ID: 1102431143

View in Genome Browser
Species Human (GRCh38)
Location 12:112883482-112883504
Sequence ATCTTTTTAGAGTGAAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102431143 Original CRISPR ATCTTTTTAGAGTGAAGCCC TGG (reversed) Intronic
902701951 1:18178688-18178710 TCCTTTTAAGAGTTAAGCCCTGG + Intronic
908211007 1:61900151-61900173 ATCATCTTAAAGTGCAGCCCTGG - Intronic
910978139 1:92929959-92929981 ATTTAGTTGGAGTGAAGCCCAGG - Intronic
916508175 1:165446671-165446693 AGCTCTTTACAGTGAAGGCCTGG - Intergenic
921373296 1:214447808-214447830 ATATTTTTAGATTTAAGCGCTGG - Intronic
924949467 1:248868716-248868738 ATCTTTTTAGAGTCAGTCACTGG - Intergenic
1063359471 10:5439611-5439633 ACCTAGTTAGAGTGAGGCCCTGG - Intronic
1065443898 10:25777764-25777786 GAATTTTTAGAGTAAAGCCCAGG - Intergenic
1075464929 10:122644221-122644243 ATGTTTGCAGAGTGATGCCCAGG + Intergenic
1077523728 11:3051380-3051402 TTCTTCTCAGAGGGAAGCCCCGG - Intronic
1077560859 11:3259807-3259829 ATCTATTTTGAGTGCAGTCCGGG - Intergenic
1077566755 11:3305637-3305659 ATCTATTTGGAGTGCAGTCCGGG - Intergenic
1078804939 11:14689416-14689438 GTCCTTTAAGATTGAAGCCCTGG + Intronic
1080270680 11:30448023-30448045 ATGTTTTCAGAGAGAAGCCCTGG + Intronic
1080325073 11:31062166-31062188 CTCTTTCTTGAGTAAAGCCCAGG + Intronic
1086280874 11:85186981-85187003 ATATTTTTATATTAAAGCCCTGG + Intronic
1088189190 11:107208212-107208234 GTCTTGTTAGAGTCTAGCCCTGG - Intergenic
1089024323 11:115253009-115253031 TTCTTTTTCCAGTGAGGCCCAGG - Intronic
1090865872 11:130699950-130699972 ATCTTCATATAGTGATGCCCTGG - Intronic
1092583637 12:9875199-9875221 ATTTTTTTAAAGAGATGCCCTGG - Intergenic
1095102112 12:38196127-38196149 ATGTTGTTATAGTGAAGCTCAGG - Intergenic
1095216487 12:39556196-39556218 ATCTTTTTAGAGTCAGTCACTGG - Intronic
1097461441 12:59868066-59868088 ATCTTTTAAGAGTAAAGTCAAGG - Intergenic
1102431143 12:112883482-112883504 ATCTTTTTAGAGTGAAGCCCTGG - Intronic
1102891771 12:116564842-116564864 AGCTTTTTAGACTGCAGCACAGG - Intergenic
1103848119 12:123913718-123913740 ATCACTTAAGACTGAAGCCCAGG - Intronic
1105236916 13:18565250-18565272 ATATGTTTAGTTTGAAGCCCTGG - Intergenic
1105251207 13:18699897-18699919 ATCCTTTTGGAGTGAAGCTTTGG + Intergenic
1108545350 13:51487975-51487997 CTCCTTTGAGAGTGAAGCCTTGG - Intergenic
1109707085 13:66109983-66110005 AACTTTTTAGGGTGAAGAACAGG + Intergenic
1110469340 13:75841501-75841523 ATGTTTTTTGAGTGGAGTCCTGG + Intronic
1111244494 13:85517942-85517964 ATATCTTTAGAGTGATTCCCAGG - Intergenic
1112805334 13:103158697-103158719 ATCTTCTCAAAGTGCAGCCCTGG - Intergenic
1113583357 13:111445070-111445092 ATCTTTTGAAACTGTAGCCCAGG + Intergenic
1116127312 14:40804338-40804360 AAATTTTTGCAGTGAAGCCCTGG + Intergenic
1118247647 14:64126956-64126978 ATCATTTGAAAGTGAAGCCCTGG + Intronic
1119899162 14:78245129-78245151 ATCCTTTTAGGATTAAGCCCTGG + Intronic
1119950431 14:78738849-78738871 ATGATTTTTGAGTAAAGCCCAGG + Intronic
1126899736 15:53302656-53302678 ATATTTTTAAAGTGAAGCATTGG - Intergenic
1129348304 15:74938310-74938332 ATCTTGTTCGAGTCAGGCCCAGG + Intergenic
1131546708 15:93321862-93321884 ATATTTTCACAGTGAAGCTCAGG + Intergenic
1134589731 16:15442899-15442921 ACCTTTTAAGAGTGAAGGCTGGG - Intronic
1139158447 16:64473754-64473776 ATCTTTTAAGAGTAAATGCCAGG + Intergenic
1141506866 16:84483676-84483698 ATCTTTCTAGATTGGAGCCTTGG - Intronic
1142211522 16:88810874-88810896 CCCTTTTTAGACAGAAGCCCTGG - Intronic
1142371748 16:89686509-89686531 CTTATTTTAGGGTGAAGCCCGGG - Exonic
1143682175 17:8484326-8484348 ATTTTTTTAGAGATGAGCCCTGG + Intronic
1146125463 17:30227908-30227930 CTCTGTGTAGAGAGAAGCCCAGG - Intronic
1148284000 17:46372359-46372381 ATCTTTTTTGGGGGAAGCCAGGG + Intergenic
1148306221 17:46590280-46590302 ATCTTTTTTGGGGGAAGCCAGGG + Intergenic
1150132486 17:62676608-62676630 ATCTGTTTATGGGGAAGCCCTGG - Intronic
1153235348 18:2980757-2980779 TTCTTGTTAGAGAGAACCCCCGG - Intronic
1154437727 18:14360059-14360081 ATCCTTTTGGAGTGAAGCTTTGG - Intergenic
1154512626 18:15124667-15124689 ATATGTTTAGTTTGAAGCCCTGG + Intergenic
1154995427 18:21636015-21636037 ATCTTTCTATAGTGATGCTCAGG + Intergenic
1155442703 18:25878697-25878719 ATAATTTCAGAGTGAATCCCAGG - Intergenic
1156666097 18:39408842-39408864 CTCCTTTTAGAGTGAAACCAAGG + Intergenic
1159291542 18:66429233-66429255 ATCTTTTTAGATTCTAACCCTGG - Intergenic
924964684 2:64803-64825 TACTTTTGAGAGTGAAGGCCAGG - Intergenic
926107950 2:10164148-10164170 ACCTTTTTTGAATGGAGCCCAGG + Intronic
928783948 2:34858723-34858745 GTCTTTTTATAGGAAAGCCCAGG + Intergenic
928963657 2:36955491-36955513 ATCTTTGTAGAGTTAAGAACAGG + Intronic
929088204 2:38189545-38189567 ATCCAATTAGAGTGAATCCCAGG - Intergenic
929307219 2:40377186-40377208 TTCTTCTTTCAGTGAAGCCCTGG - Intronic
930909334 2:56611729-56611751 ACCTTTTTAGAGTGCAGGGCGGG - Intergenic
931370565 2:61658689-61658711 TTCTGTTAAGAGTGAAGGCCGGG - Intergenic
934645793 2:96058773-96058795 CACTTTTGAGAGTGAAGGCCGGG + Intergenic
934839197 2:97614862-97614884 CACTTTTGAGAGTGAAGGCCGGG + Intergenic
935043601 2:99458911-99458933 ATCTTTGTAGTGTGGAGGCCGGG + Intronic
935275513 2:101472615-101472637 TTCTTCTTACAGTGTAGCCCAGG - Intronic
938512871 2:131969299-131969321 ATATGTTTAGTTTGAAGCCCTGG + Intergenic
939105101 2:137939805-137939827 ATCCTTTTGGAGTGAAGCTTTGG + Intergenic
940734234 2:157430784-157430806 ATGTTTTGAGAGTGAAGGTCAGG - Intronic
944153018 2:196582176-196582198 ATATTTTGAGAGTGAAAACCAGG - Intronic
944945224 2:204676596-204676618 ATCTTTCAAGAGTGAAGCAAAGG - Intronic
948132658 2:235612160-235612182 TTCTTTTCTCAGTGAAGCCCAGG + Intronic
1170873156 20:20226738-20226760 ACCTCATCAGAGTGAAGCCCAGG - Intronic
1172988690 20:39015180-39015202 ATCTCTTAGGAGTGTAGCCCTGG - Intronic
1173164890 20:40680973-40680995 ATCTCTCTAGAGTAAAGCTCAGG + Intergenic
1176780903 21:13193535-13193557 ATATGTTTAGTTTGAAGCCCTGG - Intergenic
1176836728 21:13799781-13799803 ATCCTTTTGGAGTGAAGCTTTGG + Intergenic
1181583931 22:23842653-23842675 TTCTTTATAGAGGGAAGCCCTGG + Intergenic
1185001661 22:48250124-48250146 ATCTTTGTATGGTGCAGCCCAGG - Intergenic
1185289947 22:50018370-50018392 ATATTTTTAGAATGCAGCACAGG + Intronic
953411783 3:42694476-42694498 ATCTTTTAAGAGTGTAGCTCAGG + Intronic
958946354 3:100366836-100366858 ATCTTTTTTGAGCGAAGCTGTGG - Intronic
959072030 3:101711506-101711528 TTCTTTTTAGAGACAAGGCCTGG + Intergenic
959521570 3:107327886-107327908 GTCTTTCTAGAGGGAAGCCTCGG + Intergenic
960929212 3:122827594-122827616 TTATTTCTAGAGTCAAGCCCTGG + Intronic
965239139 3:166171975-166171997 ATTTTCTTGGGGTGAAGCCCAGG + Intergenic
965983348 3:174720926-174720948 ATCGTTTTAAAGTCAAGCACCGG - Intronic
966549385 3:181187372-181187394 ATCCTTCTAGAGTGAAACCCAGG - Intergenic
970893047 4:21069422-21069444 AGATTTTTAGATTGAAGTCCTGG - Intronic
971316262 4:25570702-25570724 ATCCTTTAAGAGAGAAGCCAAGG + Intergenic
972829145 4:42793845-42793867 CTCATTTTAAAGTAAAGCCCAGG + Intergenic
974811216 4:66948555-66948577 AATTTTTTAAAGTGAAGCCAGGG - Intergenic
975198257 4:71552142-71552164 ATCTATTCAGAATGAGGCCCTGG + Intronic
976242114 4:82968597-82968619 ATCTTTTAAAAGTGTAGGCCAGG - Intronic
976366827 4:84241973-84241995 ATCTCTTGAGAATGAAGCCCAGG + Intergenic
982549033 4:156773954-156773976 ATGTTTTTAGTATGGAGCCCAGG - Intronic
984402189 4:179280839-179280861 AGATTTTTAGTGTGAAGGCCGGG + Intergenic
985141815 4:186847801-186847823 ATTTTTTAAGAGTAAAGGCCAGG - Intergenic
987511938 5:18850583-18850605 TTCTTTTTTGTGTGAAGCCAAGG + Intergenic
988027427 5:25714809-25714831 ATCTCTTTAGAGTAAACCCATGG + Intergenic
988273144 5:29043708-29043730 ATGTTTTTTAAGTGAAGTCCTGG + Intergenic
991188173 5:63835572-63835594 TTCTTTTTAGAGTTAAGGGCTGG - Intergenic
991608035 5:68422761-68422783 CTGTTTTGAGAGTGAAGCCCAGG + Intergenic
992149620 5:73890222-73890244 ATCTTTTCAAAGTGAAGAACAGG - Intronic
992983498 5:82202628-82202650 GTCTTTCTAGTGAGAAGCCCAGG - Intronic
998244984 5:140492489-140492511 AACATTTTATATTGAAGCCCAGG + Intronic
998360744 5:141584555-141584577 ATCTCTTCAGACTGAAGCACTGG + Intronic
998947688 5:147358427-147358449 ATCTCTTTAGAGTGTATTCCTGG - Intronic
999935375 5:156480457-156480479 GTTTAATTAGAGTGAAGCCCAGG - Intronic
1001437018 5:171707217-171707239 ATTTTTTTAGAGTTGTGCCCTGG + Intergenic
1003883984 6:10504344-10504366 ATGTTTGTAAAGTGGAGCCCGGG - Intronic
1004249341 6:14010623-14010645 ATCAGTTTAGAATTAAGCCCTGG + Intergenic
1006839279 6:37017939-37017961 GTCTTTTAGGAGTGCAGCCCCGG + Intronic
1011769883 6:90663741-90663763 TTTTTTAGAGAGTGAAGCCCAGG + Intergenic
1016913665 6:149224480-149224502 ATCATTTCAGAGTTCAGCCCAGG - Intronic
1017310602 6:152972344-152972366 ATCTTTTTTGAGAGAAGTCTGGG + Exonic
1018861518 6:167713678-167713700 ATCTTTTAAAAGTGAAGTCCAGG + Intergenic
1019662693 7:2233492-2233514 ATCTTCTTAGAGGGAAGCCAGGG - Intergenic
1024924642 7:54600001-54600023 ATCCTTTTCCAGAGAAGCCCTGG - Intergenic
1026454480 7:70558830-70558852 ATTCTTGTGGAGTGAAGCCCAGG + Intronic
1027731258 7:81876199-81876221 ATCTATTAAGTGTGAAGCCCTGG - Intergenic
1028944475 7:96561444-96561466 ATTTTTCTAGACTGATGCCCTGG + Intronic
1029641181 7:101820861-101820883 GTCTTTTTATAGCAAAGCCCAGG + Intronic
1033010018 7:137611375-137611397 ATCTGTTTGGGGTAAAGCCCAGG + Intronic
1034184886 7:149167959-149167981 ATATTTTTATAGTGAACACCTGG + Intronic
1039913422 8:41842505-41842527 AAATTTTTGGAATGAAGCCCTGG + Intronic
1042081958 8:65063785-65063807 ATCTTTTCAAAGTGAATTCCTGG - Intergenic
1042939563 8:74093597-74093619 ATGTTTTTAGAGTGAGGCAATGG + Intergenic
1045048525 8:98301885-98301907 ATCTTTTCAGAGAGGAGCACAGG - Intergenic
1047185877 8:122632983-122633005 TTCTTTTTGAAGAGAAGCCCAGG - Intergenic
1048710876 8:137208952-137208974 ATCTTTTTGGAGTGAAGTTTTGG + Intergenic
1048949699 8:139485700-139485722 ATCTTTTTAGAGTGAGGCCAAGG - Intergenic
1052346030 9:27410560-27410582 ATCTTTCTGGAGTTAAGCACAGG + Intronic
1054739664 9:68792122-68792144 GCCTTTATAGAGGGAAGCCCTGG - Intronic
1055110619 9:72555919-72555941 ATCATTTAAGAGTTAAGTCCAGG - Intronic
1055307689 9:74947231-74947253 ATCTCTCAAGAGTGAGGCCCAGG + Exonic
1058367697 9:104229905-104229927 ATCTTCTTAGAGAGAAGCATTGG + Intergenic
1058970838 9:110081572-110081594 ATCTTTTCACAGAGAATCCCAGG + Intronic
1187572976 X:20523916-20523938 AACTTTTCAGGTTGAAGCCCTGG - Intergenic
1187718335 X:22126628-22126650 ATCTCATTAAAGTAAAGCCCTGG + Intronic
1188565782 X:31524538-31524560 ATCTTATCAGAGTGAAACCGGGG - Intronic
1189516595 X:41718823-41718845 CTCTTTTCAGAAGGAAGCCCGGG - Intronic
1189974121 X:46445503-46445525 ATCTTTAGAGCCTGAAGCCCAGG - Intergenic
1190249975 X:48715699-48715721 ATCTTTTTGGATTGATGTCCAGG - Intergenic
1193887242 X:86997455-86997477 ATCATGTAAGAGTCAAGCCCTGG + Intergenic
1196407968 X:115385631-115385653 ATCCTTTAAGAGTGAAGCAGAGG + Intergenic
1197894360 X:131295617-131295639 ATCTTTTTACAGTGAATATCTGG + Intronic
1198525960 X:137501268-137501290 ATACTTTTAGAGAGAAGCCAAGG + Intergenic
1199848710 X:151710124-151710146 ATCTTCTAAGAGTGAAGGGCAGG + Intergenic
1201756524 Y:17492538-17492560 ATCTTATTACAGTGATGCACAGG - Intergenic
1201845028 Y:18413447-18413469 ATCTTATTACAGTGATGCACAGG + Intergenic