ID: 1102419844

View in Genome Browser
Species Human (GRCh38)
Location 12:112794842-112794864
Sequence CAGGCTGGACTGGGGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 377}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102419844_1102419853 -8 Left 1102419844 12:112794842-112794864 CCCTACTCCCCCAGTCCAGCCTG 0: 1
1: 0
2: 3
3: 32
4: 377
Right 1102419853 12:112794857-112794879 CCAGCCTGAGGTACAGAGGAAGG 0: 1
1: 0
2: 16
3: 340
4: 3539
1102419844_1102419855 24 Left 1102419844 12:112794842-112794864 CCCTACTCCCCCAGTCCAGCCTG 0: 1
1: 0
2: 3
3: 32
4: 377
Right 1102419855 12:112794889-112794911 AGTGTCTCTCCAGCCCGTGCTGG 0: 1
1: 0
2: 1
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102419844 Original CRISPR CAGGCTGGACTGGGGGAGTA GGG (reversed) Intronic
900167075 1:1248105-1248127 GAGGCTGGACTGAGGGAGGCTGG + Intergenic
900415903 1:2534548-2534570 CAGGCTGACCTGGGGAAGGAGGG + Intergenic
900976553 1:6020393-6020415 CAGGCTGGATTGGGGGCAGAAGG - Intronic
901016945 1:6237268-6237290 CAGGCTGGAGTGCGGCAGTCTGG + Intergenic
901464755 1:9413899-9413921 GAGGCTGGACTGGAGAAGTTGGG + Intergenic
901602129 1:10430587-10430609 CGGGCTGGGCTGGGGCAGGACGG + Intronic
902123806 1:14191439-14191461 CAGGCTTGAATGGGGAAGTAAGG + Intergenic
902546593 1:17194261-17194283 CAGGCAGGGCTGGGGGAGACAGG - Intergenic
902784481 1:18724202-18724224 CAGCCTCGACTGGTGGAGTGGGG - Intronic
902984720 1:20148569-20148591 GGGGCTGGGCTGGGGGAGTCAGG - Exonic
903136633 1:21313555-21313577 CAGGTGGGAGTGGGGGAGCAGGG + Intronic
903165154 1:21515046-21515068 CAAGCTGGAGTGGAGGAGGAGGG - Intronic
903661182 1:24979820-24979842 CAGGCTGGGCTGGGCCAGCATGG + Intergenic
904239054 1:29132284-29132306 CAGGCTGGACCTTGGGAGTTGGG + Intergenic
904353550 1:29924325-29924347 CTGGCTGGAGTGGGGGAGTGGGG - Intergenic
904613203 1:31736382-31736404 CAGGCAGACCTGGGGGAGCAGGG + Exonic
904625611 1:31800225-31800247 CAGGGTGGACTGGAGGAGGGAGG - Intronic
904771644 1:32884495-32884517 GAGGCTGAACTGGGGAAGTGGGG + Intergenic
905156185 1:35984513-35984535 ATGGCTGGATTGGGGGAGAAGGG - Intronic
906167736 1:43699764-43699786 CAGGCTGGAGTACGGGAGTACGG + Intronic
906520005 1:46461283-46461305 CAGGCTTGACTCGGGGACTAGGG - Intergenic
906638344 1:47425400-47425422 GAGGCTGGACTTGGGGTTTAGGG + Intergenic
912207334 1:107523199-107523221 CAGGTTGGGGTGGGGGAGTGTGG - Intergenic
915318915 1:155045377-155045399 CAGGGTGTATTGGGGGAGGATGG + Intronic
916677088 1:167073247-167073269 CAGGCTGGAGTGGGTGGGGAGGG - Intronic
918929672 1:190838117-190838139 CAGGCTGGACTGTGTAAGAACGG - Intergenic
919774307 1:201184115-201184137 TAGGCTGGCCAGGGGGAGTGAGG + Intergenic
920693317 1:208163371-208163393 CAGCCTGGGCTGGGGGAGGGAGG + Intronic
921030061 1:211328525-211328547 CCCGCTGGACTTGGGTAGTAGGG + Intronic
922216855 1:223526767-223526789 GAGGCTGGACTGGGGACGTGGGG + Intergenic
922233365 1:223705013-223705035 GTGGATGAACTGGGGGAGTATGG - Intronic
922569883 1:226628197-226628219 CCAGCAGGACTGGGGGAGTTGGG - Intergenic
923242262 1:232097368-232097390 CTGGCTGCCCTGGGGGAGGAAGG + Intergenic
924362505 1:243255807-243255829 CAGGCTGGGCTGGAGGAAAAGGG + Intergenic
1063361895 10:5466306-5466328 CAGACTTGCCTGGGGGAGGAGGG - Intergenic
1063461073 10:6215377-6215399 AAGGCTGGGCTGCAGGAGTAAGG + Intronic
1064330273 10:14387388-14387410 CAGGCTGGAGTGCTGGAGTGCGG - Intronic
1065529352 10:26653117-26653139 CAGGCTGGACTTGGGGCCTTGGG - Intergenic
1065972837 10:30818699-30818721 CAGACTGGACTGGCGGGGAAAGG + Intergenic
1067357367 10:45542300-45542322 CAGGCTGGAGTGCGGTAGGACGG - Intronic
1067781698 10:49212425-49212447 GAGGCAGGAGTGAGGGAGTAGGG - Intergenic
1067904382 10:50275586-50275608 CAGTCTGCACTGGGTGGGTATGG - Intergenic
1068436671 10:57001263-57001285 CAGGGTGGAGTGAGAGAGTAAGG - Intergenic
1070056388 10:72939074-72939096 CAAGCTGGGCAGGGGGAGTTTGG + Intronic
1070287177 10:75092645-75092667 CAGGCTGCCCTGGGTGAGTGTGG + Intergenic
1070331629 10:75421665-75421687 CAGGGTGGACAGGGTGATTAGGG + Intergenic
1070829098 10:79407837-79407859 AAGCCTGGATTGGGGGAGAAAGG + Intronic
1072190777 10:93074689-93074711 CTGGCAGGACTGGGGGTGTCTGG + Intronic
1074114625 10:110446387-110446409 CAGGCTGGATTGGAGGTGGACGG - Intergenic
1075271263 10:121053826-121053848 CAGGCTGAAGGGCGGGAGTAGGG - Intergenic
1075819415 10:125293151-125293173 CAGGCTGGGCTGGGGGCTTTTGG + Intergenic
1075936988 10:126351183-126351205 CAGGGTGGGGTGGGGGAGCAGGG - Intronic
1076764947 10:132627889-132627911 CAGGCTGGAGTGGCGGCGTCGGG + Intronic
1076790491 10:132774670-132774692 CAGGCTGGGCTGGGTAGGTAGGG - Intronic
1077316183 11:1920374-1920396 GGGGCTGGACTGGGGCAGGACGG + Intronic
1077461990 11:2715367-2715389 CAGGCAGGAGTGGGGCAGGAGGG + Intronic
1078105468 11:8355555-8355577 CAGGCTGGACAAGGAGAGGAAGG - Intergenic
1078501504 11:11883679-11883701 CAGTCTGGAGTGAGTGAGTAGGG + Intronic
1081753871 11:45531103-45531125 CAGGCTGGAGTGAGAGAGGAGGG + Intergenic
1081992744 11:47346522-47346544 CAGGCAGGACTGGGGGCCAAGGG + Intronic
1081997640 11:47375589-47375611 CAGGCTGGGCTGGGGGATGGGGG + Intronic
1083181533 11:60988919-60988941 CAGGCTGGAGGAGGGGAGTGAGG - Intronic
1083618960 11:64039605-64039627 CAGGCTGTCCGGGGGGAGGAGGG - Intronic
1083895867 11:65619474-65619496 CAGACAAGGCTGGGGGAGTAAGG - Intronic
1083956186 11:65984176-65984198 CAGGCTGGTCAGGGTGAGTAGGG + Intergenic
1084480224 11:69415765-69415787 CTGGCTGCAGTGGGGGAGTCTGG - Intergenic
1084680184 11:70662399-70662421 CAGGCTGGGCTGGGAGAGGGCGG + Intronic
1085024424 11:73228299-73228321 CAGCCTGGGATGGGGGAGCAGGG - Intronic
1085346516 11:75771555-75771577 CAGGCTGGGGTGGGTGAGGATGG + Intronic
1086341013 11:85848193-85848215 CAGGCTGGAATGCAGCAGTATGG - Intergenic
1089491073 11:118884611-118884633 CAGGCTGGAGTCAGGGAGCAGGG + Intronic
1089541742 11:119193434-119193456 AAAGCTGGACTGGGGGAGGTAGG - Intronic
1089766762 11:120773528-120773550 CAGCCTGGAGTGGGGAAGTGGGG + Intronic
1089771920 11:120809170-120809192 CAGGCTGGACAGGGGTGGTGGGG - Intronic
1090036120 11:123251150-123251172 CAGGATGGACTAGGGGAGTGCGG + Intergenic
1090320346 11:125837819-125837841 CAGGCTGGATTGTGGGACAATGG - Intronic
1091754114 12:3040699-3040721 CGGGAGGGACTGGGGGAGCAAGG + Intergenic
1091774383 12:3174956-3174978 CAGGCAGGGCAGGGGGTGTAAGG - Intronic
1094742936 12:33310407-33310429 CAGGCTGGAGTGGGGCAACAGGG + Intergenic
1095187341 12:39215960-39215982 TAAGCTGGGCTGGGGGAATACGG + Intergenic
1096071209 12:48776418-48776440 GAGGCCGGGCTGGGTGAGTAGGG - Exonic
1096478868 12:51924775-51924797 AAGGCAGGACTGAGGGAGGATGG - Intergenic
1096653550 12:53074511-53074533 GAGGCTGGACTGGAGGAGATGGG + Intronic
1096827272 12:54289343-54289365 CAGGCTGGAGTGCAGCAGTAGGG - Intergenic
1097188450 12:57208301-57208323 CAGGCTGGCCTGGGAGGGAAGGG - Intronic
1097246886 12:57611776-57611798 CAGCCTGGACCGGGGTAGGAGGG + Intronic
1097921979 12:65085727-65085749 TGGGCTGGACTGAGGGAGTGAGG + Intronic
1099888084 12:88556380-88556402 AAGGATGGACTGGGGGAGAGAGG + Intronic
1100811498 12:98343196-98343218 CATATTGGACTGGGGGAGTTGGG + Intergenic
1102419844 12:112794842-112794864 CAGGCTGGACTGGGGGAGTAGGG - Intronic
1102852689 12:116264787-116264809 CAAGCAGGAATGGGGGAGTAGGG - Intronic
1103810775 12:123611774-123611796 CAAGCTGGACTGGGTGAGGGAGG + Intronic
1103870135 12:124085448-124085470 GACGCTGGACTGGGGGAACAGGG + Intronic
1104856725 12:131905643-131905665 CAGGCTGGGCTGGAGGAGCAAGG - Intronic
1104988617 12:132611524-132611546 CAGGCAGGGCTGGGGGAACAAGG + Intergenic
1105410184 13:20165033-20165055 CAGGCTGGAGTGGAGGGGCATGG - Intergenic
1106203519 13:27566279-27566301 CAGGCTGCAATGTGGGAATAAGG + Intronic
1107276914 13:38688418-38688440 CAGGCTGGAATGGAGAAGTAAGG - Exonic
1107373626 13:39778741-39778763 AAGGCTTGACTGGGGCAGGAGGG + Intronic
1108214450 13:48170561-48170583 CAGGCTGGAGTGTGGTAGTGTGG - Intergenic
1112441400 13:99427048-99427070 GAGGGTGGAAGGGGGGAGTAGGG + Intergenic
1117584417 14:57185616-57185638 CAGCCTTGTCTGGGGGAGAATGG - Intergenic
1118323207 14:64765271-64765293 CAGGCTGCACTGGGGGCCAAGGG - Intronic
1118825623 14:69377998-69378020 CAGGCTGGGTTGGGGGAGAGAGG - Intergenic
1119510029 14:75203759-75203781 CAGGCTGGGCTGGCGGAGAATGG + Intergenic
1119763813 14:77175361-77175383 CAGGCTGGAGTGCAGTAGTACGG + Intronic
1120368241 14:83598020-83598042 CAGACTGGGCAGGGTGAGTAGGG + Intergenic
1120782052 14:88494184-88494206 CAGGCTGCAATGAGGGAGCAAGG + Intronic
1122045838 14:99022700-99022722 CATGCTGGACTTGGGGAGACAGG + Intergenic
1122292713 14:100688214-100688236 GAGGCTGGAATGGGGGACCAAGG - Intergenic
1122694851 14:103547542-103547564 CAGGCTGGACGGCTGGAGCAAGG - Intergenic
1122924934 14:104895132-104895154 GGGGCTGGACAGGGTGAGTAGGG - Exonic
1124465576 15:29936386-29936408 CAGGCTGGACCGGGGAAGGCAGG - Intronic
1124498129 15:30200448-30200470 CAGGCTGGAGTGGAGTAGCATGG + Intergenic
1124745453 15:32338222-32338244 CAGGCTGGAGTGGAGTAGCATGG - Intergenic
1125756603 15:42069556-42069578 CAGCCTGGGCTGGGGAAGGATGG + Intronic
1125967616 15:43886950-43886972 CAGGCAGGGCTGGGTGGGTAGGG + Intronic
1126338494 15:47613688-47613710 CAGGCTGGAGTGCTGGAGTGTGG + Intronic
1127202008 15:56664443-56664465 CATGGTGAACTGGGGGAGAAAGG + Intronic
1128060505 15:64732515-64732537 CAGCCTGGAGTGTGGGAGTCTGG - Intergenic
1128072473 15:64806508-64806530 CAGGCTGGACTGGGGGCTGGGGG - Intergenic
1128237312 15:66077140-66077162 CAGGCTGGACTGGTGGGCCAGGG - Intronic
1128264394 15:66254164-66254186 CAGGAGGGAAAGGGGGAGTAGGG - Intergenic
1128726630 15:69992705-69992727 CAGGCTGGAGTGAGTGAGGAGGG - Intergenic
1129121400 15:73399042-73399064 CAGTCTGGAGTGTGGGAGGAGGG + Intergenic
1129735065 15:77955762-77955784 CAGGCTGGACTGCAGTGGTAGGG + Intergenic
1130303090 15:82695139-82695161 CAGGCTGGAGTGGTGCAGTGAGG + Intronic
1131022404 15:89110126-89110148 CAGGCTGGAGTGTGGTAGTGTGG + Intronic
1131097985 15:89667785-89667807 CAGGCTGCTCTGAGGGAGGATGG + Exonic
1132404912 15:101536268-101536290 CAGGCAGCACTGGGGGTGTGGGG + Intergenic
1132465963 16:77656-77678 CAGGCTGGTCGGGGGAAGGAAGG - Intronic
1132676660 16:1123871-1123893 CAGGCTGGACTGTGGGGCTGGGG + Intergenic
1132804869 16:1770824-1770846 CAGGCTGAACAGGGGGAGGCCGG + Intronic
1135178646 16:20253736-20253758 AAGATTGGACTGGGGGAGAAGGG + Intergenic
1137701667 16:50502213-50502235 CAGGCTGACCTGGAGGAGAAGGG + Intergenic
1138434378 16:56989127-56989149 CAGGATGAACTAGGGGAGAAGGG - Intergenic
1138613716 16:58147764-58147786 CAGGCAGCACTGAGGGAGGAGGG - Intergenic
1139358917 16:66384382-66384404 AAGGCTGGACTCGGGGGGCATGG - Intronic
1139479992 16:67225493-67225515 GAGACTGGACTGGGGAAGTTTGG - Intronic
1139958387 16:70704170-70704192 CAGGGTGGGCAGGAGGAGTAAGG + Intronic
1140850802 16:78933047-78933069 AGGGCTGGACTGGGGGAGCAAGG + Intronic
1142260497 16:89040513-89040535 CTGGCTGGCCTGGGGGAGCAAGG + Intergenic
1142717037 17:1752824-1752846 CAGGCTGGGCAGGGCGGGTAAGG + Intronic
1142805550 17:2369484-2369506 CAGGCTGGACGGGGGGAGGGGGG - Intronic
1142927688 17:3255382-3255404 CAGGGTGGGGTGGGGGACTAGGG + Intergenic
1143124425 17:4632421-4632443 CAGGTTGGGGTGGGGGAGTGGGG + Intronic
1143158079 17:4851524-4851546 GAGGCTGGGCTGGGTGAGAAGGG - Intronic
1143283915 17:5774869-5774891 CAGGCTGGTCTGGAGTAGGAGGG + Intronic
1143516180 17:7420339-7420361 CACGGTGGGCTGGGGGCGTAAGG + Exonic
1143593347 17:7899231-7899253 CCGCCTGGACTGGGGAAGTGGGG + Intronic
1143670226 17:8391830-8391852 CAGGCTGGGCTGGGTGAGGAAGG - Exonic
1144710632 17:17399401-17399423 CAGGCTGGAAGGGGTGAGTCAGG - Intergenic
1144830953 17:18131001-18131023 GAGGCTGGAATGGGGAAGCATGG + Intronic
1144837143 17:18162533-18162555 CAAGGTGGACTGTGGGAGAAAGG - Intronic
1145824338 17:27865857-27865879 CAGGCTTGAATGGGGTGGTATGG - Intronic
1146839597 17:36141394-36141416 GAGGGTGGCCTGGAGGAGTAGGG + Intergenic
1147608221 17:41786103-41786125 CACCCAGGCCTGGGGGAGTAGGG + Intronic
1147654053 17:42078454-42078476 CATGGGGGACTGGGGGAGCAGGG + Intergenic
1148083630 17:44980948-44980970 GAAGCTGGACTTGGGGAGAATGG + Intergenic
1148762916 17:50017357-50017379 CAGGCTGGAGTGCGGTGGTACGG + Intergenic
1148797005 17:50201836-50201858 CAGGCTGGGCTGGGGGGCTGGGG - Intergenic
1149294455 17:55249349-55249371 GAGGCTGGAATTGGGGAGTGGGG - Intergenic
1149500814 17:57150951-57150973 CAGGCTGGGCAGTGGGAGTTGGG - Intergenic
1149548014 17:57518694-57518716 GAGGCTGGAGAGGGGGAGAAGGG + Intronic
1150287001 17:63960317-63960339 CAGGCTGGGCTGGAAGGGTAAGG - Intronic
1150525945 17:65922911-65922933 GAGGCTGGAATTGGGGAGGAAGG - Intronic
1150549051 17:66192153-66192175 CAGGCTAGAGGGGTGGAGTAGGG - Intergenic
1151237696 17:72733516-72733538 GAGGCTGGACTGGCTGAGTCTGG + Intronic
1151668453 17:75558649-75558671 CAGGCTGGGCTGGGAGTGGAAGG - Intronic
1151825287 17:76520618-76520640 CAGGATGGACTGGGGAAGGCAGG + Intergenic
1151935799 17:77260113-77260135 CAGGCTGGAGTGTGGTAGCATGG + Intergenic
1151943520 17:77306975-77306997 CAGGGTTACCTGGGGGAGTAGGG + Intronic
1152081478 17:78190228-78190250 GAGGCTGGGCTGGAGGAGGAGGG - Intronic
1152365626 17:79854707-79854729 CAGCGTGGGCTGGGGGAGTGGGG + Intergenic
1152519204 17:80845544-80845566 CAGGCTGGGCTGGCAGAGCAGGG - Intronic
1152770713 17:82166869-82166891 CAGTCTGGAGTGTGGTAGTATGG - Intronic
1152911768 17:83009377-83009399 CAGGCTGGAGTGCAGGGGTACGG - Intronic
1153701141 18:7694469-7694491 CAGGCTGGACTGCGGTAGTGCGG + Intronic
1153732559 18:8029311-8029333 CAGGCAGGACAGGTGGAGGAGGG - Intronic
1155598671 18:27517553-27517575 CAAACTGGCCTGGTGGAGTAAGG - Intergenic
1157197551 18:45631659-45631681 CAGGCTGGACTGGAGGGCAATGG + Intronic
1157550368 18:48577062-48577084 CAGGCTGGCCTGGGGGAGCCAGG + Intronic
1157576376 18:48746549-48746571 CAGGCTGGCCAGGAGGAGTCAGG + Intronic
1157595497 18:48861405-48861427 CAGGCTGGGCTGGGGAGGAAGGG - Exonic
1157616105 18:48988708-48988730 CAGCCTGAGCTGGGGGAGGAGGG + Intergenic
1159572722 18:70137586-70137608 CTGGCTGGATTTGGGGAGTGTGG - Intronic
1160538632 18:79608714-79608736 CAGGCTGAGCTGCGGGAGGATGG + Intergenic
1160975059 19:1789150-1789172 CGGGCGGGACTGGGGGCGTGCGG - Intronic
1161058099 19:2200623-2200645 ATGGCGGGACTGGGGGAGCAGGG - Intronic
1161253710 19:3294955-3294977 CAGCCTGGCCGGGTGGAGTAGGG + Intronic
1161301765 19:3546218-3546240 CAGGCTGGGGTGGGGGAGGCCGG - Intronic
1161353171 19:3804731-3804753 CAGGCTGGGCTGGGGGCGTGGGG + Exonic
1161869894 19:6862041-6862063 CAGGCTTGAGTAGGGGAGGATGG + Intergenic
1162075309 19:8182812-8182834 GAGGCTGGGCTTGGGGAGCAGGG + Intronic
1162423786 19:10581700-10581722 TGGGCTGGACTGTGGGTGTAAGG - Intronic
1162681326 19:12344316-12344338 CAGGCTGGACTGGAGTGGTGCGG - Intergenic
1162927057 19:13936036-13936058 CAGGCAGGCCTGGGAGAGTAGGG + Exonic
1163490915 19:17616755-17616777 CTGGCTGGATCGGGGGAGAAGGG + Intronic
1163728188 19:18934271-18934293 CAGGCAGGCATAGGGGAGTAGGG + Intronic
1163786338 19:19276855-19276877 CTGGCTGGACTGAGGAAGGAAGG + Intronic
1165115431 19:33525385-33525407 TGGGCTGGGCTGGGGGAGAAAGG - Intergenic
1165482708 19:36074259-36074281 CAGGCTGGAGTGTGGGAGTGTGG - Intronic
1165811428 19:38614226-38614248 CAAGGTGGTCTGGGGGTGTAGGG - Exonic
1166001792 19:39881841-39881863 CAGGCTGGACTTGGCAAGAAGGG - Intronic
1166004573 19:39898092-39898114 CAGGCTGGACTTGGCAAGAAGGG - Intronic
1166794240 19:45416750-45416772 CAGGGTGGGATGGGGGAGCAGGG + Intronic
1166987950 19:46673414-46673436 AGGGCTGGACTGGGGGAGTTTGG - Intergenic
1167596012 19:50428482-50428504 CGGGCTGGGCTTGGGGATTATGG - Exonic
1168580114 19:57548193-57548215 CAGGCTGGACCGGGGGACAGAGG + Intronic
1168642441 19:58039112-58039134 CCGGCTGCCCTGGGGCAGTAAGG - Intronic
925611425 2:5705944-5705966 GAGGCTGGAGTGGAGGAGCAGGG + Intergenic
926010046 2:9400292-9400314 AAGGCAGGAGTGGGGGAGGAAGG - Intronic
926220584 2:10933225-10933247 CAGCCTGGACTGGAGGGGTCGGG + Intergenic
927808075 2:26165900-26165922 CAGGCTGGACTGCAGTGGTATGG + Intergenic
929399394 2:41562641-41562663 CAGGCTGGAGTGCTGGAGTGCGG + Intergenic
929446002 2:42001921-42001943 CAGGCTGAACTGCTGGAGGAAGG - Intergenic
929534645 2:42773417-42773439 CTGGCTGCACTGGGGGAGGTGGG + Intronic
929887568 2:45892506-45892528 CAAGCTGGAGTGAGGGAGGAGGG + Intronic
931539897 2:63318763-63318785 GAGGCTGGAGTGTGGGAGGAGGG + Intronic
932573291 2:72949651-72949673 GAGGATGGACTGGAGGGGTAAGG + Intronic
934557838 2:95296813-95296835 CAGGCGGGACTGGGGCAGTGGGG + Intergenic
934648001 2:96070471-96070493 AAGGCTGGGCTGGGGGCATAGGG + Intergenic
935885047 2:107608595-107608617 CAGGGTGTTTTGGGGGAGTAAGG + Intergenic
937743321 2:125381512-125381534 CAGGCTTGCCTGGGGAAGGATGG + Intergenic
941539791 2:166768053-166768075 CAGGGTGGAGTGTGGGAGGAGGG - Intergenic
942250899 2:174047018-174047040 GTGGCTGGACTGGGGGTGTTTGG + Intergenic
943857819 2:192820982-192821004 TAGGCTGGACCGGAGGAGTGGGG + Intergenic
944551670 2:200850008-200850030 CAGGCTGGAATGCGGTAGCATGG + Intergenic
947794903 2:232888187-232888209 GGGGCTGGACTGGTGCAGTAGGG - Intronic
948748133 2:240110481-240110503 CTGCCTGGAGTGGGGGAGCAGGG - Intergenic
1168938537 20:1689115-1689137 CAGGAGGGACAGGGAGAGTAGGG + Intergenic
1170605087 20:17869823-17869845 CAGGCAGGACTGGGGTGGTCTGG - Intergenic
1170727834 20:18945839-18945861 CAGGCTTGACTGGGGTGGGAGGG + Intergenic
1171008262 20:21489764-21489786 CAGGCTTGACTGGGGAGATATGG + Intergenic
1172049902 20:32109572-32109594 CAGTCTGGTCTGGGAAAGTAAGG - Exonic
1172211153 20:33199481-33199503 CAGCCTGGACTGGGGGTGGTTGG - Intergenic
1172624582 20:36339953-36339975 GAGGCTGGGTTGGGGGAGTGAGG + Intronic
1173029204 20:39339062-39339084 CTGGCTGTGCTGGGGGACTAGGG + Intergenic
1173688791 20:44942835-44942857 CTAGCTGGGCTGGGGGAATAGGG + Exonic
1174266853 20:49338169-49338191 CAGGAAGGACTGGCGGAGCAGGG + Intergenic
1175747518 20:61468676-61468698 CAGGCTGGCAGGGGGGAGTGGGG - Intronic
1176068764 20:63215527-63215549 CGGGCTGGAGTGGAGGAGGACGG - Intronic
1177301193 21:19247388-19247410 CATGCTGGAAGAGGGGAGTAAGG - Intergenic
1179531801 21:42024602-42024624 CAGGCAGGACCCGGGGAGGAGGG - Intergenic
1179722214 21:43322308-43322330 CAGGCTGGGCTGGGGGAGAAAGG - Intergenic
1180092037 21:45538196-45538218 CAGCCTGGCCTGGGGGACTCCGG - Intronic
1181265644 22:21629246-21629268 CAGGCGGGGCTGGGGGAGTAGGG - Intronic
1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG + Intronic
1181549299 22:23627817-23627839 CAGGCTGGACAGGCTGAGAAGGG + Intronic
1181799313 22:25334063-25334085 CAGGCTGGACAGGCTGAGAAGGG - Intergenic
1182446512 22:30392806-30392828 CAGGCTGGACTGCAGAAGTGAGG + Intronic
1182880242 22:33726795-33726817 CAGGCAAGACTGGGGGAATTGGG + Intronic
1183235236 22:36611803-36611825 CAGGCTGGAATTGGGGATGATGG - Intronic
1184083916 22:42246636-42246658 CAGGGAGGACTGGGGAAGGAGGG + Intronic
1184326842 22:43794754-43794776 GAGACTGGAATGGGGGAGGAGGG - Intronic
1184489734 22:44801656-44801678 CAGGGTGGCCTGGGGGACAATGG - Intronic
1184792808 22:46710873-46710895 CTGGCTGGGCTGGGCGAGAATGG - Intronic
1185298787 22:50068261-50068283 CAGGCTGGCATTGGGGAGCACGG + Intronic
949171599 3:1005271-1005293 CAGGCTGGAGTGCAGTAGTAGGG - Intergenic
953411800 3:42694628-42694650 CATGATGAACTGGGGGAGCATGG - Intronic
953541213 3:43820322-43820344 TAGGCTTGACTGTTGGAGTATGG + Intergenic
953941210 3:47099652-47099674 CAGGCTGGACTGTAGTAGCAAGG + Intronic
954554261 3:51505809-51505831 CAGGCTGTAGTGGGTGAGGAGGG + Intergenic
954584449 3:51721233-51721255 CAGGCTGGACTGGGAGAACAAGG - Intergenic
954790116 3:53126353-53126375 CAGGCTGGGGTGGGGGAGTGTGG - Intronic
955176676 3:56621237-56621259 GGGGGTGGACTGGGGGAGAAGGG + Intronic
956931988 3:74053817-74053839 AAGGCTGCTCTTGGGGAGTATGG + Intergenic
960941859 3:122940107-122940129 CAGGCTGGACTGTGGGGAGAGGG - Intronic
961003807 3:123391301-123391323 CAGGCTGGAAAGGGGGGGTTTGG - Intronic
961667572 3:128503290-128503312 CAGGAGGGACTGGATGAGTAGGG + Intergenic
962226956 3:133621054-133621076 CAGGCTGGACTGCAGTGGTATGG + Intronic
962400727 3:135056795-135056817 GAGGCTGGGCTCTGGGAGTAGGG + Intronic
962626845 3:137234197-137234219 AAGGCTTAACTGGGGGAGGATGG - Intergenic
966942517 3:184755933-184755955 AAGGCTGGGCTGGAGGAGAAGGG + Intergenic
967115542 3:186334275-186334297 CAGGGTGGGGTGGGGGAATATGG - Intronic
968654203 4:1771679-1771701 CCGGCTGGGGTGGGGGAGGAGGG - Intergenic
969075217 4:4572824-4572846 CAGGTGGGACAGGTGGAGTAAGG - Intergenic
969348756 4:6585747-6585769 AAGGCTGGACTGGGGCTGGAGGG + Intronic
969350784 4:6596849-6596871 CAGGCTGCACTGGGGCAGGTGGG - Intronic
969696895 4:8740075-8740097 CAGGCTGGGCAGGGGGAGGGTGG + Intergenic
969851536 4:9960888-9960910 AAGGCTAGACTGAGGGATTAGGG + Intronic
969967088 4:11008068-11008090 GAGGCTGGACAGAGGGAGTGAGG + Intergenic
970256885 4:14177465-14177487 CAGGCTGACCTCTGGGAGTAAGG + Intergenic
973196542 4:47449437-47449459 CATGGTGGACTTGGGGAGGAAGG + Intergenic
973973610 4:56240312-56240334 CAGACTGGGGAGGGGGAGTAGGG + Intronic
976711287 4:88074183-88074205 CAGGCTGGAGTGCAGGAGTGCGG + Intronic
977570821 4:98627542-98627564 CATGGAGGAATGGGGGAGTAAGG - Intronic
981150243 4:141372012-141372034 CAGGCTGGAGTGCGGTGGTACGG + Intergenic
981495952 4:145392679-145392701 CAGGCAGGAGTGGTGCAGTAGGG - Intergenic
981786303 4:148483101-148483123 CAGACTGGGGTGGGGGAGGATGG - Intergenic
982610973 4:157574513-157574535 CAGAGTGGACTCTGGGAGTAGGG - Intergenic
983518039 4:168677811-168677833 CAGGATTAACTGGCGGAGTAGGG - Intronic
984400363 4:179256924-179256946 CAGGCTGGAGTGGGGCAATTAGG - Intergenic
984688076 4:182694152-182694174 CAGGCTGGACTGCGGTGATACGG + Intronic
984817124 4:183849233-183849255 CAGGCTGGAGTTGGGGAATTAGG + Intergenic
985487126 5:158192-158214 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487145 5:158233-158255 CAGGATGGGCAGGGGGAGGAGGG - Intronic
988553493 5:32217300-32217322 CAGGTGGGACTGCGGGAGAATGG + Intergenic
989278912 5:39619830-39619852 CAGGCTGGAGTGCTGGAGTGTGG + Intergenic
989402104 5:41018815-41018837 CAGGCTGGGGTGAGAGAGTAAGG + Intronic
990259293 5:54004449-54004471 CAGGCTGGAGTGCGGTGGTACGG - Intronic
990316173 5:54585245-54585267 CAGGCTGGAGTGCAGGAGCATGG - Intergenic
993823669 5:92653887-92653909 CAGGCAGGGCTGTGTGAGTATGG - Intergenic
994011846 5:94913747-94913769 CAGGCTGGAGTGCAGGGGTATGG + Intronic
995095950 5:108236163-108236185 CAGGCTGGAGTGCAGCAGTATGG - Intronic
997815068 5:137008867-137008889 GAGGCTAAACTGGGGGAGAAGGG + Intronic
997913373 5:137898766-137898788 CAGGCTGGAGTGCTGGAGTGCGG + Intronic
999742682 5:154568540-154568562 GAGGCTGGACTGGGGGTGGGAGG + Intergenic
999969231 5:156842492-156842514 GAGGCTGGGCATGGGGAGTATGG - Intergenic
1002277578 5:178113802-178113824 CGGGCTGGACTCGGGGGGTGGGG + Intronic
1002400680 5:178990205-178990227 CAGGTAGGACTGGGGGTGCAGGG + Intronic
1002773668 6:310313-310335 CAGGCTGGGATGGGGGTGTAGGG + Intronic
1003052524 6:2792800-2792822 CAGGCTGAACTTGGGGACTGCGG + Intergenic
1003184003 6:3814666-3814688 GAGGCTGGGCTGGGAGAGTGGGG + Intergenic
1005281437 6:24278967-24278989 CAGGCTGCCTTGTGGGAGTAGGG - Intronic
1006322020 6:33324942-33324964 CAGGCTGGAATGCGGTGGTACGG + Intronic
1006368877 6:33632481-33632503 CAGGGTGGAATGGGGCAGAATGG + Intronic
1007599213 6:43071468-43071490 CAGGCTGGACTGAAGGGGTCTGG - Intronic
1007654779 6:43445522-43445544 CAGGCAGCACTGGGGGAGGTGGG - Intronic
1008433648 6:51449830-51449852 CAGGCTGGGCTGGGTGTGGAAGG + Intergenic
1008463682 6:51805758-51805780 CTGGCTGCAGTGGGGGAGAATGG + Intronic
1010035696 6:71323730-71323752 CAGCCTGGTGAGGGGGAGTAAGG - Intergenic
1012744127 6:103061826-103061848 CAGGATGGACTGGGGCTTTATGG + Intergenic
1013002619 6:106039219-106039241 CAGGCTGCATTGGAGGAGTGGGG + Intergenic
1013423390 6:109987333-109987355 CAGGCTTGACAGGAGGAGGATGG + Intergenic
1013637691 6:112044699-112044721 GAGGCTGGACTGGGGGAGGTAGG + Intergenic
1014005354 6:116411430-116411452 CAGGCTGCACTCTGGGAGGAGGG + Intronic
1014216280 6:118755545-118755567 CAGCCTGCACTGGGGAAGGAAGG - Intergenic
1015945161 6:138492227-138492249 CAGGAGGGAGTGGGGGAGTGAGG + Intronic
1017609361 6:156168059-156168081 CAGGCTGGAGGGAGGGAGGAAGG + Intergenic
1018718544 6:166554647-166554669 CAGGCTGCAGTGGAGGAGGATGG - Intronic
1019707530 7:2503671-2503693 CAGGCTGCGCTGGGGGTGCACGG + Intergenic
1020014038 7:4820751-4820773 CAGGCTGGACTGAGGGCGCGTGG - Intronic
1021091134 7:16484540-16484562 GAGACTGGACTGGAGGACTAGGG - Intronic
1021387553 7:20050450-20050472 CAGGCTTCACTGGGGGAATGAGG - Intergenic
1021689843 7:23221233-23221255 CAGGCTGGTCTGGTAGAGTTGGG + Intergenic
1023521190 7:41051637-41051659 CCGGCTGGAGTGGAGGAGCAGGG - Intergenic
1024213783 7:47228963-47228985 AAGGCAGGACTGGAGGAGGATGG - Intergenic
1025712743 7:63927317-63927339 CTGGCGGCACTGGGGGAGCAGGG - Intergenic
1025744788 7:64233194-64233216 CAAGCTGGAGTGGGGCAGTGGGG - Intronic
1026024187 7:66732052-66732074 CAGGCTGGGCTGGGGGTGGCTGG - Intronic
1026689582 7:72540263-72540285 CAGGCTGGAGGGTGGGGGTAGGG + Intergenic
1026888911 7:73970944-73970966 CAGGCTGGGCTGGGGGTGGCAGG - Intergenic
1029240809 7:99160738-99160760 CAGGGTGGAGTGGATGAGTAGGG + Intergenic
1029950419 7:104578390-104578412 CTGGCTGGAGAGGGGAAGTATGG - Intronic
1029996655 7:105013718-105013740 CAGACTGGGCTGGGGGAGGAGGG + Intergenic
1030225572 7:107146648-107146670 CTGACTGGACTGGAGGAGTGGGG - Intronic
1030865581 7:114698502-114698524 CAGGCAGCACAGGGAGAGTAGGG - Intergenic
1031923947 7:127620665-127620687 GGGGCTGGGCTGGGAGAGTAGGG - Intergenic
1032035380 7:128517575-128517597 CAGTCTGGAGTGGGGGAGACAGG + Intergenic
1032120997 7:129156418-129156440 CAGTCTGCACTGAAGGAGTAAGG + Intronic
1032220069 7:129987886-129987908 CAGGCTGTACAGGGGGATTGAGG + Intergenic
1034101956 7:148457850-148457872 CCGGCTGTAATGGGGGAGAAGGG - Intergenic
1034276994 7:149828208-149828230 CAGGCTGGGCTTGGGGATCAGGG + Intergenic
1034417357 7:150972097-150972119 GAGGCTAGACTGGGGGAGTGTGG - Intronic
1034577499 7:152013191-152013213 GAGGGTGGACTGTGGGAGGAGGG + Intronic
1034577668 7:152015023-152015045 GAGGGTGGACTGTGGGAGGAGGG + Intronic
1035938823 8:3873552-3873574 CAGGGTGGACGGTGGGAGGAGGG + Intronic
1036228939 8:6983295-6983317 CAGGCTGGGGTTGGGGACTATGG - Intergenic
1036231390 8:7002400-7002422 CAGGCTGGGGTTGGGGACTATGG - Intronic
1036233848 8:7021497-7021519 CAGGCTGGGGTTGGGGACTATGG - Intergenic
1036568968 8:9962960-9962982 AAGGCTGGACAGGGTGATTACGG + Intergenic
1037491766 8:19403004-19403026 GAGGGTGGACTGTGGGAGGAGGG + Intergenic
1037892587 8:22631292-22631314 CAGGCGGGACTGGGACAGCAGGG + Intronic
1039955757 8:42206130-42206152 CAAGCTGGTCTTGGGGAGTCGGG + Intronic
1040385250 8:46910980-46911002 CAGGCTGGGGTGGGGCAGTGGGG - Intergenic
1041360099 8:57043862-57043884 CAGGCTTCACTGAGGAAGTATGG - Intergenic
1041711228 8:60896333-60896355 GAGGCTGAACAGTGGGAGTATGG - Intergenic
1041904137 8:63013181-63013203 CAGGAAGGACTGGGTGGGTATGG - Intergenic
1042535982 8:69859770-69859792 TATGCTGGAGTGGGGGTGTAGGG + Intergenic
1043440669 8:80274480-80274502 CAGGCTGGAATGCAGTAGTATGG + Intergenic
1043620834 8:82190986-82191008 GAGCCTGGACTGGGGGAAAAAGG - Intergenic
1044790285 8:95840094-95840116 CAGGGTGGAGTGGGAGAGTGAGG - Intergenic
1045312846 8:101018163-101018185 CAGGCAGGAAAGGGGGAGAAAGG + Intergenic
1046761829 8:118029376-118029398 CAGGCTGGAGTGCGGTAGCATGG - Intronic
1046809580 8:118517844-118517866 CAGAATGGGCTGGGGGAGGAGGG + Intronic
1049219587 8:141422755-141422777 CAGGCTGGACTAGGGGCTTCAGG + Intronic
1049519609 8:143081140-143081162 CGGGCTGGGCTGGGGGCGTCGGG + Intronic
1050377018 9:4984620-4984642 CAGCCTGGACTGGGGAAGGACGG + Intergenic
1052818960 9:33123961-33123983 CAGGCTGGGATGAGGGAGAAAGG - Intronic
1053055773 9:34992293-34992315 CAGGGTGGACTGGGGGCGTAGGG + Intronic
1054988017 9:71285219-71285241 CAGGCAGGATTGGAGGAGTTAGG - Intronic
1056648631 9:88437451-88437473 CAGGCTGGAGTGTGGTAGCATGG - Intronic
1056848091 9:90057702-90057724 CAGGCTGCAGTGGGTGACTATGG + Intergenic
1057165277 9:92920724-92920746 CAGGCTTGGGTGGGGGAGTGGGG - Intergenic
1057222018 9:93262561-93262583 CAGGCTGGGCTGAGGAAGTGGGG + Intronic
1057914881 9:99047889-99047911 CAGGCTGGTCTGTGGGCGGAGGG + Intronic
1058672825 9:107374962-107374984 CAGGCTGGACTGCAGTAGCATGG - Intergenic
1058975979 9:110126074-110126096 CAGGGTGGCCTGGGGGAATATGG + Intronic
1058993551 9:110277363-110277385 CAGACTGTTCTGGTGGAGTATGG - Intergenic
1059735117 9:117092867-117092889 CAGGCAGGCCTGGGGGTGTAGGG + Intronic
1060180469 9:121530094-121530116 AAAGATGGACTGGGGGAGAAGGG + Intergenic
1061457071 9:130706483-130706505 CAGGCTGGAGTGGGGTGGCATGG + Intergenic
1061926279 9:133807580-133807602 CAGGGTGGACTTGGGCACTATGG + Intronic
1062020627 9:134317867-134317889 CTGGCTGGGGTGGGGGGGTATGG - Intronic
1062020648 9:134317940-134317962 CTGGCTGGGGTGGGGGAGTATGG - Intronic
1062020669 9:134318014-134318036 CTGGCTGGGTTGGGGGGGTATGG - Intronic
1062020709 9:134318154-134318176 CTGGCTGGGGTGGGGGGGTATGG - Intronic
1062193015 9:135257309-135257331 CAGGGTGGACCGGGGGACAAAGG - Intergenic
1062343416 9:136103836-136103858 CAGGGTGGACAGGTGGAGTGTGG - Intergenic
1185612778 X:1402398-1402420 GAGGCTGAATTGGGGGAGGAGGG - Intergenic
1186427192 X:9471931-9471953 CAGGCTAGAATATGGGAGTAGGG + Intronic
1190213487 X:48466145-48466167 CAGGCTGGGCTGGGGAAGACGGG - Intronic
1190687745 X:52889509-52889531 CAGGCTGGAGTGGACGAGTCTGG - Intergenic
1190698237 X:52966283-52966305 CAGGCTGGAGTGGACGAGTCTGG + Intronic
1191700425 X:64036110-64036132 GAGGCTGGACGGTGGGAGGAGGG + Intergenic
1193374129 X:80737788-80737810 CAGGCTGGAGTGCGGTGGTACGG - Intronic
1196866922 X:120078525-120078547 TAGGGTGGAGGGGGGGAGTAGGG + Intergenic
1196876177 X:120157757-120157779 TAGGGTGGAGGGGGGGAGTAGGG - Intergenic
1197729505 X:129797756-129797778 CAGGCTGGGGTGGGCGTGTAAGG - Intergenic
1198052605 X:132963138-132963160 CAGGCTGGAGTGCAGTAGTATGG - Intergenic
1198560358 X:137843271-137843293 GAGGGTGGACTGGGGGAGGATGG - Intergenic
1200061609 X:153486278-153486300 ATGGCTGGATTGGGGGAGGATGG - Intronic