ID: 1102422365

View in Genome Browser
Species Human (GRCh38)
Location 12:112814078-112814100
Sequence GAGTGTGCACGAGTGTGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 6, 3: 42, 4: 320}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102422365 Original CRISPR GAGTGTGCACGAGTGTGTAG GGG Intronic
900137412 1:1123952-1123974 GTGTGTGCAGGAGTGTGTGCAGG - Intergenic
900194209 1:1366298-1366320 GAGTGTGAACGAATGTGGATTGG + Intergenic
900194283 1:1367122-1367144 GAGTGTGGATGAGTGTGAATTGG + Intergenic
900194310 1:1367503-1367525 GAGTGTGAATGAGTGTGGATTGG + Intergenic
900222916 1:1518829-1518851 GACTGTGCCCGAGTGTGCAGGGG - Intronic
900295253 1:1945861-1945883 GTGTGTGCACGTGTGTGTGTGGG + Intronic
900295258 1:1945927-1945949 ATGTGTGCACGTGTGTGTGGGGG + Intronic
900526030 1:3129114-3129136 GAGTGTGCACGTGCGTGTGTGGG + Intronic
900818955 1:4871568-4871590 GTGTGTGCATGTGTGTGTACAGG - Intergenic
901032415 1:6314962-6314984 GAGTGAGCCCGAGGGTGTGGAGG - Intronic
902881659 1:19375526-19375548 GGGTCTGCAACAGTGTGTAGTGG - Intronic
903283929 1:22265614-22265636 AAGTGTGCATGTGTGTGCAGGGG - Intergenic
903499621 1:23794034-23794056 GAGGGGGCATGAGTGGGTAGAGG - Intronic
905516249 1:38564172-38564194 GAGTGTGCATGTGTGTGAGGAGG + Intergenic
905971647 1:42146341-42146363 GAGTGCTCTCGTGTGTGTAGGGG - Intergenic
912504583 1:110147539-110147561 GTGTGTTAAGGAGTGTGTAGGGG + Intergenic
912519547 1:110235619-110235641 CAGTGTGCAGGAGGGTGGAGGGG + Intronic
916693329 1:167212146-167212168 GTGTGTGTACCTGTGTGTAGAGG + Intergenic
917414781 1:174797545-174797567 GTGTGTGCAGGAGGGTGTGGGGG + Intronic
917990630 1:180374264-180374286 GAGTGTGCATGTGAGTGTAAGGG - Intronic
920059097 1:203215332-203215354 GAGTGGCCATGAGTTTGTAGAGG + Intronic
920553704 1:206887541-206887563 GAGTGTGGACGATTGTGTGCTGG + Intergenic
920668118 1:207981525-207981547 GTGTGTGCATGTGTGTGTAGAGG + Intergenic
921339929 1:214124621-214124643 GGGTGTGCATGAGTCTGTGGGGG + Intergenic
921644211 1:217594789-217594811 GTGTGTGCACATGTGTGTAAAGG + Intronic
922190721 1:223316418-223316440 GAGTGTGGAGGAGAGTGGAGAGG - Intronic
923564279 1:235065023-235065045 GAGTGTGGAAAAGAGTGTAGAGG + Intergenic
923727631 1:236521237-236521259 GAGTGTGTATGAGTGTGTTTTGG + Intronic
1062794875 10:337204-337226 GTGTGTGCAAGTGTGTGTGGTGG + Intronic
1062885444 10:1012384-1012406 GAGTGTGGCAGAGTGTGTATGGG - Intronic
1062988794 10:1795760-1795782 GAGTGTGCATGTTTGTGTAGGGG - Intergenic
1063541645 10:6940017-6940039 GTGTGTGCGCGTGTGTGTAAGGG - Intergenic
1064283424 10:13971061-13971083 GTGTGTGCACCTGTGTGTTGGGG - Intronic
1065196918 10:23275574-23275596 GTGTGTGTATGTGTGTGTAGGGG - Intronic
1069095463 10:64254056-64254078 GACTGTGGAGGAGTGTGTTGAGG + Intergenic
1069744236 10:70704945-70704967 GAGAGTGTATGAGTGTATAGAGG - Intronic
1069744245 10:70705012-70705034 GAGTGTGCGAGTGTGTGAAGGGG - Intronic
1069793044 10:71035560-71035582 TAGAGTGCACACGTGTGTAGAGG - Intergenic
1070968677 10:80545698-80545720 GGGTGTGCATGGGTGAGTAGCGG + Intronic
1071513789 10:86283548-86283570 GTGTGTGCATGTGTGTGTAAGGG - Intronic
1072468580 10:95691036-95691058 GAGTGTGCAGGATGGTGTCGGGG + Intronic
1073204564 10:101762075-101762097 GAGTGTGTACGAGTGTGTGAGGG - Intergenic
1073255544 10:102148683-102148705 GAGCGTGCAATAGTGAGTAGAGG + Exonic
1073488413 10:103836639-103836661 GTGTGTGCACTCGTGTGTTGGGG - Intronic
1075464073 10:122638300-122638322 GGGTGTGAACGAGTGTGAATGGG - Intronic
1075654860 10:124154498-124154520 GAGTGTGCATGTGTGTGTGGGGG - Intergenic
1075654938 10:124155074-124155096 GAGTGTGCATGCATGTGTGGGGG - Intergenic
1075831530 10:125416069-125416091 GTGTGTGCACACGTGTGTATGGG - Intergenic
1076605628 10:131687596-131687618 GAGTGTGCACCTGTGTGTGCTGG - Intergenic
1077009423 11:373588-373610 GAGTGTGCGCAAGTGTGCACAGG - Intronic
1077144588 11:1039249-1039271 GTGTGTGCATGTGTGTGTATAGG + Intergenic
1077281025 11:1745821-1745843 GTGTGTGCACGGGTGTGTGAGGG - Intronic
1077281032 11:1745924-1745946 GTGTGTGCACAAGTGTGTGTGGG - Intronic
1077281047 11:1746216-1746238 GTGTGTGCACAAGTGTGTGAGGG - Intronic
1077721854 11:4637809-4637831 GTATGTGCACGTGTGTGTTGTGG + Intergenic
1078738057 11:14039422-14039444 GTGTGTGTATGTGTGTGTAGGGG + Intronic
1078845445 11:15115227-15115249 GAGTGTGTCAGAGTGTGTGGTGG + Intronic
1079296574 11:19240658-19240680 GCCTGTGCACGTGTGTGTAAGGG - Intronic
1079788189 11:24702009-24702031 GAGTGTGCACGAGTCTGACTGGG - Intronic
1081066736 11:38551151-38551173 TATTGTGCAGGATTGTGTAGTGG - Intergenic
1081707259 11:45190118-45190140 GTGTGTGCACGTGTGTGTGTAGG - Intronic
1081755451 11:45541038-45541060 GAGTATGCAAGAGAGTGAAGTGG - Intergenic
1082223693 11:49674942-49674964 GTGTGTGCATGAGTGTGTTTGGG - Intergenic
1084477935 11:69399388-69399410 ATGTGTGCATGTGTGTGTAGGGG + Intergenic
1085781226 11:79410942-79410964 GTGTGTGTATGTGTGTGTAGAGG - Intronic
1086625361 11:88944320-88944342 GTGTGTGCATGAGTGTGTTTGGG + Intronic
1086905404 11:92412849-92412871 GGCTGTGCATGTGTGTGTAGGGG - Intronic
1088718337 11:112570013-112570035 GAGTGAGCACGAGAGAGGAGAGG + Intergenic
1088736094 11:112728912-112728934 ATGTGTGCGCCAGTGTGTAGGGG + Intergenic
1088901257 11:114119378-114119400 GTGTGTGCACATGTGTGTACAGG + Intronic
1089281940 11:117380877-117380899 GTGTGTGCACGTGTGTGTACTGG + Intronic
1090428828 11:126629233-126629255 GACTGTGCACATGTGGGTAGAGG + Intronic
1090527929 11:127557378-127557400 GTGTGTGTATGAGTGAGTAGTGG - Intergenic
1091559983 12:1604897-1604919 GAGTGTGTGAGAGTGTGTGGGGG + Intronic
1091560019 12:1605137-1605159 GAGTGTGTGTGAGTGTGTGGGGG + Intronic
1091681212 12:2528492-2528514 GGGTGTGCACAAGTGTGCAGAGG - Intronic
1091713775 12:2761535-2761557 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1092312563 12:7374394-7374416 GTGTGTGCACGTGTGTGTAGAGG + Intronic
1092937076 12:13374092-13374114 GTGTGTGCATGTGTGTGTTGGGG + Intronic
1097759865 12:63450659-63450681 AAGTGTGCATCAGTCTGTAGTGG - Intergenic
1102422365 12:112814078-112814100 GAGTGTGCACGAGTGTGTAGGGG + Intronic
1102695847 12:114798799-114798821 GTGTGTGCACGTGTGTGTAAGGG + Intergenic
1104568075 12:129903189-129903211 GAGTGTGTGGGAGTGTGTGGAGG - Intronic
1104916545 12:132268264-132268286 GTGTGTGCGTGCGTGTGTAGGGG - Intronic
1104929610 12:132331265-132331287 GTGTATGCACATGTGTGTAGGGG + Intergenic
1105024613 12:132839715-132839737 GAGTTTGCACGTTTGTGCAGGGG - Intronic
1106333601 13:28763052-28763074 GCATGTGCACGTGTGTGTAGGGG + Intergenic
1106486070 13:30173881-30173903 GTGTGTGCACATGTGTGTGGGGG - Intergenic
1107842032 13:44467987-44468009 GTGTGTGCGCGTGTGTGTATAGG - Intronic
1108537457 13:51399724-51399746 GTGTGTGTGCGTGTGTGTAGTGG + Intronic
1111641416 13:90975377-90975399 GAGTTTGCAGGGGTGTGTGGAGG - Intergenic
1113293415 13:108931078-108931100 GAGTGTACACAAGTGTGTAAGGG - Intronic
1113672411 13:112183939-112183961 GAGTCGGCACGAGTGTGTGCCGG - Intergenic
1113721747 13:112562618-112562640 GAGTGGGCAGGAGTGGGTAGAGG + Intronic
1113870563 13:113557184-113557206 GTGTGTGCACATGTGTGTAGGGG + Intergenic
1114069536 14:19096594-19096616 GAGTGTGTGTGAGTGTGTGGGGG + Intergenic
1114092726 14:19303409-19303431 GAGTGTGTGTGAGTGTGTGGGGG - Intergenic
1115056120 14:29129272-29129294 GTGTGTGTATGTGTGTGTAGGGG - Intergenic
1115413290 14:33101134-33101156 GTGTGTGCAGGTGTGTGTGGGGG - Intronic
1119282378 14:73420463-73420485 GTGTGTGCATGTGTGTGTATAGG + Intronic
1120753781 14:88222626-88222648 GAGACTGCACATGTGTGTAGGGG + Intronic
1121410927 14:93747601-93747623 GAGTGTGTGAGAGTGTGTGGGGG + Intronic
1122019861 14:98828774-98828796 GAGTGGGCATGAGTGCTTAGAGG + Intergenic
1122020710 14:98835753-98835775 GTGTGAGCATGAGTGTGTAGGGG - Intergenic
1122828623 14:104384356-104384378 GAATGTGCACATGTGTGAAGGGG + Intergenic
1122979783 14:105186310-105186332 GGGTGTACATGAGTGTGTGGGGG + Intergenic
1124869277 15:33524115-33524137 GTGTGTGTATGTGTGTGTAGGGG - Intronic
1127526399 15:59796438-59796460 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1133045697 16:3087211-3087233 GGGTGTGCTCGAGGGTGTGGGGG + Intergenic
1137490912 16:48931871-48931893 GGGTGTGCATGAGCGTGTATGGG - Intergenic
1138340534 16:56286189-56286211 GTGTGTGCAGATGTGTGTAGCGG - Intronic
1138522376 16:57578224-57578246 GTGTGTGCATGTGTGTGTATGGG + Intronic
1139595986 16:67958561-67958583 GAGTGGGCTGGAGTGTGGAGAGG - Intronic
1140476947 16:75243853-75243875 GAGGATGCATGAGTGTGTGGTGG - Intronic
1140513581 16:75526223-75526245 GAGTGTGCATGTGTGTGTGTGGG + Intergenic
1140529883 16:75655976-75655998 GTGTGTGCACGTGTGTGTGAGGG - Intronic
1141928981 16:87188206-87188228 ATGTGTGCACGTGTGAGTAGGGG + Intronic
1141983420 16:87563866-87563888 GTGTGTGCGCGTGTGTGTTGGGG + Intergenic
1141983690 16:87565849-87565871 GTGTGTGCGTGTGTGTGTAGGGG + Intergenic
1142477421 17:197693-197715 GTGTGTACATGTGTGTGTAGTGG + Intergenic
1142561604 17:812573-812595 GTGTGTGCACGTGTGTGTGATGG + Intronic
1142562020 17:815855-815877 GTGTGTGCACGTGTGTGCACAGG - Intronic
1142627600 17:1202490-1202512 GAGTGGGCACGTGTGTGTTTGGG - Intronic
1142639179 17:1275739-1275761 GAGTGTGTGTGAGTGTGTGGGGG + Intergenic
1144757938 17:17691587-17691609 GAAAGTGCAGGAGTGTGTTGTGG + Intronic
1145856154 17:28160136-28160158 GAGTATCCACGAGTGTGGATAGG + Intronic
1147317136 17:39626475-39626497 GAGTGTGCAGGGGTGTGCCGGGG - Intergenic
1147957828 17:44147067-44147089 GAGAGCACACGAGTGTGTATTGG + Intronic
1148330173 17:46809469-46809491 GTGTGTGTACGTGTGTGTTGGGG - Intronic
1148550256 17:48545987-48546009 GTGTGTGCATGAGTGTGGTGGGG + Intergenic
1148736987 17:49870388-49870410 GTGTGTGCACGATTGTGAGGCGG + Intergenic
1149051895 17:52314887-52314909 GAGTGTGTATGTGTGTGTTGAGG - Intergenic
1149117985 17:53122190-53122212 GTGTGTGTATGTGTGTGTAGAGG + Intergenic
1149659777 17:58328151-58328173 GTGTGTGCGCGAGTATGTGGAGG + Intronic
1151227005 17:72655212-72655234 GCGTGTGCACGGGTGTGTGGAGG - Intronic
1151826586 17:76527333-76527355 GAGACTGCACGAGTGTGCACAGG + Intergenic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152191894 17:78893203-78893225 GTGTGTGCATGTGTGTGCAGGGG + Intronic
1152245726 17:79183717-79183739 GCGTGTGCGCGCGTGTGTAGCGG + Intronic
1152286955 17:79418313-79418335 GTGTGTGCACGCGTGTGCATGGG - Intronic
1152733417 17:81984828-81984850 GTGTGTGCAGGGGTGTGTGGGGG - Intronic
1152859882 17:82690184-82690206 GAGTGTGCATGTGTGTCCAGGGG + Intronic
1152859904 17:82690342-82690364 GAGTGTGTACGTGTGTCCAGGGG + Intronic
1152859934 17:82690582-82690604 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1152859947 17:82690662-82690684 GAGTGTGCACGTGTGTGCAGGGG + Intronic
1152859958 17:82690741-82690763 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1152859969 17:82690820-82690842 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1153325525 18:3815400-3815422 GTGTGTGCACGGGTGTGCAGAGG - Intronic
1153539545 18:6139480-6139502 GTGTGTGCATGTGTGTTTAGGGG - Intronic
1153597636 18:6744163-6744185 GAGTGAGCATGAGTTAGTAGGGG + Intronic
1153677959 18:7472348-7472370 GAGTGTGTGAGAGTGTGTGGCGG - Intergenic
1154070029 18:11145992-11146014 GTGTGAGTATGAGTGTGTAGGGG - Intronic
1154080252 18:11249146-11249168 GTGTGTGCATGTGTGTGCAGTGG - Intergenic
1154227451 18:12519329-12519351 GTGTGTGCACATGTGTGTATAGG - Intronic
1156669612 18:39452568-39452590 GTATGTGCATGTGTGTGTAGGGG - Intergenic
1157113759 18:44844326-44844348 GTGTGTGCACGTGTGTGTGTGGG - Intronic
1157600849 18:48892368-48892390 GAGTGTGCACGAGGGAGTCAGGG - Intergenic
1157958197 18:52122803-52122825 TAGTGAGCAAGAGAGTGTAGTGG + Intergenic
1158109124 18:53920420-53920442 GTGTGTGCACGTGTGTGTATGGG + Intergenic
1159903873 18:74073133-74073155 GTGTGTGTATGTGTGTGTAGGGG - Intergenic
1159963649 18:74575739-74575761 GTGTGTGCGCGTGTGTGAAGGGG + Intronic
1160357892 18:78244193-78244215 GTGTGTGCGCGTGTGTGAAGTGG - Intergenic
1160404551 18:78636675-78636697 GAGTGTGCATGGGTGTGTAGAGG + Intergenic
1162015320 19:7843328-7843350 GAGTGTGCATGTGTGTGTATAGG + Intronic
1162015345 19:7843646-7843668 GTGTGTGCATGTGTGTGTATAGG + Intronic
1165211136 19:34236755-34236777 GGGTGTGGGCGAGTGTGCAGAGG - Intergenic
1166196185 19:41207340-41207362 GAGTGTGTATGTGTGTGTGGAGG - Exonic
1167103465 19:47417920-47417942 GTGTGTGCATGTGTGTGTGGGGG - Intronic
1168057513 19:53871393-53871415 CAGTATGCAGGAGTGTGGAGGGG + Intronic
925059230 2:878332-878354 GAGTGTGCGTGTGTGTGTAGGGG - Intergenic
925059258 2:878487-878509 GAGTGTGCATGTGTATGTAGGGG - Intergenic
925059265 2:878527-878549 GGGCGTGCATGTGTGTGTAGTGG - Intergenic
925126629 2:1461699-1461721 CTGTGTGCACGTGTGTGTATGGG - Intronic
925462033 2:4072006-4072028 AAGTGTGCATGTGTGTGTGGTGG + Intergenic
925465888 2:4107070-4107092 GCGCGTGCATGTGTGTGTAGGGG + Intergenic
925587054 2:5474884-5474906 GAGTGTGCGCAGGTGTGGAGAGG - Intergenic
926119370 2:10233794-10233816 GAGTGTGCATGAGTGTATGTGGG + Intergenic
926119373 2:10233830-10233852 GAGTGTGCATGAGTGTATATGGG + Intergenic
926119394 2:10234058-10234080 GAGTGTGCATGAGTGTATGTGGG + Intergenic
926119397 2:10234082-10234104 GAGTGTGCATGAGTGTGGGTCGG + Intergenic
926906129 2:17807377-17807399 GTGTGTGCTCGTGTGTGTTGGGG - Intergenic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
929011017 2:37444876-37444898 GGGTGTGTATGTGTGTGTAGGGG - Intergenic
929315855 2:40477753-40477775 GTGTGTGCACGTGTGTGTAGGGG + Intronic
929581802 2:43086054-43086076 GTGTGTGCACGTGTGTGGTGGGG - Intergenic
931937357 2:67214031-67214053 GGGTGTGTATGTGTGTGTAGGGG - Intergenic
932300673 2:70664729-70664751 GAGTGTGCAAGTGTGTGTGTGGG + Intronic
932412178 2:71554007-71554029 GTGTGTGCACCAGTGGGTGGTGG - Intronic
932416650 2:71577669-71577691 GAGTGTGAAAGAGTGTGTGTGGG - Intronic
932627636 2:73311096-73311118 GTGTGTGTACGTGTGTGTATGGG + Intergenic
933009945 2:77048229-77048251 GTGTGTGCATGTGTGTGTAATGG + Intronic
936075672 2:109400199-109400221 ATGTGTGCAAGTGTGTGTAGGGG - Intronic
936285894 2:111181135-111181157 GTGTTTGCACGAGTGTGTATGGG + Intergenic
937216174 2:120315042-120315064 GTGTGTGGACGAGTGTGCCGGGG - Intergenic
940036327 2:149315621-149315643 GTGTGTGCATGAGTATGTGGCGG - Intergenic
941264961 2:163349242-163349264 GTGTGTGTGCGTGTGTGTAGAGG - Intergenic
941318759 2:164028513-164028535 GAGAGGGCACGAATGTGAAGGGG + Intergenic
944083603 2:195818695-195818717 GTGTGTGGATGAGTGTGCAGAGG - Intronic
946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG + Intergenic
947099019 2:226598979-226599001 GCATGTGCATGTGTGTGTAGAGG + Intergenic
947730338 2:232425190-232425212 GAGTTTGCACAAGTATTTAGAGG - Intergenic
1170045629 20:12082423-12082445 GTGTGTGCACGTGTGTGTCTGGG - Intergenic
1170210774 20:13844380-13844402 GTGTGTGTGCGTGTGTGTAGCGG + Intergenic
1172100730 20:32483109-32483131 GAGTGTGCCCGAGAGTGGAGGGG - Intronic
1173882289 20:46424615-46424637 GTGTGTGCGTGTGTGTGTAGGGG + Intronic
1174103558 20:48145933-48145955 GTCTATGCACGAGTGTGTACCGG + Intergenic
1174786984 20:53442180-53442202 GTGTGTGTACGTGTGTGTAAAGG + Intronic
1174863520 20:54114367-54114389 GAGTGGGCAGGAGTGGGTAGTGG + Intergenic
1174863530 20:54114401-54114423 GAGTGGGCAGGAGTGGGGAGTGG + Intergenic
1174863540 20:54114435-54114457 GAGTGGGCAGGAGTGGGGAGTGG + Intergenic
1175270706 20:57731934-57731956 GAGAGAGCACGGGTGTGAAGGGG + Intergenic
1175320730 20:58086200-58086222 GAGTGTGGACGAGTGGGGAATGG - Intergenic
1175657352 20:60782620-60782642 GAGCGTGCACACGTGTGTGGCGG + Intergenic
1175850420 20:62087930-62087952 GAGTGTGCAGGTGAGTGTACAGG - Intergenic
1176020018 20:62957857-62957879 GCGTGTGCAAGTGTGTGTATGGG + Intronic
1178708257 21:34890970-34890992 GAGGGAGCACGAGGGTGTGGCGG + Intronic
1178759927 21:35392581-35392603 GAGTGTGCAGGAGTTGGGAGGGG + Intronic
1178844728 21:36165424-36165446 GTGTGTGCATGTGTGTGTATGGG + Intronic
1179827550 21:43975386-43975408 GTGTGTGCACTGGTGTGTGGTGG + Intronic
1179914203 21:44465941-44465963 GAGCATGCACGTGTGTGTACAGG - Intergenic
1180488003 22:15819157-15819179 GAGTGTGTGTGAGTGTGTGGGGG + Intergenic
1180611535 22:17101350-17101372 GTGTGTGCACGCGTGTGTGCAGG - Intronic
1181085687 22:20438334-20438356 GAGTGCGCAGGAGTGCGCAGGGG - Intronic
1182012647 22:27013310-27013332 GTGTGTGCACGAGTGTGACAGGG + Intergenic
1183278190 22:36914564-36914586 GTGTGTGCAGGTGTGTGTACTGG + Intronic
1184026025 22:41857176-41857198 GAGTGTGGACGGGAGTGAAGAGG + Intronic
1184288469 22:43485661-43485683 TAGTGTGCACACGTGTGTTGAGG - Intronic
1184739619 22:46420089-46420111 GAGTATGCACGAGTGTGGGTAGG - Intronic
1184914944 22:47562951-47562973 GTGTGTGTATGTGTGTGTAGGGG + Intergenic
1184924669 22:47628936-47628958 GAGTGTGTGAGAGTGTGTGGAGG + Intergenic
1185079966 22:48704185-48704207 GTGTGTGCGCGTGTGTGTTGAGG - Intronic
952276581 3:31883185-31883207 GTGTCTGCAGGTGTGTGTAGGGG - Intronic
953004836 3:38968579-38968601 GTGTGTGCACATGTGTGTTGGGG - Intergenic
953294507 3:41700435-41700457 GAGTGTGAATGTGTGTGGAGGGG - Intronic
954633952 3:52061446-52061468 GAGTGTGCAGGACAGTGAAGGGG + Intergenic
955000662 3:54924517-54924539 GAATGTGGAGGAGTGTGTAAGGG - Intronic
957580628 3:82067817-82067839 GAATGAGCACCACTGTGTAGTGG + Intergenic
957597289 3:82283624-82283646 AAGTGTGCACTTGTGTGTGGTGG - Intergenic
958837296 3:99160047-99160069 GAGTTTGGAAGAGTGTGGAGGGG - Intergenic
960223150 3:115140539-115140561 GAGTGTGTATGTGTGTGTGGTGG + Intronic
962157471 3:132963477-132963499 GATTGTGAAGGAGTGAGTAGAGG - Intergenic
966857125 3:184202430-184202452 GTGTGTGCATGTGTGTGCAGTGG - Intronic
967241253 3:187441687-187441709 GTGTGTGTGCGTGTGTGTAGGGG - Intergenic
967330464 3:188284643-188284665 ATGTGTGCATGAGTGTGTATTGG + Intronic
967500207 3:190188499-190188521 GTGTGTGCATGAGGGGGTAGAGG - Intergenic
967748724 3:193088932-193088954 GTGTGTGCATGTGTGTGTGGGGG - Intergenic
968222176 3:196947507-196947529 GAGTGAAGAGGAGTGTGTAGTGG + Exonic
968627632 4:1634337-1634359 GTGTGTGGACGGGTGTGGAGGGG - Intronic
969301417 4:6299482-6299504 GGGTGTGCACGTGTGTGTAGGGG + Intronic
969301432 4:6299573-6299595 GTGTGTGAATGTGTGTGTAGGGG + Intronic
969301444 4:6299645-6299667 GTGTGTGAATGTGTGTGTAGGGG + Intronic
969301452 4:6299693-6299715 GTGTGTGAATGTGTGTGTAGGGG + Intronic
969301465 4:6299770-6299792 GTGTGTGAATGTGTGTGTAGGGG + Intronic
969301497 4:6299965-6299987 GTGTGTGCACGTGTGTGTACGGG + Intronic
969609310 4:8218130-8218152 GTGTGTGCACGTGTGTGTGTTGG + Intronic
970017094 4:11524115-11524137 GGGTGGGCCCGAGTGTGTGGTGG - Intergenic
970399604 4:15704600-15704622 GAGTGTGAAGGAGGGTGGAGAGG + Intronic
970466986 4:16334053-16334075 GAGTGTGCAATAATGGGTAGAGG + Intergenic
972348219 4:38211541-38211563 GAGACTGCACGAGTGGGCAGGGG + Intergenic
972351436 4:38239790-38239812 GAGTGTGCACACGTGTGTGAAGG + Intergenic
975601784 4:76107943-76107965 GTGTGTGCATGTGTGTGTTGGGG + Intronic
978360194 4:107923472-107923494 GTGTGTGTATGTGTGTGTAGGGG - Intergenic
980613691 4:135191840-135191862 ATGTGTGCACGAGTTTGTAAAGG - Intergenic
984043364 4:174766016-174766038 GAGGGTGTAAGTGTGTGTAGAGG - Intronic
984867305 4:184292714-184292736 GAGTGTGTATGTGTGTGTGGAGG + Intergenic
985515998 5:344900-344922 GCGTGTGCAGGTGTGTGTGGAGG + Intronic
985564912 5:610799-610821 GTGTGTGCAACAGTGTGCAGGGG - Intergenic
986546157 5:8899749-8899771 CTGTGTGCAAGAATGTGTAGGGG + Intergenic
988909126 5:35822069-35822091 GTGTGTGAATGAGTGTGTGGAGG + Intergenic
989740504 5:44765679-44765701 GTGTGTGCACATGTGTGTATCGG - Intergenic
990007519 5:50961046-50961068 GAATGTGCTTGAGTGTGTACAGG - Intergenic
992554848 5:77893111-77893133 GAGTGTGGACGAGTATGTCCAGG - Intergenic
993431280 5:87834704-87834726 GAGTGCACACGTGTGTTTAGTGG - Intergenic
993721004 5:91321947-91321969 GAATGTGGACAAGTGTATAGAGG + Intergenic
994939755 5:106307352-106307374 GAGTGTGCCCTGGTGTGGAGTGG - Intergenic
996300268 5:121973598-121973620 GTGTGTGCATGTGTGTGTGGGGG + Intronic
997827172 5:137116761-137116783 CAGTGTGCATGTGTGTGTTGGGG - Intronic
998428315 5:142048791-142048813 GAGTCTGAAGGAGTGAGTAGGGG - Intergenic
1000166147 5:158650613-158650635 GAATGAGCAGGGGTGTGTAGGGG - Intergenic
1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG + Intergenic
1002213051 5:177609667-177609689 GAATGTGCACCAGGGTGTGGCGG - Exonic
1003917928 6:10805052-10805074 GTGTGTGCATGTGTGTGTCGGGG + Intronic
1004351960 6:14898005-14898027 GTGTGTGCGCGTGTGTGTGGTGG - Intergenic
1004496524 6:16168581-16168603 GAGTGTGGGAAAGTGTGTAGTGG + Intergenic
1005430445 6:25751120-25751142 GGGTGTGCATGGGTGTGTAGGGG + Intergenic
1005798029 6:29388599-29388621 GAGTGTGTACGACTGTTTAATGG - Intronic
1006173139 6:32106980-32107002 GTGTGTGCACGTGTGTGCATGGG - Intronic
1007384260 6:41510047-41510069 GTGTGTGTACGTGTGTGTTGGGG - Intergenic
1007784415 6:44271507-44271529 GCGTGTGCACAAGTGTGCATGGG - Intronic
1010373742 6:75141745-75141767 GTGTGTGCATGTATGTGTAGTGG - Intronic
1012930324 6:105309709-105309731 GAGTGTGCAAGAGTGTCTGGGGG - Intronic
1013072855 6:106744573-106744595 GTATGTGCATGTGTGTGTAGGGG + Intergenic
1015221560 6:130809778-130809800 GAGTGGGGACGAGTGTGAAGAGG + Intergenic
1015953179 6:138574433-138574455 GAGTGTGCACAGATGTGTGGCGG - Intronic
1017851897 6:158311398-158311420 GAGTGTTCTCGTGTTTGTAGAGG + Intronic
1018187096 6:161274695-161274717 GTGTGTGCACGCCTGTGCAGTGG - Intergenic
1018378837 6:163239675-163239697 GAGTGTGCGTGTGTGTGTAGGGG - Intronic
1018980717 6:168599671-168599693 GAGAGTGTGAGAGTGTGTAGGGG - Intronic
1019067664 6:169315977-169315999 GTGTGTGAACTAGTGTGCAGAGG - Intergenic
1019407792 7:892906-892928 GGGTGTGCAGGTGTGTGTACTGG + Intronic
1019553816 7:1618675-1618697 GTGTGTGTAGGTGTGTGTAGGGG + Intergenic
1019553871 7:1619022-1619044 GTGTGTGTAGGTGTGTGTAGGGG + Intergenic
1019553882 7:1619100-1619122 GTGTGTGTAGGGGTGTGTAGGGG + Intergenic
1019553885 7:1619110-1619132 GGGTGTGTAGGGGTGTGTAGGGG + Intergenic
1019553904 7:1619227-1619249 GGGTGTGTAGGTGTGTGTAGGGG + Intergenic
1019553913 7:1619283-1619305 GGGTGTGTAGGTGTGTGTAGGGG + Intergenic
1019630721 7:2047774-2047796 GAGTGTGCATGTGTCTGCAGAGG - Intronic
1021446696 7:20741775-20741797 GTGTGTGCATGTGTGTGTGGTGG - Intronic
1022230898 7:28410862-28410884 GCGATTGCACGAGTGTGTTGTGG - Intronic
1024148786 7:46545380-46545402 GAGTGTGCACGTGTGTGCATTGG - Intergenic
1027613503 7:80392079-80392101 GAGTGTGCACGATTGAGAACAGG + Intronic
1030395472 7:108981030-108981052 GTGTGTGTATGTGTGTGTAGTGG - Intergenic
1032023379 7:128422280-128422302 GTGTGTGTAAGTGTGTGTAGGGG + Intergenic
1032348733 7:131140547-131140569 GAGAGAGCACGAGTGAGAAGAGG - Intronic
1033927271 7:146478673-146478695 GTGTGTGTACATGTGTGTAGAGG - Intronic
1034423208 7:150999841-150999863 GAGTGTGTGTGAGTTTGTAGGGG + Intronic
1034423220 7:150999898-150999920 GAGTGTGTGTGAGTTTGTAGGGG + Intronic
1034480093 7:151313196-151313218 GAGTGTAGAGGAGTGTGGAGTGG + Intergenic
1034869547 7:154671849-154671871 GTGTGTGCATGTGTGTGTTGGGG - Intronic
1034937148 7:155207632-155207654 GAGTGTGTATGAGTGTGTGTGGG + Intergenic
1037172829 8:15913886-15913908 GTGTGTGCACGTGTGTCTAAAGG + Intergenic
1038680259 8:29660379-29660401 GTGTGTGCACACGTGTGTATGGG - Intergenic
1038729009 8:30110379-30110401 GCGTGCGCGCGTGTGTGTAGTGG + Intronic
1038908416 8:31934382-31934404 GTGTGTGTATGTGTGTGTAGGGG - Intronic
1039427018 8:37494679-37494701 GAGTGTGTGTGAGTGTGTATAGG + Intergenic
1039440287 8:37590497-37590519 GAGTGTGCATGGGTGTGTGTGGG - Intergenic
1040978281 8:53217888-53217910 GAGTGTGCGCGTGTGTGGGGGGG + Intergenic
1041864197 8:62550405-62550427 GCGTGTGCGCGTGTGTGTGGTGG + Intronic
1042757120 8:72227300-72227322 GAGTGTGCATGTGTGGGAAGTGG + Intergenic
1043054125 8:75415759-75415781 GTGTGTGCACGTGTGTGTGTTGG + Intronic
1047523588 8:125614502-125614524 GAGTGTGCAAGTGTGTGTGAGGG + Intergenic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1048936351 8:139360658-139360680 GAGTGTGCAGGAGTGGGTGGGGG - Intergenic
1049239672 8:141530792-141530814 CAGTGTGCACAAGTGGGCAGAGG - Intergenic
1049251155 8:141589763-141589785 GTGTGTGCACACGTGTGTACAGG + Intergenic
1049398602 8:142413558-142413580 GTGTGTGCACGTGTGTGTGTGGG - Intergenic
1049637869 8:143698903-143698925 AAGTGTGCACGTGTGGGGAGGGG - Intronic
1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG + Intergenic
1050551950 9:6756723-6756745 GAGTGTGTCTGTGTGTGTAGCGG + Intronic
1052861698 9:33441724-33441746 GTGTGTGCATGTGTGTGCAGGGG - Exonic
1053785786 9:41652012-41652034 AACTGTGCAGGAGTGGGTAGGGG + Intergenic
1054159256 9:61662165-61662187 AACTGTGCAGGAGTGGGTAGGGG - Exonic
1054174499 9:61865975-61865997 AACTGTGCAGGAGTGGGTAGGGG + Intergenic
1054449357 9:65395023-65395045 AACTGTGCAGGAGTGGGTAGGGG + Intergenic
1054479030 9:65593170-65593192 AACTGTGCAGGAGTGGGTAGGGG - Intergenic
1054663039 9:67714816-67714838 AACTGTGCAGGAGTGGGTAGGGG - Intergenic
1056537967 9:87547597-87547619 GTGTGTGTGCGTGTGTGTAGAGG + Intronic
1058649552 9:107162078-107162100 TAGTGTCCATGAGTTTGTAGGGG - Intergenic
1058983970 9:110195070-110195092 GTGTGTGCATGTGTGTGTGGAGG - Intronic
1059332075 9:113542011-113542033 GTGTGTGCACGTGTGTGTGTTGG - Intronic
1059621214 9:116007765-116007787 GAGTGTGCACAAGGCTTTAGAGG - Intergenic
1059652712 9:116330605-116330627 GTGTGTGCGTGTGTGTGTAGGGG + Intronic
1060321706 9:122567994-122568016 GTGTGTGCAGGAGTGAGTGGAGG + Exonic
1060695929 9:125708829-125708851 GTGTGTGCAAGAGTGTGTCTGGG - Intergenic
1062022457 9:134326051-134326073 GTGTGTGCGCGAGTGTGTGGCGG + Intronic
1062104264 9:134744498-134744520 GGGTGTGCATGAGTGTGTGCAGG - Intronic
1062253893 9:135611993-135612015 GAGTGTGCACGTGTGTGTGCAGG - Intergenic
1062328445 9:136023958-136023980 GCATGTGCACGTGTGTGTGGGGG - Intronic
1062399482 9:136366170-136366192 GAGTGTCCAGGAGTGGGCAGTGG - Intronic
1062444160 9:136586469-136586491 GTGTGTGCCCGTGTGTGTAGAGG + Intergenic
1185480190 X:440363-440385 GTGTGTGCACCTGTGTGTGGGGG - Intergenic
1185764344 X:2712864-2712886 TTGTGTGCACGTGTGTGTATGGG - Intronic
1187678621 X:21743402-21743424 GTGTGTGCACGTGTGTGTGGTGG - Intronic
1188394594 X:29665222-29665244 GAGTGTGCATATGTGTGTATAGG + Intronic
1192193794 X:69015451-69015473 GTGTGAGCACATGTGTGTAGTGG + Intergenic
1194657514 X:96590720-96590742 GTGTGTGCAAGTGTGTGTATGGG + Intergenic
1196117882 X:112016711-112016733 ATGTGTGCATGTGTGTGTAGAGG + Intronic
1196893318 X:120310547-120310569 GAATGTGCATGAGTGTGAAAAGG - Intronic
1197288318 X:124623342-124623364 GTGTGTGCATGAGTGTGTTTGGG + Intronic