ID: 1102419929

View in Genome Browser
Species Human (GRCh38)
Location 12:112795443-112795465
Sequence TTGATGTGCTGAAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102419926_1102419929 -7 Left 1102419926 12:112795427-112795449 CCCAGGATGGAGAGCCTTGATGT 0: 1
1: 0
2: 3
3: 131
4: 3479
Right 1102419929 12:112795443-112795465 TTGATGTGCTGAAAGAGTGAAGG 0: 1
1: 0
2: 0
3: 22
4: 209
1102419925_1102419929 -4 Left 1102419925 12:112795424-112795446 CCACCCAGGATGGAGAGCCTTGA 0: 1
1: 0
2: 2
3: 21
4: 508
Right 1102419929 12:112795443-112795465 TTGATGTGCTGAAAGAGTGAAGG 0: 1
1: 0
2: 0
3: 22
4: 209
1102419927_1102419929 -8 Left 1102419927 12:112795428-112795450 CCAGGATGGAGAGCCTTGATGTG 0: 1
1: 0
2: 1
3: 142
4: 3302
Right 1102419929 12:112795443-112795465 TTGATGTGCTGAAAGAGTGAAGG 0: 1
1: 0
2: 0
3: 22
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102419929 Original CRISPR TTGATGTGCTGAAAGAGTGA AGG Intronic
904890772 1:33777932-33777954 TTGATGTGCTCCAAGAGGGGAGG + Intronic
905929425 1:41776848-41776870 AAGATCTGCTGTAAGAGTGAAGG - Intronic
906508239 1:46395572-46395594 CTTATGTGCTGAGAGAGGGAGGG + Intronic
908309645 1:62866559-62866581 ATAATTTGCTGAATGAGTGAAGG + Intergenic
908951901 1:69569991-69570013 TCGATGTGTTGAAAGAGTATTGG - Intronic
909506276 1:76393827-76393849 TTAGTGCGCTGAAGGAGTGATGG + Intronic
910261105 1:85294626-85294648 TTGATGGACTGGAAGAGAGATGG - Intergenic
910737126 1:90472040-90472062 TTGATGCGTTGGAAGAGTGCTGG - Intergenic
911126513 1:94345507-94345529 TTGGGGTGATGAAAGAGTTACGG + Intergenic
912848514 1:113100537-113100559 TTGTTGTGCTTAAAGTGTGATGG + Intronic
913130786 1:115837585-115837607 TTAATGTGTTGAAAGAATGAGGG - Exonic
915305965 1:154978710-154978732 GTGAGGTTCTGAAAGAGTGAGGG - Exonic
915681668 1:157587321-157587343 GTGTGGTGCTGAAACAGTGAGGG - Exonic
915756009 1:158260598-158260620 TTGATAGGCTGAAACAGTAAAGG - Intergenic
919125838 1:193392399-193392421 TTGATCTTCTGAAAAAGTTATGG + Intergenic
919473993 1:198011889-198011911 TTATTGTGCCTAAAGAGTGAAGG + Intergenic
920248946 1:204609471-204609493 TTGATGGGCTGAAAGCTTGAAGG + Intergenic
921104385 1:211961111-211961133 CTGATGTCCTGAAAGAGATAGGG + Intronic
921371694 1:214430193-214430215 TGGATGAGCGGAAAGTGTGAAGG - Intronic
922018936 1:221684376-221684398 TTGAAGTGCTGAATGAGGGATGG - Intergenic
923089465 1:230728756-230728778 TGCATGTGCTGAAAGAGCTATGG - Intergenic
924727061 1:246680919-246680941 TTGCTGTCCTGAAAGAGGGTCGG - Intergenic
1063102960 10:2966657-2966679 TTGATGTGGTGAAGGATAGAAGG - Intergenic
1063853643 10:10222168-10222190 GTAATGTGCTGAAAGGGTGTGGG - Intergenic
1065195720 10:23263612-23263634 TTGATCTGCAGAAAGAATCAGGG - Intergenic
1065565458 10:27003218-27003240 TTGAAGTGCTCAAAGAATAAGGG + Intronic
1069177274 10:65308324-65308346 TTGCAGTGCTAAGAGAGTGAAGG - Intergenic
1071111205 10:82159321-82159343 TTGGAGTGCTGAGAGAGTGAAGG - Intronic
1074090834 10:110253298-110253320 TGGATGTTTTGAGAGAGTGATGG + Intronic
1074149197 10:110743035-110743057 TTGAGGTGCTCTGAGAGTGATGG - Intronic
1074496091 10:113981216-113981238 TTGATTTACTGAAAGGATGAGGG + Intergenic
1074592477 10:114826125-114826147 GACATGTGCTGAATGAGTGAAGG - Intronic
1076060434 10:127409850-127409872 TTGCTGTGCTGTAAGGCTGAAGG - Intronic
1077892954 11:6432432-6432454 ATGAGGTGGTGGAAGAGTGAGGG + Intronic
1078266492 11:9759094-9759116 TGGAGGTGCTGACAGAGTGCGGG - Intergenic
1079555059 11:21750310-21750332 TTTATGTGATGAAAGACTGAGGG + Intergenic
1081319406 11:41672306-41672328 TGGAACTGCTGCAAGAGTGAAGG - Intergenic
1085346607 11:75772129-75772151 GTGGTTTGCTGAATGAGTGAAGG + Intronic
1086988403 11:93275530-93275552 TAGTTTTGCTCAAAGAGTGAGGG + Intergenic
1087014878 11:93544921-93544943 TCTATGCGCTGAAAGAATGAGGG + Intergenic
1088076104 11:105850529-105850551 TTGATGTCCTTACAGAGAGAAGG + Intronic
1088336782 11:108714097-108714119 TTGTTTTGCTGAAAGCATGAGGG + Intronic
1089046714 11:115507123-115507145 TTGATGTGCCAAGAGAATGAAGG - Intergenic
1089710433 11:120310670-120310692 TTACAGTGCTGAAAGACTGAAGG - Intronic
1089937288 11:122377322-122377344 TTGAAGTGCTGAAATGCTGAAGG + Intergenic
1091660618 12:2380604-2380626 TGTATGTGATGAAAGAGGGATGG - Intronic
1092521484 12:9278327-9278349 TATATGACCTGAAAGAGTGATGG + Intergenic
1094217138 12:27954761-27954783 TTTATTTGAGGAAAGAGTGATGG + Intergenic
1095994091 12:48064048-48064070 ATGTTGTGCTGAAAAAGAGAAGG - Intronic
1097241189 12:57576363-57576385 TTGATGAGCTCAAAGAGTAAGGG + Exonic
1099039315 12:77631286-77631308 CTGGTGTCCTGAAAGAGTTAAGG - Intergenic
1099692705 12:85979788-85979810 CCCATGTGCTGAAAGAGAGATGG + Exonic
1100780526 12:98020843-98020865 TTGATGTTCTGAATGGGTGAGGG + Intergenic
1101058616 12:100947250-100947272 TTGATGTTGGGAAAGAGTGGAGG + Intronic
1101483897 12:105131427-105131449 TGGATGTGATCACAGAGTGATGG + Intronic
1101651305 12:106679792-106679814 TTCATATGCTGAAAGTCTGAAGG + Intronic
1102313921 12:111870783-111870805 GTGATGGGCTTATAGAGTGAAGG + Intronic
1102419929 12:112795443-112795465 TTGATGTGCTGAAAGAGTGAAGG + Intronic
1105897307 13:24727148-24727170 TTGGAGTCCTGAAGGAGTGAGGG + Intergenic
1106067802 13:26373366-26373388 TTGCTGTGCTGTATGAATGAAGG + Intronic
1107824219 13:44312787-44312809 ATGAGGTGGGGAAAGAGTGAGGG - Intergenic
1110130091 13:71997856-71997878 AGGAATTGCTGAAAGAGTGATGG + Intergenic
1111081503 13:83315905-83315927 CTGATGGTATGAAAGAGTGAAGG + Intergenic
1112992580 13:105532102-105532124 ATGATGTGATGAAAGGGTGGAGG + Intergenic
1113034432 13:106033681-106033703 TGGATGTCCTGAAAGTGTGCTGG - Intergenic
1113560770 13:111278903-111278925 TTGATGTGTTGACAGACTGCTGG + Intronic
1119429270 14:74555372-74555394 TTGATTGGCTGAAAGAATGAGGG + Intronic
1120202316 14:81551034-81551056 AGGATGTGCTCAAAGAATGATGG - Intergenic
1125470909 15:40002561-40002583 CTGATGTGTTCAAAGAGGGATGG + Intronic
1125751342 15:42031401-42031423 TTGATGTTTTTACAGAGTGATGG + Intronic
1126082563 15:44979539-44979561 TTAATAAGCTGAAATAGTGAGGG + Intergenic
1128892874 15:71346523-71346545 AAGAAGTGCTCAAAGAGTGATGG - Intronic
1129178785 15:73858619-73858641 TGGAAATGCTGAAGGAGTGATGG - Intergenic
1130851660 15:87800686-87800708 TGGAAGTGCTCAAAGAATGATGG - Intergenic
1131792441 15:95979877-95979899 CTGGTGTGGTGAAAGAGGGAGGG + Intergenic
1131900391 15:97081782-97081804 TTGCTGTGATGAAAGTGTGGGGG - Intergenic
1132571394 16:645917-645939 TTCATGGGCTGAAAAAGGGATGG + Intronic
1135120054 16:19758229-19758251 CTGAGGAGCTGAAAGAGAGAAGG - Intronic
1135155481 16:20049193-20049215 TTTGTGGGATGAAAGAGTGATGG + Intronic
1139324292 16:66139981-66140003 GTGAGCTGCAGAAAGAGTGAGGG - Intergenic
1140833377 16:78771390-78771412 TTGAGGTGATGAAAGAGTTTTGG + Intronic
1141164107 16:81648862-81648884 TTGACGTTCCTAAAGAGTGAGGG - Intronic
1142945153 17:3420455-3420477 TTGAGGTGTTGGAGGAGTGAGGG + Intergenic
1143798468 17:9357753-9357775 TTAATTTTCAGAAAGAGTGAAGG + Intronic
1147883640 17:43670043-43670065 AGGAAGTGCTGAAAGAGAGAAGG + Intergenic
1148083459 17:44980111-44980133 GTGAAGTGTTGAAAGAGTGAGGG - Intergenic
1151257117 17:72886505-72886527 TTGAGCTGCAGAAAGAGTGGCGG - Intronic
1151286507 17:73115777-73115799 TTACTGTGCTGAAATAGCGAGGG + Intergenic
1153470326 18:5437277-5437299 CTCATGTGGTGAAAGGGTGAGGG - Intronic
1155904169 18:31429254-31429276 TTGATGGGCTGAAAGAGAAGGGG + Intergenic
1156744831 18:40377268-40377290 TTAATGAGCTGAAAGAGGGAGGG - Intergenic
1157048984 18:44137700-44137722 TTGATGTGCTGGAAAAGTATGGG - Intergenic
1157745472 18:50131349-50131371 TTGGTGTGCTCAAAGACTCATGG - Intronic
1158078235 18:53556982-53557004 ATGATATGCTTAAAGAGTGCAGG + Intergenic
1158154309 18:54408121-54408143 TTCACCTGCTGAAAGTGTGAGGG + Intergenic
1158473224 18:57757271-57757293 TGGACATGCTGAAAGAATGATGG - Intronic
1160470246 18:79125188-79125210 TTGATGTGCTCAGGGAGAGATGG + Intronic
1161993475 19:7698514-7698536 TGGAGGTGCTGAAAGTGTGGAGG + Intronic
1162348917 19:10137273-10137295 CTCATGTCCTGAAAGAGTGTGGG + Exonic
1162894255 19:13755642-13755664 TTTATGAGCTGAAAGAGCCAGGG - Intronic
1164691317 19:30212861-30212883 TGGATGTTGTGAAAGAGAGAAGG - Intergenic
1165361833 19:35341595-35341617 TTGAAGTGCTGTGTGAGTGAGGG + Exonic
1166804842 19:45479848-45479870 TTGATCAGATGACAGAGTGAAGG - Intergenic
1168112981 19:54205175-54205197 TTGATTTGCTGAAGGCGTGTGGG + Intronic
1168125619 19:54280912-54280934 TGGATGGGCTGAAGGAGGGAGGG - Intronic
1168185183 19:54696018-54696040 TGGATGGGCTGAAGGAGGGAGGG + Intronic
932307071 2:70711639-70711661 TTGATGTGCTGGGAGAGTTATGG + Intronic
932539845 2:72640391-72640413 TTGGTGTCCTGAAAGAGATAGGG + Intronic
934521119 2:95020803-95020825 TGGATGTGCAGGAAGAGGGAGGG - Intergenic
934988522 2:98904343-98904365 TTCCTGTGCTGAATGAATGATGG - Intronic
938762944 2:134441872-134441894 TTGAGGTGCTGGAAGAAAGAAGG - Exonic
939362191 2:141186807-141186829 TTGTTGTTCAGAAAGAGAGATGG + Intronic
940063363 2:149597773-149597795 TTGATGTGCTGAATTAGTGGGGG + Intergenic
941122243 2:161543979-161544001 TTGGTGTCATGAAAAAGTGAAGG + Intronic
941411870 2:165167739-165167761 TTGATGTTTTGAAACAATGAAGG + Intronic
942139957 2:172967851-172967873 AGCATGTGCTGAATGAGTGAAGG - Intronic
942631440 2:177954317-177954339 TTGATATGCTGTAAGAATGATGG - Intronic
943663372 2:190583180-190583202 TTGATGGGCAGAAGGAGAGAGGG + Intergenic
1170666532 20:18391592-18391614 TTCAAATGCTGAAAGACTGAAGG + Intronic
1170687807 20:18585210-18585232 TTGATGTGCTGGGAGGGTAATGG - Intronic
1173382871 20:42561694-42561716 TAGATGTGCTAAAGGAGTGAGGG + Intronic
1175125566 20:56748925-56748947 TTGTTGTTGTGTAAGAGTGAAGG + Intergenic
1177732400 21:25044539-25044561 TTGATGTCCAGAAACAGTCATGG + Intergenic
1182870494 22:33642161-33642183 TTGATCTGCTGTTAGTGTGATGG - Intronic
1184929535 22:47670821-47670843 TTGGTGGCCTGAAAGAGTGCAGG + Intergenic
951847135 3:27096751-27096773 TTTGTGAACTGAAAGAGTGAGGG + Intergenic
952427850 3:33193639-33193661 TTGAAGTGTTGAGTGAGTGAGGG + Intronic
954209985 3:49090744-49090766 TTCCTTTGCTGAAAGAGGGAAGG - Intronic
955272473 3:57515355-57515377 AGGATGTGCTCAAAGAATGATGG + Intronic
956609623 3:71109439-71109461 TTGATCTGCTGATAGCTTGAGGG - Intronic
957807953 3:85175636-85175658 TTGAAGTGCTGAAAAAGTTCTGG + Intronic
958698707 3:97559967-97559989 TTGATGTTCTCAAAGAGAGGGGG + Intronic
958915058 3:100040552-100040574 TAGATGTGCTGAAAAAAGGAAGG - Intronic
961015338 3:123464167-123464189 AAGATGTGCTCAAAGATTGATGG + Intergenic
961589335 3:127964309-127964331 ATCATGTGCTTAAAGAGTGAAGG - Intronic
962243460 3:133771178-133771200 CTGAAGTGCTCAAACAGTGATGG + Intronic
963216215 3:142751742-142751764 TTAAGGTGAGGAAAGAGTGAGGG - Intronic
964891381 3:161540248-161540270 TTTATATGCTGAGAGAGTAATGG - Intergenic
965447624 3:168795045-168795067 TTGATGTACTGAGACAGAGATGG - Intergenic
966797264 3:183727507-183727529 TTCATGAGCTGGAAGAGTAAAGG + Intronic
970937226 4:21587396-21587418 GTGATGTAAAGAAAGAGTGATGG - Intronic
971242378 4:24900292-24900314 TTGATGTGAAGGAGGAGTGAAGG - Intronic
971732607 4:30405371-30405393 TTGAAGTGCTCAAATAGTGGAGG - Intergenic
977767824 4:100821404-100821426 GTGATGTGCTGAAGGAGCAAGGG - Intronic
978589692 4:110311592-110311614 TGGATGTGGTAAAAGAGAGATGG - Intergenic
979011869 4:115381112-115381134 TTATTATGCTGAAAGAATGAAGG - Intergenic
980885359 4:138756791-138756813 AATATTTGCTGAAAGAGTGAAGG - Intergenic
981534210 4:145782474-145782496 TGGATGTGTTGAAAGAGAGTCGG - Intronic
982464744 4:155716094-155716116 TTGATGTGCTTAAAGGATAATGG + Intronic
987540540 5:19248815-19248837 TTTATGTTCAGAGAGAGTGAGGG + Intergenic
987948083 5:24640283-24640305 TAGATTTGCAGAAAGAGAGATGG + Intronic
988908528 5:35815579-35815601 TTGATGTGCTGATAGGCTGGAGG - Intergenic
989598924 5:43183738-43183760 ATGATGTCCTAGAAGAGTGAAGG + Intronic
989783191 5:45295066-45295088 TTGGGGTGCTCAAGGAGTGATGG - Intronic
990507502 5:56458987-56459009 TTGAAGTACAGAAAGAGGGAAGG - Intronic
990926931 5:61036689-61036711 TTCCAGTGCTGAAACAGTGAGGG + Intronic
991446738 5:66708185-66708207 TTTATTTGCGGAAAGAGTGCGGG + Intronic
991590026 5:68241351-68241373 TTGATTTGCTGAAAAGGTGGTGG + Intronic
992006278 5:72480986-72481008 TTCATGTGGAGAAAGAGTGCGGG + Intronic
993399643 5:87432600-87432622 TTCATGTGGTGGAAGAGGGAAGG - Intergenic
994149003 5:96426621-96426643 TTGAAGCCCTGAGAGAGTGAGGG + Intronic
994471858 5:100217295-100217317 CTCATGTGCTGAAAGTGTCAAGG - Intergenic
996792229 5:127305358-127305380 TTGAGGGGGTGAAAGTGTGAGGG + Intronic
997076921 5:130689784-130689806 TTTCTCTGCTGATAGAGTGAAGG - Intergenic
997216424 5:132114859-132114881 TAGATGTGCTGAAAGAAGGGAGG - Intergenic
998299772 5:141006646-141006668 ATGGTGTCCTGAAAGAGTGGTGG + Intronic
999409633 5:151339645-151339667 TTGCTGAGCTGAGAGTGTGAGGG - Intronic
999695645 5:154186670-154186692 TTTATGTGCTGACAGAGGCACGG + Intronic
1001141861 5:169151208-169151230 CTGCTGTGCTGAGAGAGAGATGG - Intronic
1003024304 6:2540018-2540040 TTGGTGACCTCAAAGAGTGATGG + Intergenic
1004975041 6:20955850-20955872 TTTATGTGCTGGAAGACTGAAGG - Intronic
1007326087 6:41061043-41061065 ATGTTGTGCTGGAAGAGTGATGG + Intronic
1007712344 6:43832731-43832753 TTGATTTACTTAAAGAGTGCGGG - Intergenic
1009024314 6:57979936-57979958 AGGAATTGCTGAAAGAGTGATGG + Intergenic
1009199895 6:60731473-60731495 AGGAATTGCTGAAAGAGTGATGG + Intergenic
1009853632 6:69231600-69231622 TTGATGTGCTGCTACAGTTAGGG + Intronic
1010232830 6:73550709-73550731 TTGATGGGATTAAAGAGTGGAGG + Intergenic
1010864023 6:80950286-80950308 TTGATGCTCAGAGAGAGTGAAGG + Intergenic
1013713586 6:112930860-112930882 TTGGTGTTCAGAAAGTGTGAAGG + Intergenic
1016854702 6:148655577-148655599 ATGATGTCCTAGAAGAGTGAAGG - Intergenic
1018340823 6:162849167-162849189 TTGGCGTGCAAAAAGAGTGAAGG + Intronic
1019837505 7:3403731-3403753 GTGCTCTTCTGAAAGAGTGAGGG + Intronic
1020029960 7:4925693-4925715 TTAATGATCGGAAAGAGTGAGGG - Intronic
1022691764 7:32662881-32662903 GTCATTTGCTGAGAGAGTGAAGG + Intergenic
1025108001 7:56188951-56188973 GTGATGTGCTGAGAGCCTGAAGG - Intergenic
1027720671 7:81737569-81737591 GTGATATCCTGAAAGACTGATGG + Intronic
1028590136 7:92484760-92484782 TGGATGTCCTCACAGAGTGAGGG + Intergenic
1033605578 7:142925830-142925852 CTGATGAGCTGAGTGAGTGATGG - Intronic
1033807709 7:144973441-144973463 TTGTTGAGGAGAAAGAGTGAAGG + Intergenic
1033857104 7:145577353-145577375 TTCATGTGCTGGAATATTGAAGG - Intergenic
1034031877 7:147775916-147775938 TTGAAGGGCTGAAATAATGAGGG + Intronic
1035206302 7:157295906-157295928 TTGAGGTGAAGAGAGAGTGAAGG + Intergenic
1036225802 8:6956443-6956465 TCAATGTGCTGAAAGGTTGATGG + Intergenic
1038238295 8:25783765-25783787 TTCATGTGAAGAAAGAGTGATGG - Intergenic
1038903302 8:31868655-31868677 TGGCAGTGGTGAAAGAGTGATGG - Intronic
1039232890 8:35468327-35468349 TTGATTTTCTCAAAGAGTGCAGG - Intronic
1039317350 8:36388039-36388061 TTTATATTCTGAAAGAATGAAGG - Intergenic
1039578510 8:38644919-38644941 TGGTTGCGCTGAAAGAGGGAAGG - Intergenic
1042156101 8:65845652-65845674 TTAATATGCTGAAAGAGCTAAGG - Intergenic
1042870926 8:73398611-73398633 TTTATGTGCTGAACGACTGGGGG - Intergenic
1045451375 8:102329895-102329917 TCAATGTGCTGAATGAGTGAAGG + Intronic
1046729208 8:117707242-117707264 CTCATGTGGTGAAAGAGTTAAGG + Intergenic
1047026062 8:120825932-120825954 CTCATGTTCTGATAGAGTGAAGG + Intergenic
1048774188 8:137927035-137927057 TTGATTTGGAGAAAGATTGACGG + Intergenic
1051432038 9:16989246-16989268 TTGATGTGGTGATAGTGTTACGG - Intergenic
1051605853 9:18917285-18917307 TTGTTTTGCTGAAAAAATGATGG + Intergenic
1051701356 9:19827647-19827669 TTGATTTGCAGAATGAGGGAGGG - Intergenic
1051898412 9:22012392-22012414 TAGGTGAGCTGGAAGAGTGAAGG - Intronic
1052388653 9:27852152-27852174 TTGATGTTCTGAAAGAGCACAGG - Intergenic
1052427237 9:28321498-28321520 TTGATGTGCTGTATTAGTTAAGG + Intronic
1052758233 9:32563902-32563924 AAGAAGTGCTGAAAGAATGATGG - Intronic
1055869971 9:80864963-80864985 TTGATGTGCTAAGAGAGGAAAGG - Intergenic
1058208977 9:102143426-102143448 TTGATGTGTGGAAATAGTGGTGG + Intergenic
1058335431 9:103822534-103822556 TTAATGTGCTGAAATTGTCAAGG + Intergenic
1060499897 9:124145185-124145207 TTGATGTGCTGGGAGGGTAACGG + Intergenic
1060748674 9:126154641-126154663 GTGATTTGCTGCAAGAGTGCTGG - Intergenic
1060992618 9:127857551-127857573 TGGATTTGCTGAAAGCATGAGGG + Intergenic
1186238114 X:7535431-7535453 TTGATGTGGTTACAGAGTTAGGG - Intergenic
1189209016 X:39267085-39267107 TTGGTGAGCTTAAAGAGTGTGGG - Intergenic
1189758169 X:44293378-44293400 ATGATGTGGTGAAATTGTGATGG - Intronic
1190296951 X:49033293-49033315 TTTAGGTGCTGACATAGTGAGGG + Intronic
1190508605 X:51154515-51154537 TTAAGGTACTTAAAGAGTGATGG + Intergenic
1191962354 X:66717992-66718014 TTGATGGGATGTAAGAGTTAAGG + Intergenic
1192372588 X:70526883-70526905 AGGAAGTGCTGAAAGAATGATGG + Intergenic
1193669201 X:84363538-84363560 TTGATTTGCTGGAAGTGTGCTGG + Intronic
1195079155 X:101354970-101354992 CTGATATGCTGAAAGAATTAAGG + Intronic
1196216558 X:113059262-113059284 ATGATGTGCAGTAAGAGTCAAGG + Intergenic
1198449223 X:136750086-136750108 TTGATGTGGAGAAAGACTAAGGG + Intronic
1199306427 X:146272168-146272190 GCGATGTGCTGAAATAGGGAAGG + Intergenic
1201457250 Y:14181985-14182007 TTGATGTGGTTACAGAGTTAGGG - Intergenic
1201589093 Y:15593836-15593858 GTGCTGTGCTAAAAGAGTGAGGG - Intergenic
1201693038 Y:16790368-16790390 TTGGTGTGCTGAAAGTGACAGGG + Intergenic