ID: 1102427301

View in Genome Browser
Species Human (GRCh38)
Location 12:112854010-112854032
Sequence CTGTAAAATGGGAAGTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 349}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102427294_1102427301 -8 Left 1102427294 12:112853995-112854017 CCTCCCTGACCTCATCTGTAAAA 0: 1
1: 4
2: 39
3: 452
4: 3193
Right 1102427301 12:112854010-112854032 CTGTAAAATGGGAAGTTGGATGG 0: 1
1: 0
2: 2
3: 41
4: 349
1102427291_1102427301 12 Left 1102427291 12:112853975-112853997 CCTTACGGCGTCCCTCATGGCCT 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1102427301 12:112854010-112854032 CTGTAAAATGGGAAGTTGGATGG 0: 1
1: 0
2: 2
3: 41
4: 349
1102427293_1102427301 0 Left 1102427293 12:112853987-112854009 CCTCATGGCCTCCCTGACCTCAT 0: 1
1: 0
2: 10
3: 91
4: 512
Right 1102427301 12:112854010-112854032 CTGTAAAATGGGAAGTTGGATGG 0: 1
1: 0
2: 2
3: 41
4: 349
1102427292_1102427301 1 Left 1102427292 12:112853986-112854008 CCCTCATGGCCTCCCTGACCTCA 0: 1
1: 0
2: 8
3: 71
4: 616
Right 1102427301 12:112854010-112854032 CTGTAAAATGGGAAGTTGGATGG 0: 1
1: 0
2: 2
3: 41
4: 349
1102427290_1102427301 13 Left 1102427290 12:112853974-112853996 CCCTTACGGCGTCCCTCATGGCC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1102427301 12:112854010-112854032 CTGTAAAATGGGAAGTTGGATGG 0: 1
1: 0
2: 2
3: 41
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102427301 Original CRISPR CTGTAAAATGGGAAGTTGGA TGG Intronic
902162599 1:14543403-14543425 CTGTGAACTGTGAAGTTGGCTGG + Intergenic
902665522 1:17935059-17935081 TTTTAAAAAGGGAAGTGGGAGGG - Intergenic
902916212 1:19641190-19641212 CTGTAAAATGGGAACAATGATGG + Intronic
902978021 1:20103334-20103356 CTGTAAAATGAGATGTTGTGAGG - Intergenic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903706429 1:25289145-25289167 CTGTAAAATGGGATACTGAATGG + Intronic
904152118 1:28450408-28450430 CTGTCAAATTGGAAATTAGAGGG + Intronic
904567736 1:31437781-31437803 CAGAAAAATAGGAAGTTGGCTGG + Intergenic
905068114 1:35201099-35201121 CTGGAAAATAGGAAGGAGGAAGG - Intergenic
905105104 1:35559260-35559282 CTGAAAATTGGGAGGTGGGAAGG + Intronic
905186231 1:36198964-36198986 CTGTAAAATGGCAAGAGTGAAGG + Intergenic
905294670 1:36946693-36946715 CTGTGAAATGAGAAGGTGCATGG - Intronic
905517784 1:38574813-38574835 ATATAAAATGTGACGTTGGAAGG + Intergenic
905727286 1:40264033-40264055 CTTTAAAATGAGAAGTGGGCTGG + Intronic
906088068 1:43152894-43152916 CTGAAAACCAGGAAGTTGGATGG + Exonic
907593095 1:55694376-55694398 CTGTAGAGTGGGAGGTTGGATGG + Intergenic
907744104 1:57195478-57195500 CTGTAAAATGGGAATATGATGGG - Intronic
907744251 1:57196996-57197018 CTCTAAAGTGGGAATTTTGATGG - Intronic
907754922 1:57302086-57302108 CTGTAAAATGGATACATGGATGG + Intronic
908768176 1:67572598-67572620 CTGTGAAATGGGAGTTTGGGAGG + Intergenic
909657179 1:78045280-78045302 TTGTAAAAAGCGTAGTTGGAGGG + Intronic
911048732 1:93651369-93651391 CTGGCAGATGGGAAGCTGGATGG + Intronic
911447154 1:98011414-98011436 CTAAAAAATGGGAAATGGGAAGG - Intergenic
911454669 1:98108283-98108305 CAGTAAAGTGGGAGGATGGAAGG + Intergenic
913286380 1:117230433-117230455 CTGTAAAATGGGAATGAGCATGG + Intergenic
916126216 1:161573752-161573774 CTCTAGAATGTGAAGGTGGAAGG - Intergenic
916136134 1:161655592-161655614 CTCTAGAATGTGAAGGTGGAAGG - Intronic
917242214 1:172960690-172960712 CTGTGAAATGGGAATTTAGGTGG - Intergenic
917485689 1:175452592-175452614 CTGTAGCCTGGGAAGTTGGGGGG + Intronic
917965273 1:180174844-180174866 CTGTAAAATGGTGAATTGGGGGG - Intronic
918499627 1:185179449-185179471 GTGGAAAATTGGAATTTGGAGGG + Intronic
919793224 1:201305712-201305734 CCCTATACTGGGAAGTTGGAGGG - Intronic
921940148 1:220830702-220830724 GTGTAAAATGAGAGATTGGATGG + Intergenic
922620938 1:226987726-226987748 CTGTAAGAAGGGAGGTGGGAGGG + Intergenic
922738164 1:228000837-228000859 CTCTAAGATGGGTAGTTGAAGGG + Intergenic
923227650 1:231954064-231954086 GTGTAAACACGGAAGTTGGAAGG - Intronic
923368607 1:233287839-233287861 CTGTAAAATGGGAATAATGATGG + Intronic
923660767 1:235955155-235955177 CTCGAAAATGGGAAGTTGTCTGG - Intergenic
923890655 1:238211895-238211917 CTTAAAAATGGAAAGTTTGAGGG + Intergenic
924303479 1:242663711-242663733 CTGTAAAATGGGAATTATAATGG - Intergenic
1063949274 10:11207418-11207440 GTGTCAAATGGAGAGTTGGAGGG + Intronic
1063949400 10:11208173-11208195 CTGTAAAATGGGAGGGTGTGGGG + Intronic
1064318516 10:14280014-14280036 CTGTAACATGGCAAAGTGGAAGG - Intronic
1065312693 10:24431546-24431568 CTGTAAAATGGGCGCTTAGATGG + Intronic
1066195591 10:33096509-33096531 CTGTGAAATGTGATGTTGGCTGG - Intergenic
1067302788 10:45027782-45027804 CTGACAAATTGGAGGTTGGAAGG - Intergenic
1067720237 10:48722589-48722611 CAGTGGAATGGGAAGTTGCATGG + Intronic
1068474931 10:57512924-57512946 CTGGAAAATGGGCAGATAGACGG - Intergenic
1070548170 10:77469252-77469274 CTGTAATGTGGGGACTTGGATGG - Intronic
1070568568 10:77622656-77622678 CTGTAAAATGGGAATTTAAAAGG + Intronic
1070631467 10:78087986-78088008 CTGTAAAATGGAACTTGGGATGG + Intergenic
1072093446 10:92152495-92152517 GTTTAAAAGGGGAAGGTGGAAGG - Intronic
1072613306 10:97033316-97033338 CTGTAAAGTGAGGTGTTGGAAGG + Intronic
1072682878 10:97519286-97519308 CTATAAAATGGGATGCTGGTAGG - Intronic
1074020038 10:109573077-109573099 TTGTAAAATGGGATGTTTGCTGG - Intergenic
1074196935 10:111197384-111197406 CTGTAAAATGGGGACATTGAGGG + Intergenic
1074416322 10:113270015-113270037 TTTTAAAAAAGGAAGTTGGAAGG + Intergenic
1074910015 10:117899928-117899950 CTATTGAATGGGAAGATGGAAGG - Intergenic
1074938641 10:118212921-118212943 CTGTAAAACTGGAGGTTGTAAGG - Intergenic
1075368025 10:121910299-121910321 TCGTGAAATGTGAAGTTGGATGG - Intronic
1075559584 10:123458832-123458854 CTGTAAAATGGGGCATTTGAAGG - Intergenic
1076720951 10:132392882-132392904 CTGTAAAGTGGGAAATATGATGG - Intergenic
1077246975 11:1544459-1544481 CTGCAAAATGGGAATTGGGGAGG - Intergenic
1077756378 11:5033236-5033258 CTGTAAAATAGGAAGATAGGAGG + Intergenic
1077910556 11:6568601-6568623 CTCTCAAATTGGAAGTGGGAGGG + Intronic
1079978035 11:27116915-27116937 CTGATAGATGGGATGTTGGATGG - Intronic
1080204087 11:29708914-29708936 CTGAAACATGTGAAGTTGCAAGG - Intergenic
1080496359 11:32824234-32824256 ATATAAAATGGGAAGTTGATGGG - Intergenic
1081644227 11:44778586-44778608 CTGTAAAATGGGGAGAGGGATGG + Intronic
1082090078 11:48081754-48081776 CTGTAAAATGGGTGGGGGGAAGG + Intronic
1083048539 11:59756747-59756769 TTGTAAAATGGGTAGTTGTAAGG + Intronic
1084196796 11:67527328-67527350 GGGTAAAATGGGTGGTTGGATGG + Intergenic
1084680440 11:70663404-70663426 CTGTAAAATGGGAGGATCGAGGG - Intronic
1085324011 11:75592898-75592920 CTGTAAAATGGGAAGGAGCAGGG - Intronic
1086106821 11:83156574-83156596 CTGGGAACTGGGAAGTGGGAGGG - Intergenic
1088174715 11:107039313-107039335 CTGTAAAAATGGAAGTCAGAGGG - Intergenic
1089024203 11:115251442-115251464 CAGAAAATTGGGAAGTGGGAGGG + Intronic
1089648209 11:119894123-119894145 CTGTAAAATGGGGAGTTGGGGGG + Intergenic
1090081102 11:123613354-123613376 CTGTATTCTGGGAAGTTGGTTGG - Intronic
1090829419 11:130410670-130410692 CTGCACACTGGGCAGTTGGATGG + Intronic
1091256717 11:134194282-134194304 CTGAAAAATGGGATGTTGTGAGG - Intronic
1091692296 12:2605446-2605468 CTGTAAGATGGGAGGTTGGCAGG + Intronic
1091943989 12:4518379-4518401 CATTAAAATGGGAAGTTGCAAGG - Intronic
1092439925 12:8491619-8491641 CTATAAAAGGGGAAGCTGGTTGG - Intergenic
1092926805 12:13279090-13279112 CTCTAAAAAGGGCAGTGGGAGGG - Intergenic
1092954328 12:13535541-13535563 TTGTAAAATGAGGAGTTGGGAGG + Intergenic
1095644748 12:44530384-44530406 CTGTTAATTGGAAAGTTGGAAGG + Intronic
1096447656 12:51708459-51708481 CTTTAAAATGGGAAATTAAATGG - Intronic
1096750262 12:53754117-53754139 ATGGATAATGGGAAGATGGAAGG + Intergenic
1098103744 12:67046938-67046960 ATGTAAAATGAGAAGTCGAAAGG + Intergenic
1098184977 12:67886797-67886819 CTGCAAAATGGGTAGTGGTAAGG + Intergenic
1098272594 12:68783372-68783394 CTGTAAAATGGGTTGTTACAAGG - Intronic
1098477057 12:70917438-70917460 CTGTAAAATAAGCAGTTGGATGG + Intronic
1099567891 12:84276348-84276370 CTGCCAAATGGGATGCTGGAGGG - Intergenic
1101747365 12:107553343-107553365 CTGTAAAATGGGAAGAGGTAAGG - Intronic
1102258234 12:111428475-111428497 CTGTAAAATGGGAAGTGTCATGG + Intronic
1102427301 12:112854010-112854032 CTGTAAAATGGGAAGTTGGATGG + Intronic
1102894204 12:116585590-116585612 CTGTAAACTGGGAAGCTGTTAGG + Intergenic
1102997983 12:117364458-117364480 CTGTAAAATGGGAATAAGAAAGG - Intronic
1103002469 12:117395851-117395873 CTGGATAATGGAAAGATGGATGG - Intronic
1103079355 12:118011083-118011105 CTGTAAAATGGGCAGGGGTAGGG - Intergenic
1103244781 12:119447308-119447330 CAGTACAAGGGGAAGTGGGAGGG - Intronic
1103883748 12:124186006-124186028 CTGTAAAAGGAGAATTTGAACGG - Intronic
1103921817 12:124403169-124403191 CTGTAAAACGGGGAGGTGGGGGG + Intronic
1104295492 12:127508144-127508166 CTGTAAAATGGGTAGGAGGATGG + Intergenic
1104996120 12:132657946-132657968 TTGGAAAATGGCAAGTGGGATGG + Exonic
1106100006 13:26686447-26686469 CTGTCAAATATGAAATTGGAAGG + Exonic
1107077694 13:36340971-36340993 TTGAAAGATGGGAAGATGGATGG + Intronic
1110633836 13:77741762-77741784 CTTTAAAATGGGCAGTGGGATGG - Intronic
1110781457 13:79470559-79470581 CTTTAACATGTGAATTTGGAGGG - Intergenic
1111759531 13:92444122-92444144 TGATAAAATGGGAAATTGGACGG + Intronic
1112655652 13:101450029-101450051 CTGAAAACTGGGAAAATGGAAGG + Intergenic
1112901141 13:104358432-104358454 CTGTAATCTGGAAATTTGGAAGG + Intergenic
1113075908 13:106467962-106467984 CTGTAAAAGGGAAAGGTTGAAGG - Intergenic
1113470498 13:110541577-110541599 CTGAAAAATGAGAAGTCAGAAGG - Intronic
1113770615 13:112906004-112906026 CTGAGAACAGGGAAGTTGGACGG - Intronic
1114313220 14:21486495-21486517 CTGTAAAATGGGAATTATAATGG - Intronic
1114467047 14:22930551-22930573 CTGTGTAATAGAAAGTTGGATGG + Intergenic
1114556473 14:23565210-23565232 GTTGAAAATGGAAAGTTGGAGGG + Intronic
1114816485 14:25964918-25964940 CTGTGAAAGGGAAAGTTGAAGGG - Intergenic
1116256927 14:42569096-42569118 CTGTAAAATGGGAAGGTCTATGG - Intergenic
1118004589 14:61554027-61554049 ATGTAAAATGAGAAGTTACAGGG - Intronic
1118883562 14:69848943-69848965 CTATAAAATGGGGAGTTGTGAGG - Intergenic
1119909391 14:78335946-78335968 TTTTAAAATGGAAAGCTGGAAGG - Intronic
1120384412 14:83826157-83826179 CTGTAAAATGTAAATTTAGAGGG + Intergenic
1122092612 14:99350174-99350196 CTGTAAATTGGGAAGGGCGATGG + Intergenic
1122330239 14:100907023-100907045 CTGCAAAATGGAGAGGTGGAAGG + Intergenic
1122389947 14:101373381-101373403 CAGCAGAAAGGGAAGTTGGAGGG - Intergenic
1125229917 15:37442044-37442066 CTCTAAAATGGGTTTTTGGAAGG - Intergenic
1126421228 15:48474737-48474759 CTATACCATGGGAAGTTTGAAGG - Intronic
1127132068 15:55876999-55877021 TTTTAAAATGAGAAGTTGGCTGG - Intronic
1130066579 15:80609680-80609702 CTGCGAAATGGGAGGTGGGAGGG + Intergenic
1131053655 15:89363281-89363303 CTCTGAAATGGGAAGTTGTTGGG + Intergenic
1132024894 15:98396926-98396948 CTTTAAAATAGGAAGTGGCAAGG - Intergenic
1133022306 16:2972150-2972172 CAGTAAAATAGGAGCTTGGAGGG - Exonic
1133443339 16:5838691-5838713 CTGCAAAGTGGGAATTTGGATGG + Intergenic
1134102789 16:11464225-11464247 CTGTAAAAAGGGAAGGAGAAGGG - Intronic
1134337605 16:13315627-13315649 CTGTAAAATGGGATGTTAATAGG + Intergenic
1134644794 16:15857439-15857461 CAATAAAATGGGAAGTGGGGTGG - Intergenic
1134827796 16:17298398-17298420 CTGTAAAATGGGAACAGTGAGGG - Intronic
1134896279 16:17889716-17889738 CTGCAAAATGGGAGGAGGGAGGG - Intergenic
1135158036 16:20071142-20071164 CAGTAAAATGGGAATTATGAGGG - Intronic
1135707436 16:24686874-24686896 CTGTAAAATGGGAATAACGATGG + Intergenic
1136561542 16:31042119-31042141 CTGTAAGATTGAAAGTGGGATGG - Intronic
1137640257 16:50022814-50022836 CTGACAAATGGGAAGGAGGAAGG + Intergenic
1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG + Intergenic
1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG + Intergenic
1138960706 16:62025457-62025479 CTGAAAATTGGGAAGTTGCACGG - Intronic
1140260191 16:73371475-73371497 CTGTAAAATTGGAGGTTGGCAGG - Intergenic
1140490735 16:75333706-75333728 CTGTCAAATGAGAATTAGGAAGG + Intronic
1140588043 16:76317923-76317945 CTGTCAAATGGGAAACTGGGGGG + Intronic
1141585376 16:85030006-85030028 CTGTGGAATGGGAAGTGGGGCGG + Intronic
1142018839 16:87767184-87767206 ATTTTAAATGGGAAGGTGGAAGG - Intergenic
1142233715 16:88911603-88911625 CTGTAAAATGGGAATGGGGATGG + Intronic
1142893855 17:2962339-2962361 CTGTAAAATGGGAATGATGATGG - Intronic
1143182012 17:4989240-4989262 CTGTAATATGGAAAGAAGGAGGG - Intronic
1143191293 17:5042034-5042056 GTGAAAAATTGGAAGTTGGACGG - Intronic
1145792473 17:27636461-27636483 CTATAATATGGGAATTTGGGGGG + Intronic
1145995808 17:29104222-29104244 CTGGCAAATGGGTAGATGGATGG + Intronic
1146584213 17:34068440-34068462 CTGCAGAATGGGCTGTTGGAAGG - Intronic
1146673405 17:34757166-34757188 CTGTAACATGGGAGGATTGAGGG - Intergenic
1147925534 17:43943243-43943265 CTGTAAAATGGGTTGTTGTGGGG - Intergenic
1148150609 17:45394728-45394750 CTGTAAAATGGGATGGTGTGTGG + Exonic
1148353514 17:46958237-46958259 CTGTAAAATGTGAAGGTTGACGG - Intronic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1148580422 17:48739460-48739482 CTGTTGAATCCGAAGTTGGATGG + Intergenic
1148638284 17:49165760-49165782 CTGTAAGATGTCAAGTTTGAAGG - Intronic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149467188 17:56889404-56889426 CTGCAAAATGAGAAGTCAGATGG + Exonic
1150979835 17:70128658-70128680 CTGTAGAATATGAAGTTCGAAGG - Intronic
1151341999 17:73477529-73477551 CTGTAAAATGGGAATAATGATGG + Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1153059573 18:981363-981385 CTGTAAAATGGGAATATTAATGG + Intergenic
1156042076 18:32834289-32834311 CAGGAAGATGGGAAGTTGTAGGG + Intergenic
1156489710 18:37488916-37488938 CTGTAAAATGGGAAGAGTAATGG + Intronic
1156624258 18:38889395-38889417 CAGTAGGAAGGGAAGTTGGATGG - Intergenic
1157197833 18:45634072-45634094 CTTTAAATTGGGAAGTGGGATGG - Intronic
1157265764 18:46219893-46219915 CTATAAAATCTGTAGTTGGAGGG + Intronic
1158821712 18:61167092-61167114 CTGTAAAATGAGGTATTGGATGG - Intergenic
1158901296 18:61964257-61964279 CCATAGAATGAGAAGTTGGAGGG - Intergenic
1159342438 18:67153261-67153283 CATTAAAATGTGTAGTTGGAGGG + Intergenic
1160077312 18:75690922-75690944 CTCTAAAATTGGAATTTGGCTGG + Intergenic
1160668086 19:342842-342864 CTCTGAAATGGGAAGTTTAATGG - Intronic
1161335337 19:3709847-3709869 CTGTAAAATGGGGATATTGAGGG + Intronic
1161669236 19:5595656-5595678 CAGTAAAATGCAAACTTGGAGGG - Intronic
1161717164 19:5882538-5882560 CTGGCAGATGGGAAGCTGGAAGG - Intronic
1162873771 19:13605752-13605774 CTGTGAAATGGGAAGAAGAATGG - Intronic
1162901877 19:13799975-13799997 CTGGAAATGGGGGAGTTGGAGGG + Intronic
1162991811 19:14307803-14307825 CTTTAACATGTGAATTTGGAGGG + Intergenic
1163567653 19:18060978-18061000 CTTTAAAATGGGAAGGGGTATGG + Intronic
1166317011 19:41994674-41994696 CTGCAGGAGGGGAAGTTGGAAGG + Intronic
1166822028 19:45586461-45586483 CTGTAAAATGGGAAGGGGGCTGG - Intronic
1167205261 19:48097205-48097227 CTGTAATAAGGGATGTTTGAAGG - Intronic
1167323923 19:48812651-48812673 CTGTAGAATAGGAAGGTGGCTGG - Intergenic
1167523266 19:49969527-49969549 CTGTGAAAGGAGAAGTTGGGAGG + Intergenic
1168307658 19:55444058-55444080 CTGTAAAATGGGGATAAGGATGG + Intergenic
925310439 2:2877902-2877924 TTGTAAAATGTTAAGTAGGAAGG - Intergenic
926294368 2:11558112-11558134 CTGTGATTTGGGAAGATGGAAGG + Intronic
927874433 2:26645610-26645632 CTGTAAAACTGTAAGTTGCAAGG - Intergenic
927921067 2:26971951-26971973 CTGCAAGATGGGCAGGTGGAGGG - Intronic
928220427 2:29398691-29398713 CTGGAAACTGGGAAGGAGGAGGG - Intronic
928493854 2:31811992-31812014 CTGTAAAATGAGATCTTGCAGGG + Intergenic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
930649340 2:53948906-53948928 CTATAAAAGGGGAAGTTCAATGG + Intronic
931666320 2:64611946-64611968 CTGTAAAATGGGATAATGAAAGG + Intergenic
932737300 2:74263380-74263402 CTTAAAAATGGGAAGTGGGCCGG - Intronic
932747217 2:74343990-74344012 GTGGAAAATGGGAAGTTTGGAGG + Intronic
934064048 2:88323197-88323219 TAGTAAAATGGGGAGTTGAATGG + Intergenic
935126075 2:100223991-100224013 CTGTGAAGTGGGCAGTTGGTGGG - Intergenic
935664394 2:105497519-105497541 ATCTAAAATGGGAGATTGGAAGG - Intergenic
936539708 2:113340371-113340393 CTGGAAAAGGGGAAGTTAAAAGG - Intergenic
936678522 2:114743715-114743737 CTGTAAAAGGTGAGGTTGTAAGG + Intronic
937024204 2:118683805-118683827 CTGTAAAATGGGGATTTTCAAGG - Intergenic
942509327 2:176679906-176679928 CTGTAAAATGGGAATAAGAATGG + Intergenic
942579413 2:177401421-177401443 CTGTGAAATGGGCAGTTGTGAGG - Intronic
943836691 2:192523799-192523821 TAGAAAAATGGGAAGTTAGATGG + Intergenic
945286427 2:208087189-208087211 TTCTAAAAAGGGAGGTTGGATGG + Intergenic
945585358 2:211654710-211654732 CTGTAAAATGGGAATTATAATGG - Intronic
947335125 2:229074121-229074143 TTGTAAAATGGCAAGTCAGATGG + Intronic
948242855 2:236452830-236452852 TTTTAAAAAAGGAAGTTGGATGG - Intronic
1169452102 20:5720796-5720818 CTGCAAACTGGTAAGCTGGATGG - Intergenic
1170217679 20:13908873-13908895 ATGTACAAAGGGAAGCTGGATGG - Intronic
1172049843 20:32109162-32109184 CTGTGAAATGGGAAGGGGGTTGG - Intergenic
1173748670 20:45458472-45458494 CTGTAGCATGGGAAAATGGAGGG - Intergenic
1174740123 20:53004872-53004894 CTGTAAAATGGGAATAATGATGG - Intronic
1175121891 20:56722199-56722221 TTGGCAAATGGGAGGTTGGAAGG + Intergenic
1175568818 20:60002937-60002959 CTGAAAATTGGAAATTTGGAAGG + Intronic
1175603758 20:60295979-60296001 ATTTAAAATGGGAAGTTTGAGGG + Intergenic
1175739993 20:61413499-61413521 CTGTAAACTGGGGAGGTGGTGGG + Intronic
1178574657 21:33774730-33774752 CTGCAAAACGGGAACTTGAAAGG + Exonic
1178897878 21:36575395-36575417 CTGTAAAATGGGAATAATGATGG - Intronic
1179429104 21:41306899-41306921 ATGTCAAATGGGAAGGAGGAAGG - Intronic
1179433717 21:41345132-41345154 CTGTAAAGTAGGAAGTGGGCAGG + Intronic
1179593575 21:42427563-42427585 CTGTAAAATGGGTAGGGGGCAGG - Intronic
1179604011 21:42500426-42500448 CTGTAAAATGGGCTGTTGTGAGG + Intronic
1181043501 22:20203960-20203982 CTGTGGAATGGGAAGTGGGGAGG + Intergenic
1181775850 22:25159662-25159684 CTGTAAAATGGGAAGCTTGGAGG - Intronic
1181913262 22:26257357-26257379 CTGTAAAATGAGAAGTTAAATGG - Intronic
1182351313 22:29701569-29701591 CTGTAAAATGGGAATTTTATAGG + Intergenic
1182663426 22:31941255-31941277 CTGTAAAACGGGAAGGAGGCCGG + Intronic
1182759953 22:32714338-32714360 CTGTAAAATGGGAGTTTGTCTGG + Intronic
1183247776 22:36707134-36707156 CTGTAAAATGGGAATAATGATGG - Intergenic
1183426803 22:37744381-37744403 CTGTCAAATGAGAATCTGGAAGG + Intronic
1184028528 22:41876581-41876603 CTGTAAAATGGAGAGTGGGGTGG + Intronic
1185271169 22:49929807-49929829 TTCTAAAAGGGGAACTTGGAAGG + Intergenic
950125870 3:10509476-10509498 CTGTAAAATGGGAAGAAGCCTGG - Intronic
950831012 3:15876408-15876430 CAGCAAAACTGGAAGTTGGAAGG - Intergenic
951063706 3:18239641-18239663 CTCTAAAATGGGAGTTAGGATGG - Intronic
951804691 3:26631396-26631418 CTGATAACTGGGAAGTGGGAAGG - Intronic
952083995 3:29795704-29795726 CTGTAAACTGGGAGGAAGGAGGG + Intronic
953695185 3:45152723-45152745 TTGTATAAGGGGAAGTTTGATGG + Intergenic
954679356 3:52333677-52333699 TTGAAAAATGGTAAGTTGGCTGG - Intronic
955194134 3:56789133-56789155 CTGAAAATTGGGAATTTGCAAGG - Intronic
955636030 3:61030647-61030669 CAGTTAAATGGTATGTTGGACGG + Intronic
955726782 3:61941713-61941735 CAAAAAAAGGGGAAGTTGGAGGG - Intronic
956942752 3:74182825-74182847 CTTTAAACTGGGAAGTTACATGG + Intergenic
956949365 3:74263079-74263101 CTGCAAAATGTGAAATTGGTAGG + Exonic
958192758 3:90204594-90204616 CTGTGAACTGGGCGGTTGGATGG - Intergenic
958681634 3:97339463-97339485 TTGTAAAATGTTAAGATGGAAGG - Intronic
959450508 3:106493427-106493449 CAGAAAAATGGGAATTTGAATGG - Intergenic
959538215 3:107511068-107511090 CTGTAAAATGGGAATTTTAACGG - Intergenic
960392163 3:117090722-117090744 CATTAAAGTGGGAAGGTGGAAGG + Intronic
961245373 3:125447846-125447868 CTTTAAAATGTGAGTTTGGAAGG + Intronic
961747065 3:129070954-129070976 CTGTAAAATGGAGAGGAGGAAGG - Intergenic
961864825 3:129945997-129946019 CTGTGAAATGGGAGGGTGAATGG - Intergenic
962087004 3:132201753-132201775 CTGTAAAATAAGAAGTCGAAGGG + Intronic
962895334 3:139708820-139708842 CTGTAAAATGGGAATTACAATGG + Intergenic
963351472 3:144157352-144157374 CTGTAAAATGAGATGTTAGAAGG + Intergenic
963389723 3:144645104-144645126 CTTTAAATTGGGGAGTTGTATGG + Intergenic
964163737 3:153675986-153676008 CTATGAGATGGGAAGTTGTAGGG + Intergenic
964578959 3:158209060-158209082 CCTTAAAAGGGGAATTTGGATGG + Intronic
965423305 3:168489783-168489805 CTGAAAAGTGGGGAGTAGGAAGG - Intergenic
966625554 3:182012469-182012491 CTGTGAAATGGGCAGATGGTGGG - Intergenic
966889649 3:184397794-184397816 CTGGAAAAGGGGAAGAAGGAAGG + Intronic
967133045 3:186490202-186490224 CTGGAGAATGGGATGGTGGAAGG + Intergenic
969278666 4:6154401-6154423 TTGTGAAATGGGGACTTGGAAGG - Intronic
969445975 4:7244942-7244964 CTGAGAAGTGGGCAGTTGGAAGG + Intronic
969497375 4:7533820-7533842 CTGTAAAGCGGGCAGGTGGAAGG + Intronic
970966977 4:21939353-21939375 ATCTAAACTGGGAAGCTGGAAGG - Intronic
972139258 4:35936491-35936513 CTGTAAAATGGGAATAATGATGG + Intergenic
975972331 4:80055388-80055410 CTGACAGATGGCAAGTTGGACGG - Exonic
976358328 4:84147166-84147188 CGGTAGAATTGGAAGTTGTATGG + Intergenic
977280398 4:95032427-95032449 CTGTAACACGGGAAGTAGGGAGG + Intronic
977707573 4:100088453-100088475 CTATAATATAGAAAGTTGGAGGG + Intergenic
977915612 4:102589130-102589152 CTGTAAAATGGGAATTTTAAGGG - Intronic
978380097 4:108117833-108117855 CTCTAAAATGGGGACTTGGGAGG - Intronic
981468702 4:145103676-145103698 CTGAAAAAGGGGAAGCAGGATGG - Intronic
981594593 4:146405199-146405221 CTGGAAAATAGAAAGTTGAAGGG - Intronic
982836772 4:160128987-160129009 GGGGAAAATGGGAAGCTGGAAGG + Intergenic
982870361 4:160572414-160572436 CTGCAAATGGGGAAGTTTGAGGG + Intergenic
984242920 4:177239343-177239365 CTATAAAATGGGAGGATGAATGG + Intergenic
985173849 4:187179858-187179880 CTGTAACATTGGAAGCTGCAAGG + Intergenic
986432693 5:7697216-7697238 CTTTAATATGTGAATTTGGAAGG + Intronic
986758616 5:10859845-10859867 ATTTAAAATGGGGAGTTGTATGG + Intergenic
988055049 5:26083991-26084013 TTGTAAAATGGGCAGTAGGTAGG - Intergenic
988148217 5:27338774-27338796 CTGTAACTTGGGAAGTTTGATGG + Intergenic
988213429 5:28239467-28239489 CTGTAAAATGGGAATCATGATGG + Intergenic
990192511 5:53275736-53275758 CTGTAAAAAGAGAACTTGCAGGG + Intergenic
990199225 5:53352672-53352694 CAGGAAAATGGGTAGTTTGAAGG - Intergenic
990998267 5:61755517-61755539 TTGTAAAAGGGGAAGCTGAAGGG - Intergenic
991526137 5:67560267-67560289 ATTTAAAATGTGAAGTTTGATGG + Intergenic
991585714 5:68199995-68200017 CTGTACACTGGGAAGTCAGAAGG - Intergenic
992009368 5:72511526-72511548 CTGTAAAAAGGGCAGGGGGATGG - Intergenic
994183889 5:96797780-96797802 CTTTAAAATGGTAAGTTGTATGG - Intronic
994770870 5:103980551-103980573 ATGTAAAATGCGAAGTTGGCTGG + Intergenic
997211790 5:132081192-132081214 TGGTAAACAGGGAAGTTGGAAGG + Intergenic
998461881 5:142315718-142315740 CTGTAAAATGGGCTCTTGCAAGG + Intronic
998613738 5:143717342-143717364 AAGAAAAATGGGGAGTTGGAGGG + Intergenic
999177248 5:149640099-149640121 TTGGGAAATGGGAAGTGGGATGG + Intergenic
999185872 5:149708254-149708276 CTGTCAAGTGGGATGTTTGAGGG + Intergenic
999686720 5:154109773-154109795 CTGTAAAATGGGAATTAGGATGG - Intronic
999997990 5:157110565-157110587 CTATAAAATGAGAAATTGGCCGG - Intronic
1000374071 5:160563262-160563284 CTGTAAGATGGCACATTGGATGG + Exonic
1001308032 5:170589988-170590010 CTGCAAAATGGGAATGGGGATGG + Intronic
1001790560 5:174454203-174454225 CTCCAAAGTGGGAAGCTGGAGGG + Intergenic
1002923301 6:1589164-1589186 CTCTAAAATGGGCTTTTGGAAGG - Intergenic
1003418589 6:5935795-5935817 CTGTAACATTTGAAGTTGGGTGG - Intergenic
1003999193 6:11579141-11579163 CAGGAAAATGAGAATTTGGAGGG - Exonic
1006044894 6:31286844-31286866 TTGTCAAATGTAAAGTTGGAAGG - Intronic
1006175379 6:32118163-32118185 CTGTAAGATGGGAATAAGGATGG + Intronic
1006511136 6:34521813-34521835 CTGTAAAATGGGCTGTTGCAAGG - Intronic
1007170762 6:39861741-39861763 CTGAAAACTGGGAGGGTGGAGGG - Intronic
1008877806 6:56348550-56348572 CTGTAGCATGGGAAGGTGGCTGG + Intronic
1010121605 6:72382096-72382118 TTGGAAAATGGGAAAATGGAAGG + Intronic
1010142228 6:72624062-72624084 TTGTAAAACGGAAAGTTGGCTGG - Intronic
1010529706 6:76952664-76952686 GTGTAAAAGGGGATGTGGGATGG + Intergenic
1011002583 6:82607586-82607608 CTGTAAAATGGGAATAATGATGG - Intergenic
1011349634 6:86408334-86408356 CTGTAAAATGTGTGTTTGGAAGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014121331 6:117728635-117728657 CTGCAAAATGGGAATTTTAATGG - Intergenic
1014321667 6:119937305-119937327 ATGTAAAATGGAAAATTGGCCGG - Intergenic
1014366072 6:120543685-120543707 CAGTAAAGTGGGAAGTTTAAGGG + Intergenic
1020121854 7:5508799-5508821 CTGCAAACTGGGAATTGGGAGGG - Intronic
1021149635 7:17134012-17134034 CTGTAAACTAGGTTGTTGGATGG + Intergenic
1022009047 7:26292801-26292823 CTGTAAAATGAAAGGTTTGATGG - Intronic
1022311696 7:29202467-29202489 CAACAAAATGGGAAGGTGGAAGG + Intronic
1022474080 7:30699158-30699180 CTGTAAAATGGGGAGAAGGCTGG + Intronic
1023158977 7:37279296-37279318 CTTTAAAATGGCAAATGGGAAGG + Intronic
1024477788 7:49832112-49832134 CAGAAAAATGGGAATTTGCAAGG + Intronic
1026127589 7:67593157-67593179 CTGTAAAATGGGAAATAACAAGG + Intergenic
1026367045 7:69659120-69659142 ATGTAAACAGGGGAGTTGGAGGG + Intronic
1027052125 7:75027231-75027253 CTGTGACATGGGACGTGGGAAGG + Intronic
1028220867 7:88195131-88195153 CAGTAAAAATGGAATTTGGATGG + Intronic
1032084993 7:128879233-128879255 CTGTAAAGTGGGGAATGGGAAGG - Intronic
1033576849 7:142693690-142693712 CTGTAATAAGGCAACTTGGAGGG + Intergenic
1034874878 7:154716352-154716374 CTGTAAAATAGTAAGTGGGTAGG - Intronic
1037200762 8:16249720-16249742 GTTTAAAAAGGGAAGTTGGAAGG + Intronic
1037616430 8:20523138-20523160 CAATAAAATAGGAATTTGGATGG + Intergenic
1038538383 8:28371058-28371080 CTGTAAAATGGGAATGATGATGG - Intronic
1042214722 8:66418728-66418750 CTGTTGAATGGTAAGTTGGCTGG - Intergenic
1042487801 8:69365928-69365950 CTATAAAATGGGCAGTGGGGAGG - Intergenic
1042848546 8:73192382-73192404 CTGAAAAATGGGAAAATGGCTGG + Intergenic
1046657191 8:116907655-116907677 CTGTAAAATGGGAATGATGATGG - Intergenic
1046990616 8:120448846-120448868 CAGTAATATGGCAAGTTTGAGGG + Intronic
1047679859 8:127243478-127243500 GTGTAAAATGTCAAGCTGGAGGG - Intergenic
1048159250 8:131997456-131997478 CTATGTAATGGGAAGTTGAATGG - Intronic
1048474259 8:134729265-134729287 CTGTAAAATTGGGAGATGGCTGG + Intergenic
1048526698 8:135209275-135209297 CAGCAAAGTGAGAAGTTGGAGGG + Intergenic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1050328832 9:4524597-4524619 CTGTAAGTTGGGAAGTTCAAGGG + Intronic
1050630755 9:7555865-7555887 CTGTAAAAACTGAAGTGGGAGGG + Intergenic
1050676902 9:8066021-8066043 CTCTAATAAGGGATGTTGGAAGG - Intergenic
1051264921 9:15300919-15300941 CTAAAAAATGGGAACCTGGAAGG - Intronic
1051444311 9:17124339-17124361 CTGTAAACTTGGAAGTTCGAGGG - Intergenic
1055003581 9:71481253-71481275 TTGTAATATGGGTAGTTAGAAGG + Intergenic
1055575129 9:77653343-77653365 CTTTAAAATGTGAAGTTTGGAGG + Intergenic
1057159923 9:92882396-92882418 CTGGAAGGTGGGAAGGTGGAGGG + Intergenic
1057802455 9:98198572-98198594 CTGAAAAATGGGTGGTTGGGAGG - Intergenic
1058001508 9:99870558-99870580 CTGGAAATTGGGAGGTTGGCTGG - Intergenic
1058001812 9:99873455-99873477 CTGTAGCAAAGGAAGTTGGAAGG + Intergenic
1059515959 9:114895662-114895684 CTGTACAATGGGAAGCTGTTGGG - Intronic
1059700499 9:116771307-116771329 CTGAAAAATGGGAACATGGAGGG - Intronic
1060063422 9:120482024-120482046 CTGAAAAATGGGAAGTTCCCTGG - Intronic
1060666357 9:125434270-125434292 CTGTAAAATGGGAATTAGGTGGG + Intergenic
1060730946 9:126036745-126036767 CTGGAAAATGGGGATATGGATGG - Intergenic
1060785622 9:126449848-126449870 TTGTAAAATGGGAAGTGGAGTGG - Intronic
1061238433 9:129355371-129355393 CTGTAAAATGGGAAGAATAATGG - Intergenic
1061296944 9:129681992-129682014 CTGTACCGTGGGAAGGTGGAGGG - Intronic
1186720733 X:12300903-12300925 CTGTAGGATGGCAAGGTGGAAGG - Intronic
1186799979 X:13083194-13083216 CTGTGAAATGGGAAAGAGGAAGG - Intergenic
1187479899 X:19645861-19645883 CTGGAAAAATGGAAGTAGGAGGG + Intronic
1188072041 X:25729039-25729061 CAGAAAAATAGGAAGATGGATGG - Intergenic
1188411696 X:29880684-29880706 CTGTCAAAAGGGAAGTTTGATGG - Intronic
1188582482 X:31731401-31731423 CTGTGACATGGGAAGCTGAAAGG + Intronic
1189416205 X:40816594-40816616 CTGTTGAATGGAAAGTGGGATGG - Intergenic
1189537670 X:41953376-41953398 CTGTAAAATGGGATAGTGGTGGG + Intergenic
1194429808 X:93788031-93788053 CTTTAAAATGGTAAATTGTATGG - Intergenic
1194818336 X:98473198-98473220 CTGTAAAAGGGGAAAATTGACGG + Intergenic
1195482495 X:105362250-105362272 CTTGAAAATGTGAAGGTGGATGG + Intronic
1196097739 X:111817648-111817670 CTGTGAACTGTGAAGTTGGCAGG + Intronic
1199458309 X:148054227-148054249 CTGTGAAATAGGAAGGTGCATGG + Intergenic
1200243709 X:154511608-154511630 CTGCAAAAGGGCAACTTGGAAGG - Intronic
1201917010 Y:19192741-19192763 TTGAAAAGTGGGAATTTGGACGG - Intergenic