGG - Intergenic
1109218794 13:59619472-59619494 CACATAAAGGAGAAAGAGAAAGG + Intergenic
1110282722 13:73714197-73714219 CTCTGAAAGGCCAAGGTGGAAGG + Intronic
1110700387 13:78540626-78540648 CTCTGCAAGAAGAAGGAGGATGG - Intergenic
1111467049 13:88627336-88627358 CACTCACAGGAGAAAGAGGAAGG + Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1111777236 13:92679895-92679917 CTCTTGAAAGAGAAGGGGGTGGG - Intronic
1113055534 13:106263118-106263140 CTCTTGAAGTGGAAGGTGGAAGG - Intergenic
1113405247 13:110032896-110032918 CTCTTTAAGGAGAAGCGGGTGGG - Intergenic
1114441129 14:22748902-22748924 CTGTCAAAGGAGAAGGGGCACGG + Intergenic
1114535181 14:23418054-23418076 CCCTGAGAGGAGAAGGAGGTGGG + Intronic
1115020216 14:28670665-28670687 CTCTTAAGGGAAAAGCAGAAGGG + Intergenic
1115967266 14:38904894-38904916 CTCTGAAAAGAGAAAGAGGGAGG - Intergenic
1116563556 14:46415551-46415573 CTCAGAAAGGAGGAGGAGAAGGG + Intergenic
1117321441 14:54627687-54627709 GGTTTAAAGGAGCAGGAGGAGGG - Intronic
1118083668 14:62390864-62390886 CTATTAGAGGAGAGAGAGGAAGG + Intergenic
1118506809 14:66422564-66422586 ATGTTAAGGGAGAAGGAGGTTGG - Intergenic
1118668454 14:68096482-68096504 ATCGAAAAGGAGTAGGAGGAAGG - Intronic
1118769839 14:68935352-68935374 CTCTGACAGGAGAAGGGAGAGGG - Intronic
1118804831 14:69226955-69226977 ATCTTACAGGAGGAGTAGGAGGG - Intronic
1119038252 14:71248795-71248817 CTTTCAAAGGAGGAGGAGGAGGG - Intergenic
1119133081 14:72192609-72192631 GTCTTAAGGGAGGAGCAGGAGGG - Intronic
1119613681 14:76084274-76084296 ATCTAAAAGGATAAGGAGAAGGG - Intronic
1121080403 14:91103335-91103357 GGCTAAAAGGAGAAGGGGGAAGG - Intronic
1121689721 14:95868659-95868681 CTCTTAATGGACAATGAGGAAGG - Intergenic
1122201799 14:100127257-100127279 ACGTTAAAGGAGAAGGACGAGGG + Intronic
1123113057 14:105882019-105882041 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1123115406 14:105892169-105892191 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1123119657 14:105910887-105910909 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1125681042 15:41530336-41530358 CCCTTAAAGGAGTAGGAGAGTGG + Intronic
1126668215 15:51093911-51093933 CTCTTAAAGGCGAAGTCGGGAGG + Intronic
1127676587 15:61245163-61245185 CTCTTAAAGAAAAATGAGGTTGG - Intergenic
1128341664 15:66826553-66826575 ATCTTGAATGAGAAGGAAGAAGG - Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129038589 15:72665611-72665633 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1129190193 15:73932923-73932945 CTCTCAAAGGAGAAACAGGGAGG - Intronic
1129211301 15:74071619-74071641 CTCCCGAAGGAGAAGGCGGACGG - Exonic
1129399102 15:75269468-75269490 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1129402709 15:75293744-75293766 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1131106966 15:89741613-89741635 CTCTTAAAGGAAAGGGCTGAAGG - Intronic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1131871962 15:96772789-96772811 CTCAGAAAGGAGCAGGATGAGGG - Intergenic
1131962263 15:97802022-97802044 CACTTTGAGTAGAAGGAGGAAGG + Intergenic
1133401877 16:5494037-5494059 TTCTTAATGGAGCAGGAGGTGGG + Intergenic
1133526031 16:6606513-6606535 CTCGTAGAGGGGAAGGAGGAGGG - Intronic
1134067571 16:11238941-11238963 CTCATATAGCGGAAGGAGGAGGG + Intergenic
1134863441 16:17582740-17582762 TTATTAAAGTAGAATGAGGATGG + Intergenic
1135345491 16:21685335-21685357 CTCTTAGAAGACAAGAAGGACGG + Exonic
1135414533 16:22258576-22258598 CTCTGAAAGGGGACGGAGCAGGG - Exonic
1135633367 16:24053673-24053695 CTTTCAAAGGAGATGAAGGAGGG + Intronic
1135671857 16:24382267-24382289 CTCCTGGTGGAGAAGGAGGAGGG - Intergenic
1135975793 16:27108369-27108391 CTCCTAGAGGAGCGGGAGGAGGG + Intergenic
1136230523 16:28882985-28883007 CTCTCAAAGGGGAAGGAGCGAGG + Intronic
1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG + Intergenic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1137844051 16:51669504-51669526 CTCTTATTGGGGAAGGAGGGAGG + Intergenic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1138086690 16:54139995-54140017 CTAATAAATGAGAAGGAGGCAGG - Intergenic
1139147543 16:64342190-64342212 CTCTTAAAGGTATAGGATGAGGG - Intergenic
1139167496 16:64584995-64585017 CATTTAAAGGAGAAAGAGAAAGG - Intergenic
1139289777 16:65846973-65846995 CTCTTAGGGGAGAAGCAAGATGG - Intergenic
1139525977 16:67516959-67516981 GTGTTAAGTGAGAAGGAGGAAGG + Intergenic
1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG + Intronic
1140977944 16:80078678-80078700 CTCTTAAAAAAGAAGAAGAAAGG - Intergenic
1142253125 16:89001922-89001944 CCCTTAGAAGAGAAGGAGGATGG - Intergenic
1142358081 16:89613535-89613557 CTCTGAAAGTAGAAAGAGGAGGG - Intronic
1142667866 17:1472788-1472810 GCTTTAAAGGATAAGGAGGAGGG + Intronic
1143978811 17:10850203-10850225 ATCTTGGAGGAGAAGGAGGCGGG - Intergenic
1144014932 17:11185098-11185120 CTCTTAATGGAAAATAAGGAAGG + Intergenic
1144443977 17:15309468-15309490 CTCTTTACAGAGAAAGAGGAGGG - Intronic
1144463421 17:15477438-15477460 CTATTACAGCAGAAGGAGGAAGG - Intronic
1145296952 17:21599687-21599709 CTCTTGAAGGAGAGAGAGGGTGG - Intergenic
1146064699 17:29625035-29625057 CTCTTTAAAGAGAAGGAGGGTGG - Intergenic
1146575182 17:33984779-33984801 TGCTGAAAGGAGATGGAGGAAGG + Intronic
1147043791 17:37737987-37738009 TTCAGAAAGGAGAAGGAGGCAGG - Intronic
1147407433 17:40222359-40222381 CTCTTAAAGGAAAACAAGGCTGG + Intronic
1148437374 17:47694539-47694561 CTCTTAAAGGGGCCGCAGGAGGG + Intronic
1150929903 17:69573183-69573205 TTCTTAAAGGAGGAGGAAGAGGG - Intergenic
1151835562 17:76580794-76580816 CTCCTAAAGGAGGAAGAGAAAGG + Intronic
1152296299 17:79469163-79469185 CCCATAAAGGAGAAGGTGTAGGG - Intronic
1153268344 18:3294522-3294544 CTCTTACAGGAGAAGAGGGAAGG + Intergenic
1153460728 18:5329821-5329843 CTCTTAGATGGGAAGGAGGAAGG + Intergenic
1153463974 18:5368215-5368237 GTGTGAAAGGAGAGGGAGGAAGG - Intergenic
1153571410 18:6476944-6476966 CTCATAAATGAGAAAGAGCAGGG + Intergenic
1154486499 18:14875759-14875781 ATCATACAGGAGAAGGAGGCAGG + Intergenic
1155318331 18:24594094-24594116 CACTTAAAGAAGAGGCAGGAAGG + Intergenic
1156170211 18:34474020-34474042 CTCTGGAAGGAGGAGGAGTAGGG - Intergenic
1156179730 18:34588619-34588641 CTCTTCAAAGATGAGGAGGAGGG + Intronic
1156289644 18:35735013-35735035 CCCTTAAATGTGAAGGAGGGAGG + Intergenic
1156526607 18:37774114-37774136 CTCCTCAAGGAGCTGGAGGAAGG + Intergenic
1157242583 18:46024976-46024998 CTCTTAGAAAAGATGGAGGAGGG - Intronic
1158596416 18:58820364-58820386 CTCTCAGAGGAGAAGGAGAAAGG - Intergenic
1159586655 18:70288980-70289002 CTCCTGGAGGAGGAGGAGGAAGG + Exonic
1159969258 18:74628821-74628843 CTTTTGAAGGACAAGGAGGGAGG - Intronic
1160611208 18:80086799-80086821 ATCTTCTAGGAGAAGCAGGATGG - Intronic
1162207989 19:9070330-9070352 CTCAGAATGGAGGAGGAGGAGGG + Intergenic
1163162120 19:15470938-15470960 CTCGAAAAGAAGAAGGAGGCCGG - Intronic
1163941862 19:20502491-20502513 GTCTTAAAGGAGAAAGAGAGAGG + Intergenic
1164526533 19:29017321-29017343 CCCTCCATGGAGAAGGAGGATGG - Intergenic
1164911118 19:32012724-32012746 CTTTTCAAGGACAAGGAAGATGG - Intergenic
1165730792 19:38143370-38143392 CACTGCAAGGAGGAGGAGGAAGG - Intronic
1166217326 19:41344226-41344248 CTTTTGAAGGCCAAGGAGGATGG - Intronic
1167691448 19:50986460-50986482 GTCTTGAAGGAGATGGTGGAGGG + Intergenic
1167732957 19:51272171-51272193 AAATTAAAGGAGGAGGAGGAAGG + Intergenic
1168282000 19:55310890-55310912 CTCATAAAGGAGAATGGGGTGGG + Intronic
1202682532 1_KI270712v1_random:20548-20570 ACCTGCAAGGAGAAGGAGGACGG - Intergenic
926766991 2:16330544-16330566 TTCCTAAAGCAGAAGGAGGTGGG - Intergenic
927144919 2:20157272-20157294 CTTTGAAAGGAGCAGGAGGGAGG + Intergenic
927246276 2:20959409-20959431 GGATTAAAGGAGAAGGAAGATGG - Intergenic
928165132 2:28965717-28965739 CTCTTAGAGAAGAGGGAGGTAGG - Intronic
929184108 2:39075226-39075248 CTGTTAAGGTAGAAGGAGGTAGG + Intronic
929625765 2:43405069-43405091 CATTTAGAGGGGAAGGAGGAGGG - Intronic
929818054 2:45251613-45251635 CAATGAAAGGAGAAGGAGGTTGG - Intergenic
930148391 2:48031732-48031754 CTCTCAAAGGACAAGCATGAGGG - Intergenic
930405916 2:50955421-50955443 CTCTTAAAGAAGGAGCATGATGG - Intronic
931182395 2:59915891-59915913 CTCTAAAAGGAGACTGTGGAGGG - Intergenic
931464262 2:62473106-62473128 CTCTTAATGGAGGAGAGGGAGGG - Intergenic
932010257 2:67970451-67970473 CTTTTAAAGGGAAAGGAGGCTGG + Intergenic
932260575 2:70323480-70323502 CTCTTAATGGAGAAGGGGTTGGG + Intergenic
932656839 2:73617872-73617894 CTCTTGAAGGAGAAGTAGAGAGG + Intergenic
932663511 2:73678148-73678170 CTCTTGAAGGAGAAGTAGAGAGG + Intergenic
933573057 2:84036086-84036108 ATCTTATAGGAGAATAAGGAGGG + Intergenic
933699191 2:85242578-85242600 CCATTCAAGGAAAAGGAGGAAGG - Intronic
933845561 2:86323713-86323735 CTCTTTAAGGAGAACAAGGTGGG + Intronic
934819233 2:97357568-97357590 CTCATAAGAGGGAAGGAGGAAGG + Intergenic
935037703 2:99395334-99395356 GTCTCAAAGGGAAAGGAGGAGGG - Intronic
935065180 2:99641166-99641188 CTCTGACAGGGGAAGGAGAAGGG - Intronic
935081356 2:99799396-99799418 TCCCTAAAGGAGAAGGGGGAGGG + Intronic
935593017 2:104857724-104857746 CTCTGAAATGGGAAGGAGGGGGG + Exonic
936607055 2:113969302-113969324 CCCTTAATGGAGCAGGAGTAGGG - Intergenic
937122484 2:119450586-119450608 TGCTCAAAGAAGAAGGAGGAAGG + Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938702506 2:133892350-133892372 TTCTTCAAGGAGATGGAGAAGGG - Intergenic
938757807 2:134396913-134396935 CTTGTAAAGGAGGAGGAGGCAGG + Intronic
939095596 2:137830203-137830225 CGCAGAAAGGAGAAGCAGGAAGG - Intergenic
939672497 2:145030306-145030328 CCCATAAAGGATAATGAGGAAGG + Intergenic
940687856 2:156876441-156876463 TACTGAAAGGAGAAGGAAGAAGG - Intergenic
940807707 2:158206507-158206529 CCCTGAAAGGGGATGGAGGAGGG + Intronic
941492476 2:166159466-166159488 CTGTTAAAGGAAAGGTAGGAAGG + Intergenic
941736930 2:168988112-168988134 CTCTTAAATGTGAATAAGGAAGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941943072 2:171064224-171064246 TTATTAAAGGGGAAGGAGAAGGG + Intronic
943566908 2:189526780-189526802 GTGTTGATGGAGAAGGAGGAGGG - Intergenic
943573532 2:189602882-189602904 ATTTGAAAGGAGAAGGAGGTTGG - Intergenic
943736062 2:191355853-191355875 CTCACAATGGAGATGGAGGATGG + Intronic
944468713 2:200030347-200030369 CTCTTAAAAGAGAAAGAGAAGGG + Intergenic
944858548 2:203792049-203792071 CTCTTGAAGGAGATGGAGTTGGG + Intergenic
945159384 2:206873692-206873714 CTGTTTAAAGAGAAAGAGGATGG + Intergenic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
946071744 2:217040002-217040024 CTCTAAAGGGACAGGGAGGAGGG - Intergenic
946220084 2:218218020-218218042 CTTTTAAAGGAGATGGGGGTGGG - Intronic
946496703 2:220202684-220202706 CTCTTCAAGAAGAAGGAAGCTGG - Intergenic
948056213 2:235010890-235010912 CTCTCCTAGGAGAGGGAGGAAGG - Intronic
948363951 2:237442591-237442613 CTCTGTAGGGAGAGGGAGGAAGG + Intergenic
948697620 2:239741006-239741028 ATCTCAAAGGAGGAGGAGGCTGG + Intergenic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
948736663 2:240012480-240012502 CACTTACAGGAGAGAGAGGAAGG + Intronic
1169133416 20:3180344-3180366 TTCTTAAAAGTGAAAGAGGACGG + Intergenic
1169251260 20:4063191-4063213 CTCTTAAAAAAAAAGGAGGTGGG - Intergenic
1170553740 20:17499070-17499092 CTCTTAGAGAAGAAGGGGGATGG - Intronic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1173900384 20:46583447-46583469 CAGTGAAAGGAGAAGCAGGAAGG + Intronic
1173952772 20:47006326-47006348 TTCACAAAGGAGAAGGAGGCAGG + Intronic
1174549858 20:51354636-51354658 CTCTTTAAGGAGCATGAGGAAGG - Intergenic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1176294547 21:5064420-5064442 CTCTTGGCGGAGAAGAAGGAGGG - Intergenic
1176362059 21:6006177-6006199 CTCCAAAAGGAGGAGGAGGAGGG + Intergenic
1176794799 21:13363617-13363639 ATCATACAGGAGAAGGAGGCAGG - Intergenic
1178260999 21:31099555-31099577 ATCTTAGAGGTGAGGGAGGAAGG - Intergenic
1178350784 21:31872287-31872309 CTTGTGAGGGAGAAGGAGGAGGG - Intergenic
1179241574 21:39597644-39597666 CTCTTAAAGATGAAAGAGGGAGG + Exonic
1179761459 21:43532368-43532390 CTCCAAAAGGAGGAGGAGGAGGG - Intronic
1179862505 21:44197706-44197728 CTCTTGGCGGAGAAGAAGGAGGG + Intergenic
1180164840 21:46019705-46019727 CTCTAAAAGGAGAGGGCTGAAGG - Intergenic
1181552717 22:23649861-23649883 GTCTTAAGGGAAAAAGAGGATGG + Intergenic
1181609791 22:24004705-24004727 CTTTTCGAGGAGAAGGGGGAAGG - Intergenic
1181746324 22:24957235-24957257 GTCTTAAAGGATGAGTAGGAGGG + Intronic
1183413396 22:37668609-37668631 CTTTTAAAGGACATAGAGGAGGG + Intergenic
1183662316 22:39228590-39228612 CTCTTAAAAAAGAAAGAGGCTGG + Intronic
1184418293 22:44364561-44364583 CTGCTTAAGGAGAAGGATGAGGG + Intergenic
1185079781 22:48703331-48703353 CACCTGAAGGAGAAGAAGGAAGG - Intronic
949165325 3:933670-933692 GAGTTAAAGGAGAGGGAGGATGG + Intergenic
949388637 3:3534921-3534943 TTATTTAAGGAGAATGAGGAAGG - Intergenic
949694480 3:6678632-6678654 CTCATAAAGGAGAGGGGAGAGGG - Intergenic
950081280 3:10224021-10224043 TTCTTAAAGGAGAAGGAGCCTGG - Intronic
950260838 3:11542684-11542706 ATCTTAAAGGAGGAGCAAGAGGG - Intronic
950313809 3:11982667-11982689 CCCTTTAAGGAGAAGGAGTGTGG - Intergenic
950386827 3:12666597-12666619 CTCTTAAAAAAGAAGAAGAAAGG + Intergenic
950459210 3:13111255-13111277 CTCTCTAATGAGAAGCAGGAAGG - Intergenic
952053407 3:29413983-29414005 TTCTGAAAGGAGAAAGAGGGTGG - Intronic
953344263 3:42161810-42161832 GTCTTGAAGGAGATGGGGGAGGG + Intronic
953405727 3:42658917-42658939 TTCTTTAAGGAGGAGAAGGAGGG + Exonic
953663719 3:44910123-44910145 CTCAGAACTGAGAAGGAGGAAGG - Exonic
954690098 3:52391170-52391192 CCCTTACAGGAGAAGGACAATGG + Exonic
954858571 3:53667894-53667916 TTCATAAAGAGGAAGGAGGAAGG + Intronic
954861919 3:53697305-53697327 CTCCTGAAGGAGTAGGAGTAGGG + Intronic
957202609 3:77156168-77156190 ATTTGAAAGGAGAAGGAGAATGG - Intronic
958735853 3:98008740-98008762 CTGTTAAAGGAGAAGGTTCAGGG - Intronic
959518218 3:107294802-107294824 CTCACAAACTAGAAGGAGGATGG - Intergenic
961360519 3:126364505-126364527 TTCTTGAAGGAGCAGGAGGGAGG - Intergenic
961864319 3:129942524-129942546 AGCTGAAAGGAGATGGAGGAGGG + Intergenic
963538012 3:146552384-146552406 CACTTAATGGAGAAGGAGGCTGG + Intergenic
964080306 3:152746206-152746228 CTCTTAAAGGAAAGTGAAGAGGG + Intergenic
964185298 3:153935023-153935045 TGCTTAAAGGAGATGGAGAATGG - Intergenic
965888840 3:173484607-173484629 CTCTAAAAGGAGAATGAAGATGG + Intronic
966185609 3:177224029-177224051 CTCATAAATAAGAAGGACGAAGG - Intergenic
966418142 3:179710303-179710325 CCCTAAAAGGACAAGGAGAAGGG - Intronic
966449797 3:180045236-180045258 CACTTGAAGGAGAAGAAGGAAGG - Intergenic
966953661 3:184849713-184849735 ATCTAAAGGGAGAAGTAGGATGG + Intronic
967376330 3:188807011-188807033 CTCTTCAAGCAGAAGGAATACGG - Intronic
967899495 3:194434994-194435016 TTCTCAATGGGGAAGGAGGAGGG + Intronic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
969235276 4:5861240-5861262 TTCTTAAAGGAAAAGTAGAATGG + Intronic
970560693 4:17279352-17279374 CTCTATAAGGAGAAGGAGATGGG - Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971192305 4:24439183-24439205 CTCTTAAAGAAGGAGAAGGATGG - Intergenic
971806650 4:31367007-31367029 CTCTGTAAGATGAAGGAGGAAGG + Intergenic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
973052198 4:45610097-45610119 CTCTTTAAGGATAATGTGGACGG - Intergenic
973303585 4:48617630-48617652 GTGTTAAAAGAGGAGGAGGAGGG + Intronic
974060896 4:57034389-57034411 CTCTTAAAGGAGATCTGGGATGG - Intronic
975436411 4:74357601-74357623 TTCTCAAAGGAGAAGGAGGTGGG - Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976010583 4:80483111-80483133 TTCTTAAAGGTGGAGGAGGGGGG + Intronic
976027903 4:80713203-80713225 ATCTTAAAGTAAAAAGAGGAAGG + Intronic
976151715 4:82099154-82099176 CTCTCCAAGAAGAAGGTGGAGGG - Intergenic
978574645 4:110177028-110177050 CTCTTAAATGACAAAGAGGCCGG - Intronic
978957696 4:114634425-114634447 CTCTCCAAGGAAGAGGAGGAGGG + Intronic
980003553 4:127516181-127516203 CTCCTAAGGGTGAAGGAGAAGGG + Intergenic
980018871 4:127683940-127683962 CTCTTAATTGAAATGGAGGATGG - Intronic
981018474 4:140000631-140000653 TTCCTAAAGGAGAAGAAGAATGG + Intronic
981228994 4:142331172-142331194 CTTTTAAAGGACAAGGATGGAGG + Intronic
981295430 4:143125856-143125878 CTCTGGAAGGTGGAGGAGGAAGG - Intergenic
981816426 4:148835877-148835899 CCCAGAAAGGAAAAGGAGGATGG - Intergenic
983452126 4:167923856-167923878 CTGTTAAGGGTGAAGGAGAAGGG - Intergenic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
984044976 4:174785768-174785790 CTCTTAAAAAAGAAGAAGAATGG - Intronic
984364833 4:178785135-178785157 CTTTTGAAGAAGAAGTAGGAAGG - Intergenic
986106297 5:4662551-4662573 TTGTTACAGGAGAAGGAGCAAGG + Intergenic
986291997 5:6407589-6407611 CTCTGGAAGGAGAAGAGGGAAGG - Intergenic
986555780 5:9008693-9008715 CTGCTAAGGGTGAAGGAGGAGGG + Intergenic
986594661 5:9408917-9408939 CTCTCAGAGGAGAGGGAGGCTGG - Intronic
988692900 5:33590527-33590549 CTCATAAGGCTGAAGGAGGAAGG - Intronic
990196236 5:53319611-53319633 TTCCTGAAGGAGGAGGAGGATGG - Intergenic
990807850 5:59686800-59686822 CTCTTAAGTGAGAAAGATGATGG + Intronic
991437759 5:66614043-66614065 CACTTAAAGGAGAAGGTGCTAGG + Intronic
991599918 5:68341961-68341983 CTCTTCCAGGAGAAGGGGTAAGG + Intergenic
991960058 5:72035354-72035376 CTTTGAAAGAAGGAGGAGGAGGG - Intergenic
992235238 5:74702372-74702394 GTCTTAAAAGACAAGGAGGCCGG - Intronic
992454303 5:76902120-76902142 CTCTTCAAGCAGAAGGAAGGGGG + Intronic
993220772 5:85094193-85094215 CTCTTGATGGAGAAGGTGCAAGG - Intergenic
993531571 5:89031166-89031188 CTCTGAAAGGAGTAAGGGGAAGG + Intergenic
993933492 5:93971980-93972002 CTCTGAATGGACAAGGACGAGGG + Intronic
994665930 5:102705237-102705259 CTCATATGGCAGAAGGAGGAAGG - Intergenic
997373223 5:133376126-133376148 CTCTCAAAGAAGAAGGACAAGGG + Intronic
997436724 5:133880984-133881006 CACTTAAAGCAGAAGGAGATGGG - Intergenic
997632541 5:135379721-135379743 CACTGAAAGGAGAAGGAAGAAGG - Intronic
997691670 5:135831582-135831604 GTCTTAAAGAAGAAGGGGGCAGG + Intergenic
998901484 5:146860138-146860160 CTATAAAAGGAAAAGCAGGATGG - Intronic
1001710030 5:173771180-173771202 GTCTCACAGGAGAAGGGGGAGGG - Intergenic
1001804776 5:174574014-174574036 CTCATTAAGGAGAAGGGAGAGGG + Intergenic
1002351763 5:178588947-178588969 CTATCCCAGGAGAAGGAGGAAGG + Intronic
1002829312 6:804803-804825 CTGTTAACAAAGAAGGAGGAAGG - Intergenic
1003335584 6:5168899-5168921 GTGATAAAGGAGAGGGAGGAGGG + Intronic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1004829178 6:19458805-19458827 TTTTTAAAGGAGGAGGAGGAAGG + Intergenic
1006635712 6:35459889-35459911 CTCATAAAGGAGAAAGAGGATGG - Intronic
1007239784 6:40416725-40416747 CCCTAGCAGGAGAAGGAGGAAGG - Intronic
1007947346 6:45838318-45838340 GTCCTGCAGGAGAAGGAGGAGGG - Intergenic
1008834682 6:55811187-55811209 ATCTTAGAGAAGAAGGAGGCAGG + Intronic
1010070304 6:71736693-71736715 CTCTTAGAGTAGAAGGTGCATGG + Intergenic
1010113289 6:72269059-72269081 CTCTGAAAGGCCAAGGAAGAAGG - Intronic
1010991208 6:82482316-82482338 CTCTCAAGAGAGAAGGAGGAAGG - Intergenic
1011401972 6:86973158-86973180 ATTTAAAAGGAGAAGGTGGAGGG - Intronic
1011403787 6:86994180-86994202 CTCATAAGGGAGAAAGAAGACGG + Intronic
1011486965 6:87852840-87852862 CTATTAAAGGGGAAGAAGGGAGG - Intergenic
1012994090 6:105956477-105956499 CTCTGCAAGTAGTAGGAGGAAGG + Intergenic
1013576720 6:111490822-111490844 ATCTTTAAGGAGAAGGTAGAAGG + Intergenic
1014366286 6:120546535-120546557 ATCTTAAATGGTAAGGAGGAAGG + Intergenic
1014496373 6:122128549-122128571 CTCTTAAAGGATAAGTAGATTGG - Intergenic
1014551220 6:122790909-122790931 CTACTAAAGGGGAAGGAAGAGGG + Intronic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016402327 6:143694068-143694090 ATCTTAAAGAAAAAGAAGGAAGG + Intronic
1017478441 6:154824326-154824348 CTCTTAAAAAAGGAGGTGGAGGG - Exonic
1018650194 6:165986584-165986606 TACTTGAAGGAAAAGGAGGAAGG - Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019362587 7:612594-612616 CTATTAGAGGAGAGGAAGGAAGG + Intronic
1019397533 7:830093-830115 CTGTTAAGGGGGAAGGAGGAAGG + Intronic
1019776591 7:2915236-2915258 CTCTTGACTGAGAAGCAGGAAGG - Exonic
1022186262 7:27972413-27972435 CTCTTTTAGGGGAAGGAGGATGG + Intronic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022971164 7:35518608-35518630 CTCTTGAAGAAATAGGAGGATGG - Intergenic
1023420851 7:39977999-39978021 GTATTTAAGGAGAAGGAGGGTGG + Intronic
1024387810 7:48773613-48773635 CTGTCACAGGAGAAAGAGGATGG - Intergenic
1026741557 7:72981859-72981881 CTCTGAAAGGGGAGGGAGAAGGG + Intergenic
1026801391 7:73402243-73402265 CTCTGAAAGGGGAGGGAGAAGGG + Intergenic
1027102178 7:75383219-75383241 CTCTGAAAGGGGAGGGAGAAGGG - Intergenic
1027539357 7:79449254-79449276 CTTTGAAAGGAGCAGTAGGAGGG + Intronic
1028623038 7:92845549-92845571 CCCTTGAAGGTGAAGGAGGCTGG - Intergenic
1028941482 7:96526729-96526751 CTCTGAAAGGAGAAAGGAGAGGG - Intronic
1029379361 7:100202695-100202717 AGCTTAAAGGAGAAGTAGGAGGG + Intronic
1030400900 7:109048965-109048987 GTCTTAAATCAGAAGGAGGCAGG - Intergenic
1030619224 7:111771250-111771272 TTCTTAAAAGAGATGGAGGTGGG - Intronic
1030704593 7:112678381-112678403 CTCTTAAAAGAGGACGAGGTGGG + Intergenic
1031217796 7:118919895-118919917 CACTGAAAGGAGTAGGAGGTTGG + Intergenic
1031994561 7:128221050-128221072 CTCACAAAGAAGGAGGAGGAGGG - Intergenic
1032048796 7:128632984-128633006 ATCTTATAAGAGAAGGAGGTAGG + Intergenic
1032131733 7:129234600-129234622 CTTTCAAAGGCCAAGGAGGAAGG - Intronic
1032349761 7:131149987-131150009 AACTTAAAGGAGAAGGAAGAGGG - Intronic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1033286586 7:140046617-140046639 GTCTGAAAGGAGAGGGAGGTGGG + Intronic
1034746018 7:153524512-153524534 CTCTCCAAGGAGGAGGTGGAGGG + Intergenic
1035165636 7:156988100-156988122 CCCTTAAACGAGAGGGTGGAGGG + Intergenic
1035226023 7:157432632-157432654 TCCTTAGAGGAGAAGGGGGAGGG + Intergenic
1035341491 7:158165418-158165440 CTCTTGGAGGAGAAGGACGGCGG - Intronic
1036116784 8:5967697-5967719 CACTTGAAGGAGAAAGAGGAGGG - Intergenic
1037903300 8:22700876-22700898 GTCTTCAGGGAGAAGGAGGAGGG + Intergenic
1038060513 8:23907257-23907279 CTCTTCAAGGGGAAGGTAGAAGG - Intergenic
1038893676 8:31756349-31756371 CTGTTAAGGGCAAAGGAGGAAGG + Intronic
1040071402 8:43191694-43191716 GCCTCAAAGGAGAAGGAAGAGGG - Intronic
1040079139 8:43270187-43270209 CTCTTAAAGGTGAAGCAGGGTGG - Intergenic
1041153290 8:54958060-54958082 CTCTTGAAGGGAAAGGAGGATGG - Intergenic
1041158096 8:55008761-55008783 CTTGTAAGGGAGAAAGAGGAAGG - Intergenic
1041746916 8:61217356-61217378 CTTTAAGGGGAGAAGGAGGAGGG + Intronic
1042295832 8:67216601-67216623 CACTTACAGGAGATGGAGGTGGG + Exonic
1042640834 8:70932469-70932491 CTGTTAGAAGAGAAGGAGGTAGG + Intergenic
1043305179 8:78784871-78784893 CTTTTCAAGGAGAAGATGGAGGG - Intronic
1043590896 8:81832407-81832429 CTCCTAGTGGAGAAGGATGAAGG + Intronic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1044148697 8:88746844-88746866 CTGTTAAGGGTGAAGGAGAAGGG + Intergenic
1044455549 8:92388797-92388819 TCCTTAAAGGAAAAGGAGGTAGG - Intergenic
1045197265 8:99944670-99944692 CTGTTAAGGGTGAAGGAGAAGGG - Intergenic
1045700282 8:104858496-104858518 ATCTTAAAGGAGAAGTACAAGGG - Intronic
1046774926 8:118153761-118153783 CTTTTGAAGGATATGGAGGAAGG - Intergenic
1047064941 8:121271331-121271353 CTTTTAAAGAAATAGGAGGATGG + Intergenic
1048285433 8:133137605-133137627 CTCTAAGAGGAGGAAGAGGAAGG + Intergenic
1048937228 8:139367320-139367342 CTCTAAAAGTTAAAGGAGGATGG + Intergenic
1049508559 8:143016464-143016486 CTCAGAAAGCAGGAGGAGGAGGG + Intergenic
1050085307 9:1959140-1959162 CTCTCAGAGGATAAGTAGGATGG + Intergenic
1050609594 9:7337640-7337662 TTTTTAAAGGAGAAGGTAGATGG + Intergenic
1050923353 9:11233872-11233894 CACTTAATGGAGAGGGAGAATGG + Intergenic
1051198637 9:14592335-14592357 ATTTTAAAAGAGAAAGAGGAAGG - Intergenic
1052501633 9:29299121-29299143 ATCTCAAAGGAGCAGTAGGAAGG - Intergenic
1052525883 9:29619526-29619548 TTCTTAATGGAGTGGGAGGATGG + Intergenic
1053272228 9:36758386-36758408 CTCTTAAACAAGCAGCAGGAGGG + Intergenic
1053887427 9:42654574-42654596 ATCATACAGGAGAAGGAGGCAGG + Intergenic
1054226449 9:62462025-62462047 ATCATACAGGAGAAGGAGGCAGG + Intergenic
1055527783 9:77152745-77152767 CTCTCAAAGAAGAAGAAAGAAGG - Intergenic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1056095378 9:83248059-83248081 CTCCAAAAGGAGGAGGAGCAGGG + Exonic
1056277094 9:85003970-85003992 CTATTTAAGGAGAAAGAAGAAGG + Intronic
1056486297 9:87061561-87061583 ATTTTAAAGGAGAAGGTGAAAGG - Intergenic
1057303290 9:93898748-93898770 CTCTTCTAGGGGAAGAAGGAGGG + Intergenic
1057364255 9:94404038-94404060 CTCACAAAGCAGAAGGTGGAAGG - Intronic
1057659079 9:96984033-96984055 CTCACAAAGCAGAAGGTGGAAGG + Intronic
1059275431 9:113092702-113092724 CTTTTAAAGGACAAGGTGGGTGG + Intergenic
1059385328 9:113959903-113959925 CGTTTAAAGGAGAAGGGGGCCGG - Intronic
1059493679 9:114691520-114691542 CTTTTGGAAGAGAAGGAGGAAGG + Intergenic
1059740139 9:117142050-117142072 ATCTGAAACGAGAAGGAGCACGG + Intronic
1060490667 9:124081834-124081856 CACTTACTGGCGAAGGAGGATGG + Intergenic
1060612877 9:124984404-124984426 CACTTACAGGAGAGCGAGGAAGG + Intronic
1062622999 9:137431000-137431022 CTCTTCAAGGTTCAGGAGGAGGG + Intronic
1185890426 X:3817024-3817046 CTCTAAAAAGAGGAGAAGGAGGG - Intergenic
1186004677 X:5056301-5056323 CTCTGAAAAGAGGAGGAGGCTGG - Intergenic
1186652569 X:11577039-11577061 CTCTCATAGGTGAAGGAGGGAGG - Intronic
1188128778 X:26404189-26404211 ATGATAAAGGAGAAGGAGCAAGG + Intergenic
1188524539 X:31075010-31075032 CTCTCTGAGGAGAAGGAGGCAGG + Intergenic
1188894219 X:35646240-35646262 GTCTTCAAGGAGAAGGGAGAAGG + Intergenic
1189207503 X:39254437-39254459 CTAGAAAAGGAGGAGGAGGATGG + Intergenic
1190171003 X:48111627-48111649 CTGTAAATGGAGAAGGAGCAGGG + Intergenic
1191952998 X:66614928-66614950 ATTTTGAAGGAAAAGGAGGAAGG - Intronic
1192221067 X:69197658-69197680 CTATTAAAAGAGAAGGAAGTGGG - Intergenic
1193964368 X:87966578-87966600 CTCATAAGGGAGAAGGTGGGAGG + Intergenic
1195551849 X:106180442-106180464 CTCTCAAAGGAGTAGGAAGATGG - Intronic
1195901190 X:109799115-109799137 CTCTAGAAGGGGAAGGAGTAGGG - Intergenic
1196061262 X:111410606-111410628 ATCTTAATAGAGAAGAAGGAGGG + Intronic
1196484084 X:116183893-116183915 CACAGAAAGGAGAAGGAGAAAGG + Intergenic
1196583469 X:117402402-117402424 CTCAAAATGGAGAAGGAAGATGG - Intergenic
1196685003 X:118503451-118503473 TTCTTAAAAGGGAAGGAGAAGGG + Intronic
1197401604 X:125998699-125998721 GTCTACCAGGAGAAGGAGGAAGG + Intergenic
1198272755 X:135070070-135070092 CTCTTAAAGAAACAGGAGGAAGG + Intergenic
1198504741 X:137290336-137290358 CTGTAAAAGGAAATGGAGGAGGG + Intergenic
1198651737 X:138870669-138870691 CTCTTAAAATAAAATGAGGAAGG + Intronic
1198831952 X:140760167-140760189 CTCTTTAAGGAAAACAAGGAAGG + Intergenic
1199833553 X:151566389-151566411 CTCTGGAAGGAGAAGGCAGAGGG + Intronic
1199849869 X:151717840-151717862 CTCTGAGAGGAGGAGGCGGACGG + Intronic
1200957400 Y:8964931-8964953 CTCTAAAATGAGTAGGAAGATGG + Intergenic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic