ID: 1102422600

View in Genome Browser
Species Human (GRCh38)
Location 12:112815841-112815863
Sequence CCAGCTACATTGTGGTAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 72}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102422600_1102422605 -6 Left 1102422600 12:112815841-112815863 CCTGCTTACCACAATGTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1102422605 12:112815858-112815880 AGCTGGGGCAGAGATAAGCCAGG 0: 1
1: 0
2: 1
3: 24
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102422600 Original CRISPR CCAGCTACATTGTGGTAAGC AGG (reversed) Intronic
904539878 1:31225652-31225674 CCAGCTACATTGTGTGAGGGTGG + Intronic
904840017 1:33366591-33366613 CCAGCTACACTGTGGAGGGCAGG + Intronic
906682910 1:47742966-47742988 CTAGCTACAGTGGTGTAAGCAGG + Intergenic
913174350 1:116260580-116260602 CAAGCTACAATGAGGTAAGTAGG + Intergenic
919924707 1:202186344-202186366 CCAGCTCCATAAAGGTAAGCAGG - Intergenic
923223915 1:231921669-231921691 CCAGCTTTATTGAGGTATGCTGG + Intronic
924449423 1:244164160-244164182 CCTTCTCCAGTGTGGTAAGCAGG + Intergenic
1071665544 10:87552930-87552952 TCAGGAATATTGTGGTAAGCTGG + Exonic
1074551483 10:114446680-114446702 GCAGCTACATTTTGGAAAGAGGG - Intronic
1075453213 10:122567752-122567774 CCAGCTCCATGGTGGGAAGCAGG + Intronic
1075738473 10:124678823-124678845 CCAGATAGACTGTGGTTAGCTGG - Intronic
1078331930 11:10429523-10429545 CCAGCACCATTCTGGGAAGCAGG - Intronic
1080690424 11:34552639-34552661 CCACCTACACTGTGGTAGGTGGG + Intergenic
1084961301 11:72718157-72718179 CCTGATACCCTGTGGTAAGCAGG - Intronic
1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG + Intronic
1091315932 11:134614072-134614094 CCATCTGCCTTGTGGTAAGGAGG + Intergenic
1091996518 12:4998060-4998082 CCAGCTCCATTCTGGCAGGCTGG - Intergenic
1097564502 12:61251453-61251475 CCAGCTACCTGGTGGCAGGCTGG - Intergenic
1101653938 12:106703294-106703316 CCATCTACAATGTGGAAAGCCGG - Intronic
1102422600 12:112815841-112815863 CCAGCTACATTGTGGTAAGCAGG - Intronic
1110533086 13:76618977-76618999 ACAGGAACAATGTGGTAAGCAGG + Intergenic
1111159469 13:84374894-84374916 CAAGCTTCATTGAGGTAAACTGG + Intergenic
1113264016 13:108596226-108596248 TCATCCACATTGTGGTAAGTGGG + Exonic
1118316273 14:64728058-64728080 CCAACTACTTTATGGGAAGCAGG - Intronic
1119767537 14:77199828-77199850 CCAGCGACACTGTGATGAGCCGG + Intronic
1120802710 14:88710443-88710465 CCAGCTACATTTTTCTAAGTTGG + Intronic
1121422821 14:93827426-93827448 CCATATACATGGTGGGAAGCTGG + Intergenic
1126782850 15:52153219-52153241 CCAGCTACCATGTTGTGAGCAGG + Intronic
1143131777 17:4682922-4682944 CCAGCTCCATTGTGGCAGGCGGG + Exonic
1152115886 17:78386798-78386820 GGAGTTACATTGTGGAAAGCCGG + Intronic
930260928 2:49145047-49145069 CCAGCTGCTTTGGGGGAAGCTGG + Intronic
935540431 2:104341493-104341515 GCAGCTAAATTGTTGAAAGCTGG + Intergenic
935585978 2:104800722-104800744 GCAGCTACATAGTGGTTACCTGG - Intergenic
937944326 2:127318676-127318698 CCACCTACAATGTAGAAAGCTGG + Intronic
938169163 2:129059432-129059454 CCAGGGACAGAGTGGTAAGCAGG + Intergenic
940134710 2:150423215-150423237 CCAGGGACATTGTGGTAAACAGG + Intergenic
942617816 2:177812782-177812804 CTAGCTACATGCTGTTAAGCGGG + Intronic
947912529 2:233810903-233810925 CCAGCATTATAGTGGTAAGCTGG + Exonic
1169130054 20:3161937-3161959 GCAGCCACTTTGTGGTAAGGAGG + Intergenic
1169454112 20:5737043-5737065 CCAGCTACTTGGTGGGAAGTGGG + Intergenic
1172692576 20:36800373-36800395 CCAGGTACCATGTGGAAAGCAGG - Intronic
1173095722 20:40026088-40026110 ACAGCTACTTTGTGGACAGCAGG + Intergenic
1173813411 20:45970038-45970060 CCAGCTAAATGGTGGTGAGAAGG - Intronic
1178474045 21:32920736-32920758 CCTGCTACATGGAGGCAAGCTGG + Intergenic
1178875958 21:36414042-36414064 CCAGCCACACTGATGTAAGCAGG - Intronic
954405657 3:50343725-50343747 CCATCTACATGGTGGTGAGCTGG - Exonic
955589765 3:60522479-60522501 TCAGCTACATAGTGGTAGACTGG + Intronic
962546531 3:136441525-136441547 CCAGATACATGCTGGTAAACTGG - Intronic
965442994 3:168739297-168739319 CCAGCTACATTGTGCCATGGTGG - Intergenic
966154591 3:176902321-176902343 CCAGCTATACTGTGGTTATCAGG - Intergenic
967236901 3:187393797-187393819 CTAGCTACATGCTGGTAAGAAGG - Intergenic
979061180 4:116062988-116063010 TCAGCTACCATATGGTAAGCAGG + Intergenic
979113426 4:116788929-116788951 CCAGCTAAGTTGTGGTTTGCAGG + Intergenic
984112076 4:175629150-175629172 CCAGCCACATTATGCTATGCAGG + Intergenic
984375405 4:178922774-178922796 TCATCTACAATGTGGCAAGCAGG - Intergenic
993685810 5:90935782-90935804 CCACCTTGATTGTGGTAACCTGG + Intronic
998480469 5:142458796-142458818 TCATCTACAATGTGGTGAGCAGG + Intergenic
1007255042 6:40522574-40522596 CCAGCTACCTTTGGGAAAGCTGG - Intronic
1016291248 6:142530573-142530595 TCAGCCACATGGTGGAAAGCCGG + Intergenic
1022895088 7:34741838-34741860 GCTGCTGCATTGTGGTAAGAGGG - Intronic
1024290619 7:47801082-47801104 CCAGCCACAGTGTGGGAGGCTGG - Intronic
1024576462 7:50768424-50768446 CCAGGTTCATTGTGGTCAGCTGG + Intronic
1025639271 7:63352041-63352063 CCAACTGCATTGTGGTCAGATGG - Intergenic
1025643428 7:63396051-63396073 CCAACTGCATTGTGGTCAGATGG + Intergenic
1030173195 7:106625506-106625528 TCTGCTCCCTTGTGGTAAGCAGG + Intergenic
1033093516 7:138409340-138409362 CAAGCTAAACTGTGGAAAGCTGG + Intergenic
1034845513 7:154440823-154440845 CCAGCCACATTGGGGACAGCTGG - Intronic
1037613315 8:20494933-20494955 CCAACTGCATTATGGTAACCAGG - Intergenic
1043357222 8:79427506-79427528 CCCTATACATTATGGTAAGCCGG - Intergenic
1044246449 8:89952344-89952366 CCAGCTGCATTGGAGTCAGCTGG - Intronic
1044429906 8:92096165-92096187 CCAGCATCATTGTGATAAGGAGG + Intronic
1052229234 9:26127602-26127624 TCAGTTACAGTGGGGTAAGCTGG - Intergenic
1053042967 9:34890424-34890446 CCAGGTACTTTGTGTTCAGCTGG - Intergenic
1058287572 9:103198624-103198646 CCTACTCCATTGTGGTAAGATGG - Intergenic
1059557006 9:115291641-115291663 CCAAGAACACTGTGGTAAGCAGG + Intronic
1060688359 9:125632838-125632860 CCAGTCACATTGTGGTCAGGTGG - Intronic
1190540193 X:51469384-51469406 CCAGGTACAGTGTGGTACACAGG + Intergenic
1193859143 X:86642148-86642170 AAAGGTACATAGTGGTAAGCTGG + Intronic
1196116824 X:112007593-112007615 CCAGGTACACTGTGGTAGGCCGG + Intronic
1198570977 X:137956501-137956523 CCAGATATATTTTGGTGAGCAGG + Intergenic
1201305340 Y:12545179-12545201 CCAGCTCCAGTGTGGTAAACTGG - Intergenic