ID: 1102428273

View in Genome Browser
Species Human (GRCh38)
Location 12:112861711-112861733
Sequence GGAGTCATTAAGAATATCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102428270_1102428273 1 Left 1102428270 12:112861687-112861709 CCTTAGCTTCTAGTGTAACTGGG 0: 1
1: 0
2: 7
3: 251
4: 4738
Right 1102428273 12:112861711-112861733 GGAGTCATTAAGAATATCCCCGG 0: 1
1: 0
2: 0
3: 15
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102428273 Original CRISPR GGAGTCATTAAGAATATCCC CGG Intronic
900006652 1:60215-60237 AGAGTAAATAAGATTATCCCTGG - Intergenic
900720761 1:4174456-4174478 GGAGTGAAGAAGAATGTCCCCGG + Intergenic
903097192 1:20988902-20988924 GATGCCATTAAGAATATTCCTGG + Intronic
904472203 1:30742857-30742879 GGAGTAAATGAGACTATCCCAGG + Intronic
913441616 1:118904407-118904429 GAGGTCTTTTAGAATATCCCTGG - Intronic
915769972 1:158410915-158410937 GGAGGCATTGTGAATAACCCTGG + Intergenic
918388056 1:184030697-184030719 GGAGTCACAAAGAAACTCCCTGG + Intronic
919300287 1:195753760-195753782 GGGTTCATTAAGAATAACCCTGG - Intergenic
920516306 1:206586942-206586964 GGAGGCCTTAAGAGAATCCCAGG + Exonic
921256702 1:213347920-213347942 GGGGTTATTAAGCATACCCCAGG + Intergenic
923020146 1:230157052-230157074 GGAGTAAATAAGACCATCCCAGG + Intronic
1063325811 10:5100509-5100531 GGAATCATTAACAATAACTCAGG - Intronic
1064133853 10:12733387-12733409 GGAGTCATAAACAATCTCCCAGG + Intronic
1066597234 10:37064194-37064216 ACTGTCATTAAGAATATGCCTGG - Intergenic
1068626168 10:59250508-59250530 CCAGTCCTAAAGAATATCCCTGG + Intronic
1071263768 10:83945462-83945484 GGAGTCATGAAGACCATCCCAGG - Intergenic
1071731521 10:88253407-88253429 GGATGCAATAAGAATAACCCAGG - Intergenic
1073712581 10:106061473-106061495 GGAGGCATTAAACATATCCATGG + Intergenic
1074749667 10:116572629-116572651 GAAGTCAGTAGGAATATTCCAGG - Intergenic
1074754259 10:116612828-116612850 GAAGTCAATAGGAATATTCCAGG + Intergenic
1078356517 11:10635945-10635967 GGAGGCACTCAGAATCTCCCGGG + Intronic
1081146843 11:39571702-39571724 GGAGTCAGTAAGAGAATCCCTGG + Intergenic
1081230238 11:40577408-40577430 GGAGTCACTAGTAATATGCCAGG + Intronic
1081708187 11:45198793-45198815 GGAGTCATTAGGAAAATCTTGGG + Intronic
1083677010 11:64331969-64331991 GGAGTCATTCAGAAACTGCCTGG - Intergenic
1085686902 11:78631618-78631640 GGAATTATTTAGAAAATCCCTGG - Intergenic
1085892372 11:80596346-80596368 ACTGTCATTAAGAATATGCCTGG + Intergenic
1087660256 11:100979400-100979422 GGAATCATCATGAATATCCATGG + Intronic
1096604477 12:52754799-52754821 GGATTCAGCCAGAATATCCCAGG + Intergenic
1098308676 12:69126310-69126332 GGAGTAATTCAGAATCTCCTTGG - Intergenic
1099634089 12:85191350-85191372 GGAGTCAGTAAAAAGATCACTGG - Intronic
1102428273 12:112861711-112861733 GGAGTCATTAAGAATATCCCCGG + Intronic
1105243724 13:18629035-18629057 GGAGTCAGTGGGAATAACCCCGG - Intergenic
1106529771 13:30578872-30578894 GGAATGAATGAGAATATCCCAGG - Intronic
1106738690 13:32615408-32615430 AGAGTGATTAGGAAGATCCCTGG + Intronic
1108847714 13:54696573-54696595 GGAGCCAGGAAGAATAGCCCTGG + Intergenic
1109337517 13:61010949-61010971 ATAGTCATTAATAATAACCCAGG + Intergenic
1113779823 13:112969644-112969666 GCAGTCATTTTGACTATCCCGGG - Intronic
1114244855 14:20903521-20903543 GGATTAATTATGAATATCCCAGG - Intergenic
1114410114 14:22493042-22493064 TGATTCATTAAGAATTTCCATGG + Intergenic
1116375497 14:44194368-44194390 AGAGTCATTAAGAATATTTTAGG + Intergenic
1117374612 14:55109107-55109129 GGAGTGATCAAGAAGATGCCTGG + Intergenic
1118534770 14:66749039-66749061 AGAGACATTAAAAATATCCATGG - Intronic
1123487570 15:20755596-20755618 GGAGTCAGTGGGAATAACCCCGG + Intergenic
1123544062 15:21324654-21324676 GGAGTCAGTGGGAATAACCCCGG + Intergenic
1125044850 15:35233530-35233552 GGAATCATTAAGACTTTCTCAGG + Intronic
1126111399 15:45177051-45177073 AGAGTGGTCAAGAATATCCCAGG - Intronic
1126911317 15:53419832-53419854 GGAGTCATAAAGACAAGCCCAGG + Intergenic
1132446813 15:101930426-101930448 AGAGTAAATAAGATTATCCCTGG + Intergenic
1202952405 15_KI270727v1_random:51928-51950 GGAGTCAGTGGGAATAACCCGGG + Intergenic
1138268846 16:55680255-55680277 GGAGTCATTTACAATAGCTCTGG + Intronic
1139056692 16:63194373-63194395 GGGCTAATTTAGAATATCCCCGG - Intergenic
1140057468 16:71537648-71537670 GGAGACATTAAGGGCATCCCTGG - Exonic
1140086017 16:71797839-71797861 GGATTCATGAAGAATATGCTAGG - Intronic
1141649569 16:85385809-85385831 GGAGCCATTAAGAATGACCGCGG + Intergenic
1141884648 16:86883129-86883151 TGAGTGATTCAGAGTATCCCAGG - Intergenic
1141991284 16:87611870-87611892 CGAGTCACTAAGAATGTCCCTGG + Intronic
1144270508 17:13610821-13610843 GGGGTCATTAAAAATATCACTGG - Intergenic
1148990962 17:51667058-51667080 GGAATCAATATGACTATCCCTGG - Intronic
1149511343 17:57244181-57244203 GTTCTCATTAAAAATATCCCAGG - Intergenic
1149554587 17:57564204-57564226 GCAGTAATTAAGAATTGCCCAGG + Intronic
1150195339 17:63292287-63292309 GGAGTCATTAAAGATATATCAGG + Intronic
1150420610 17:65031687-65031709 GGACTCATTAAGCATATGCTTGG + Intronic
1154445218 18:14430850-14430872 GGAGTCAGTGGGAATAACCCCGG + Intergenic
1158127790 18:54121177-54121199 TTAGACATTAGGAATATCCCAGG + Intergenic
1158717005 18:59889434-59889456 GAAGTCATCTTGAATATCCCTGG - Intergenic
1160638406 19:101791-101813 AGAGTAAATAAGATTATCCCTGG - Intergenic
1164366247 19:27585427-27585449 GGAGTAAAACAGAATATCCCAGG + Intergenic
1164398468 19:27886699-27886721 GGAGTTCTAAAGAACATCCCTGG - Intergenic
1168677103 19:58286446-58286468 GGAGTCATTCAGGATGTGCCAGG + Exonic
926367528 2:12146623-12146645 GGACTCATTATGAATATCAAAGG + Intergenic
926427371 2:12751378-12751400 GGTGTCACTAAGAAGATCCTTGG - Intergenic
935212369 2:100949539-100949561 GGGGGCATTAAGAATCGCCCAGG + Intronic
935533228 2:104261274-104261296 GGAGTCAGGAAGAATATTCCAGG - Intergenic
938807024 2:134815514-134815536 GGAGTGATTAAGACCATCCTGGG + Intergenic
939792889 2:146601736-146601758 GTAGTATATAAGAATATCCCAGG - Intergenic
941271990 2:163441834-163441856 GGAATGAGTAAGAATTTCCCAGG + Intergenic
945531248 2:210955800-210955822 TGAGTCACTATGAATAGCCCTGG - Intergenic
1174613176 20:51815790-51815812 CTAGTCATTAAGAAGATGCCTGG + Intergenic
1175045720 20:56103202-56103224 AGAGCCAATCAGAATATCCCTGG + Intergenic
1175583787 20:60121400-60121422 GGAGACATTAGGAAGCTCCCAGG + Intergenic
1176450774 21:6859013-6859035 GGAGTCAGTGGGAATAACCCCGG - Intergenic
1176828943 21:13724031-13724053 GGAGTCAGTGGGAATAACCCCGG - Intergenic
1177652814 21:23979808-23979830 CAAGTCATTAAGAATATAGCAGG - Intergenic
1180658416 22:17444324-17444346 GGAGTAATTAAAAATAGCCTTGG + Intronic
1181913015 22:26255544-26255566 GGAGTCATGAAGGATTTCTCAGG - Intronic
1181993762 22:26858726-26858748 GAAGTCATTCACTATATCCCAGG - Intergenic
1182229690 22:28828190-28828212 AGAGTCAGTAAGAATTTCCTAGG - Intergenic
1182614384 22:31576939-31576961 GTAGTGATTAAGAATATGGCTGG - Intronic
953507237 3:43498291-43498313 GGAGGCATTAGAAATATCCAAGG - Intronic
954441407 3:50524287-50524309 AGAGTCATGAACAATGTCCCGGG + Intergenic
956889378 3:73596689-73596711 GGAGTCTTTAAAAATATCAATGG + Intronic
957019508 3:75109296-75109318 GGAGGCATAAAAAAAATCCCAGG - Intergenic
960328935 3:116333191-116333213 TCAATCATTAAAAATATCCCAGG - Intronic
960456762 3:117881975-117881997 GGAGGCCTTTAGAATAGCCCAGG - Intergenic
961620489 3:128220305-128220327 GGAGTAATTGAGATTATTCCTGG - Intronic
961732572 3:128977188-128977210 TCAGTTATTAACAATATCCCAGG - Intronic
962468923 3:135687817-135687839 GGAGTCATCTAGAATCTCCTAGG + Intergenic
963873394 3:150445017-150445039 AGAGTATTTAAAAATATCCCAGG - Intronic
970672317 4:18411040-18411062 GGAGTAATTACAAATATTCCAGG - Intergenic
974542472 4:63255659-63255681 TTAATCATTAAGAATATACCAGG + Intergenic
981805854 4:148714181-148714203 GGAAGCATTACAAATATCCCTGG + Intergenic
981816313 4:148834760-148834782 TGAGTCCCTCAGAATATCCCTGG + Intergenic
983813332 4:172091522-172091544 GGAGCCATTAAAAATCTCCTTGG - Intronic
984790983 4:183614856-183614878 GGGTTCATTAGGATTATCCCGGG - Intergenic
985985053 5:3508429-3508451 GGAGTTATGACGATTATCCCTGG + Intergenic
986541238 5:8845918-8845940 TGAGTCACTAAGAAAATCTCAGG - Intergenic
988517946 5:31920801-31920823 GGAGACAGTAAGAAGATCCCTGG - Intronic
989222204 5:38979972-38979994 GAAGTCAATAAAAATATCCAAGG - Intronic
989765415 5:45076847-45076869 GGAGGGATTAAGAATATGCATGG - Intergenic
990673406 5:58157905-58157927 GGAGGCATTAAGGATACACCTGG - Intergenic
994059003 5:95453192-95453214 GAAGTCTATAAGAATATTCCTGG + Intergenic
994200005 5:96962759-96962781 AGAGTAATTAAGAATATCTCTGG - Intronic
994396735 5:99231555-99231577 CAAGACATTACGAATATCCCAGG - Intergenic
997046119 5:130320110-130320132 GGAGTCAATAAGAAATTTCCAGG + Intergenic
1000034174 5:157430681-157430703 GGTGCCATTAAGAAAATCCCTGG + Intronic
1002537761 5:179887227-179887249 TCAGTCATTGAGAATATGCCTGG - Intronic
1003763356 6:9208149-9208171 GCTGTCCTTAAGAATATCTCAGG - Intergenic
1003869245 6:10388938-10388960 GGAATCATTAAGAAGCTACCTGG + Intergenic
1004290417 6:14362007-14362029 TGAGCCATTTAGAATCTCCCAGG - Intergenic
1009619680 6:66058303-66058325 GGAGAAATAAAGACTATCCCAGG - Intergenic
1011655494 6:89547736-89547758 GAAATCATTGAGTATATCCCAGG + Intronic
1011670501 6:89678772-89678794 GGAGACAATAAGAAAATCCCAGG + Intronic
1013905944 6:115219930-115219952 GGAATCATTATGATTACCCCTGG - Intergenic
1019759439 7:2799254-2799276 GGACTCATTTAGAATATACAAGG + Intronic
1020504975 7:8974610-8974632 GGAGTCAGTAAAAATATCAGTGG + Intergenic
1021763343 7:23922644-23922666 TGAGTCTTTTAGACTATCCCAGG - Intergenic
1022251951 7:28617166-28617188 GGAGTATTTAACAACATCCCTGG + Intronic
1022812177 7:33880510-33880532 GGAGACATAAAGACTGTCCCTGG - Intergenic
1023185093 7:37524689-37524711 TGAGGCATTTAAAATATCCCTGG + Intergenic
1023796065 7:43793485-43793507 GGAGAAATTAAGACTTTCCCAGG + Intronic
1024972477 7:55083384-55083406 TGAGTCAAGAAGAAAATCCCAGG - Intronic
1031221454 7:118971618-118971640 TGACTCTTTAAGAATATCCTTGG + Intergenic
1032360309 7:131249220-131249242 GAGGTCATTAAGGATCTCCCTGG + Intronic
1034137666 7:148786327-148786349 GTAGTCATTTAGAATATCCAAGG - Intronic
1035993771 8:4522492-4522514 GGATTAATTAAGAATATCTGAGG + Intronic
1035994296 8:4528922-4528944 GGAGTCATCTAAAATACCCCAGG + Intronic
1039273027 8:35903672-35903694 AGAGGAATTAAAAATATCCCTGG + Intergenic
1040019405 8:42726892-42726914 GGAGACATAAATAATATTCCTGG + Intronic
1043585730 8:81768030-81768052 GGAATCATTTAGATTATCACTGG - Intergenic
1043707237 8:83366264-83366286 GGAGGAATAAAGAATAGCCCAGG + Intergenic
1045566846 8:103326417-103326439 GGAGTCATTATTAATATAGCAGG - Intronic
1049123957 8:140768647-140768669 GCAGTCATTCAGAATATCACTGG - Intronic
1052582526 9:30377269-30377291 GGAGACATTAAAAATATCACTGG + Intergenic
1056365833 9:85903773-85903795 GGAATCATGAAAAATATTCCTGG - Intergenic
1058617104 9:106842369-106842391 GGGTTCATTAAGAATAAACCAGG + Intergenic
1058651572 9:107179841-107179863 GGAGTCAGTAATAACATCCAAGG + Intergenic
1203518407 Un_GL000213v1:25504-25526 GGAGTCAGTGGGAATAACCCCGG + Intergenic
1185663316 X:1744301-1744323 GTAGTCAAGAAGAAGATCCCAGG + Intergenic
1188331885 X:28882667-28882689 GGAGAAATTAAGATTTTCCCAGG + Intronic
1189411264 X:40774055-40774077 GGAGTCACGCAGAATATGCCTGG + Intergenic
1190506438 X:51130828-51130850 TCAGTCATAAAGAATCTCCCAGG - Intergenic
1200721602 Y:6613085-6613107 GTAGTCATCCAGACTATCCCAGG + Intergenic