ID: 1102431883

View in Genome Browser
Species Human (GRCh38)
Location 12:112890241-112890263
Sequence TCAGAGGCTTAGGTGTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 252}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102431883_1102431892 9 Left 1102431883 12:112890241-112890263 CCTCTCCACACCTAAGCCTCTGA 0: 1
1: 0
2: 3
3: 25
4: 252
Right 1102431892 12:112890273-112890295 AGCCCCTTTCTCTCATACCCAGG 0: 1
1: 0
2: 1
3: 16
4: 225
1102431883_1102431896 21 Left 1102431883 12:112890241-112890263 CCTCTCCACACCTAAGCCTCTGA 0: 1
1: 0
2: 3
3: 25
4: 252
Right 1102431896 12:112890285-112890307 TCATACCCAGGATGCCCACCAGG 0: 1
1: 0
2: 1
3: 11
4: 114
1102431883_1102431899 28 Left 1102431883 12:112890241-112890263 CCTCTCCACACCTAAGCCTCTGA 0: 1
1: 0
2: 3
3: 25
4: 252
Right 1102431899 12:112890292-112890314 CAGGATGCCCACCAGGTTTTTGG 0: 1
1: 0
2: 2
3: 16
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102431883 Original CRISPR TCAGAGGCTTAGGTGTGGAG AGG (reversed) Intronic
900192441 1:1357114-1357136 GCTGAGCCTTAGGTGTGGTGTGG - Intronic
901335482 1:8445468-8445490 CCAGATGCTTGGGTGTGGTGTGG - Intronic
903014403 1:20352624-20352646 TGAGAGACTCAGGTCTGGAGTGG + Intronic
903576910 1:24344991-24345013 GCGGAGGCACAGGTGTGGAGGGG - Intronic
903576997 1:24345275-24345297 GCGGAGGCACAGGTGTGGAGGGG - Intronic
903603145 1:24556431-24556453 CCAGATGCTTGGGTGGGGAGGGG - Intronic
903695568 1:25204105-25204127 TAAGAGGCTTGGGTGAGGCGTGG - Intergenic
907730542 1:57061371-57061393 ACAGAGTCTTAGGTTTGGAAGGG + Intronic
908253725 1:62285413-62285435 TAAAAGGCGTAAGTGTGGAGAGG - Intronic
911139363 1:94482089-94482111 CCATAGGCTTAGGTGTGGAGAGG + Intronic
912672874 1:111647773-111647795 TGAGAGGCTAAGGTGGGAAGGGG - Intronic
912978644 1:114351329-114351351 CCAGTGGCTGAGGTGTGGGGTGG - Intergenic
915302556 1:154959676-154959698 TCGGAGGCTTCCGTGTGCAGGGG - Exonic
918023420 1:180717587-180717609 TCAGAATCTTGGGTGTGGATTGG + Intronic
918379239 1:183937870-183937892 TCCCAGGCTAAGGGGTGGAGCGG + Exonic
919021260 1:192108710-192108732 CCTGAGGCTTAGTAGTGGAGAGG + Intergenic
920033073 1:203048853-203048875 CCAGAGGCTCAGGTCTGGAATGG + Intronic
920954061 1:210601351-210601373 TCAGAGGCTTAGTTGGGGCTTGG - Intronic
921957166 1:220997062-220997084 TCAAAGGCTGGGGTGGGGAGAGG - Intergenic
922769729 1:228175430-228175452 TCAGAGGCTCTGATGTGCAGAGG - Exonic
1064295534 10:14076057-14076079 TCAGAGGCCCAGGTGAGCAGCGG - Intronic
1065073752 10:22055049-22055071 CCAGAGGCTGAGGAGGGGAGAGG - Intergenic
1065509177 10:26460790-26460812 TCAGAGGGTTGGATGGGGAGCGG + Intronic
1066450052 10:35520855-35520877 TCAGAGGACTTGGTGGGGAGGGG - Intronic
1067684234 10:48457478-48457500 TGGGAGGCCTAGGGGTGGAGGGG - Intronic
1067805162 10:49386960-49386982 TCAGAGGGCATGGTGTGGAGAGG - Intronic
1067813245 10:49447739-49447761 TGAGAGGCTGGGGTGGGGAGGGG - Intergenic
1069897890 10:71690211-71690233 TGAGAGGCTTAGGGATGGACTGG - Intronic
1070275008 10:74997540-74997562 TAAGAGACTTCGGAGTGGAGTGG - Intronic
1070573230 10:77657398-77657420 TCAGAGGATCAAGTGTGGATAGG + Intergenic
1070772602 10:79091017-79091039 GCAGAGGTCTAGGTGGGGAGTGG - Intronic
1074228187 10:111507915-111507937 TCACAGGCTTAGGTGGGGGCAGG + Intergenic
1074657199 10:115604601-115604623 TAAGAGGTCTAAGTGTGGAGAGG - Intronic
1075091886 10:119448396-119448418 TCTGCAGCTTAGGTGAGGAGTGG - Intronic
1075394764 10:122119378-122119400 CCAGGGGCTTAGGTGGGCAGGGG - Intronic
1075954691 10:126512710-126512732 TCAGAGCCCTAGGTTTGGGGAGG - Intronic
1076253195 10:128999134-128999156 TCAGGGGCCTAGGTGGGCAGCGG + Intergenic
1078318365 11:10310357-10310379 TCAGTGGCTTAGCTCAGGAGAGG - Intronic
1079303099 11:19296853-19296875 GCAGAGGGTGGGGTGTGGAGAGG + Intergenic
1079522303 11:21342398-21342420 TGAGAGGCTTAAGTGGGGGGGGG + Intronic
1085326958 11:75613596-75613618 CCAGAGGCTCTGTTGTGGAGGGG - Intronic
1089254436 11:117186824-117186846 TCAGAGGCTGAGGTGTTGCTTGG + Intronic
1089285968 11:117408410-117408432 TCTGAGGCTTAGGTGTAGCGGGG + Intronic
1089496861 11:118912338-118912360 TTAGGGGGTTAGGTGGGGAGGGG + Intronic
1094455900 12:30632582-30632604 GCAGAGCTTTGGGTGTGGAGAGG - Intronic
1094715288 12:33007841-33007863 TCAAAGAATTAGGTGTGGTGAGG - Intergenic
1096510253 12:52123877-52123899 TCAAAGGCTTTGATCTGGAGGGG - Intergenic
1096868378 12:54578350-54578372 TCAGAGCCCTATGTGTGGGGAGG + Exonic
1097755409 12:63401860-63401882 TCAGAGGCTCAGCTGTGGTCAGG + Intergenic
1097836527 12:64278750-64278772 TCAGAGGCTTAGGGGCGGGGTGG - Intronic
1097932446 12:65204324-65204346 TCAGAGGGTTGGGTGGGGTGAGG - Intronic
1098512385 12:71332008-71332030 CCAGAGGCTGAGCTGTGGGGAGG + Intronic
1100605437 12:96148702-96148724 ACAGAGGCTTAGGCTTGGGGAGG - Intergenic
1100691011 12:97038505-97038527 TCAGAGGTTGGGGTGGGGAGGGG - Intergenic
1101618787 12:106363327-106363349 TAGCAGGTTTAGGTGTGGAGGGG - Intronic
1102431883 12:112890241-112890263 TCAGAGGCTTAGGTGTGGAGAGG - Intronic
1102519785 12:113471200-113471222 TCACAAGCTTAGATGGGGAGCGG - Intronic
1103063538 12:117878035-117878057 TGAGGGGCTGAGATGTGGAGAGG + Intronic
1103401199 12:120644058-120644080 TTTGAGGCTAAGGTGTGGAATGG + Intronic
1104070711 12:125343015-125343037 TCAAATGCTGAGGTGTGGAAGGG + Intronic
1104375236 12:128260187-128260209 CCAAAGACTTAGGGGTGGAGAGG + Intergenic
1108520988 13:51246889-51246911 TGAGAGGCTTGGGTGTGAAGAGG - Intronic
1109609126 13:64740257-64740279 ACAGAGACTTAGGTTTTGAGAGG - Intergenic
1110130291 13:72000860-72000882 TCAGTGTCAGAGGTGTGGAGAGG + Intergenic
1110720645 13:78757724-78757746 GCAGAGTCTGAGGTGTGAAGGGG + Intergenic
1110997046 13:82123361-82123383 ACAGAGGGTTAAGTGTTGAGGGG - Intergenic
1111876382 13:93902221-93902243 ACAGAGGCTGAGGAGGGGAGAGG - Intronic
1112441801 13:99429596-99429618 GCAGATTCTTAGGAGTGGAGTGG + Intergenic
1113940615 13:114016829-114016851 TCAGAGGGTCAGGTGAGGAGTGG + Intronic
1117045398 14:51808423-51808445 TCAGAGGCAGAGGTATGTAGAGG + Intergenic
1117166716 14:53041874-53041896 ACAGAGGTGTATGTGTGGAGGGG + Intronic
1117766864 14:59092677-59092699 TCATATTCTTGGGTGTGGAGGGG - Intergenic
1118008152 14:61583861-61583883 TCACATTCTGAGGTGTGGAGAGG - Intronic
1118680042 14:68231469-68231491 TAAGAAGCTTGGGTGTGGGGAGG - Intronic
1122395576 14:101426698-101426720 TCAGAGGTTTAGGTGAACAGAGG - Intergenic
1122564588 14:102643571-102643593 TCAGAGGCCCAGGTGTGGTGTGG + Intronic
1126245206 15:46497169-46497191 TAAGAAGCTGAGGTCTGGAGAGG + Intergenic
1126781729 15:52144770-52144792 TCTGAGCCTTAGGTGTCCAGAGG - Intronic
1129658761 15:77541652-77541674 TCAGAGGCAGACATGTGGAGTGG - Intergenic
1130230837 15:82095316-82095338 TCAGAGGCAGAGGTGAGCAGAGG + Intergenic
1130747654 15:86673246-86673268 CCAGATGCTTAGGTATGAAGGGG + Intronic
1133220897 16:4318743-4318765 TGAGAGGATTAGGTGGTGAGAGG - Intronic
1133834901 16:9359120-9359142 TGAGAGGCTGAGGTGGGCAGAGG - Intergenic
1134645901 16:15865593-15865615 TCAGAAGCTTCGCTGTTGAGGGG - Intergenic
1135228836 16:20685866-20685888 GGAGAGGTTTAGGGGTGGAGCGG + Intronic
1135547279 16:23374775-23374797 TCAGGAGCGCAGGTGTGGAGGGG + Intronic
1136665747 16:31811003-31811025 TCATGGGCTAAGTTGTGGAGAGG - Intergenic
1138659749 16:58510072-58510094 CCAGAGGCTGAAGTCTGGAGGGG - Intronic
1139363474 16:66418393-66418415 TCGGAGGCTGCAGTGTGGAGAGG + Intergenic
1141011266 16:80402075-80402097 TGAGAGGCTGAGGTGGGCAGGGG - Intergenic
1142361436 16:89629507-89629529 TCAGAGGCTTCGGGGGGGGGTGG - Intronic
1142640271 17:1281357-1281379 CCAGAGGACTAGGTGTGGAGGGG + Intronic
1142738148 17:1914743-1914765 TCAGAGGCTGACGGGAGGAGAGG - Intergenic
1142878049 17:2864182-2864204 TCTGAGGCGGAGGTGGGGAGTGG + Intronic
1143036986 17:4005042-4005064 TCGGAGTCTGGGGTGTGGAGGGG + Exonic
1143864587 17:9914692-9914714 CCAGAGGGTTAAGTGTGGAGAGG + Exonic
1144549677 17:16228808-16228830 CCAGAGGCTTGGGAGAGGAGGGG - Intronic
1144575539 17:16427343-16427365 TCTGAGCCTGAGCTGTGGAGAGG - Intronic
1144655196 17:17030788-17030810 TCAGAGCCTTAGGAGCAGAGGGG - Intergenic
1144783403 17:17819002-17819024 ACTGAGGCAAAGGTGTGGAGAGG - Exonic
1144844771 17:18211180-18211202 TCAGAAGCTCAGGCATGGAGTGG - Intergenic
1146458830 17:33027715-33027737 TCAGAGGCTGAAGTGCAGAGTGG - Intronic
1146492852 17:33294345-33294367 GCAGAGATTTGGGTGTGGAGAGG + Intronic
1146683713 17:34826488-34826510 TCAGAGGCTTGGGTGGGGCAAGG - Intergenic
1146929592 17:36768048-36768070 CCAGGGGCACAGGTGTGGAGAGG + Intergenic
1147306295 17:39566707-39566729 TGAGTGTCTTAGGTGGGGAGAGG - Intergenic
1148249692 17:46065571-46065593 TCTGAGGCTTTGGAGAGGAGTGG + Intronic
1148398605 17:47332571-47332593 TCAGAGGCTGGGGGGTGGAGAGG - Intronic
1148534035 17:48423314-48423336 TTAGAGGCTTAGTTGAGGGGAGG + Intronic
1148552655 17:48559845-48559867 TCACAGGCTCAGCTGGGGAGAGG - Intronic
1149533692 17:57415815-57415837 TCAGAGGGATAGCTGTGGAGGGG - Intronic
1149638181 17:58186665-58186687 TCAGAGGCTTGGGAGTTGTGTGG - Intergenic
1150407572 17:64915990-64916012 TCAGAGGCTGAGGTGGTGGGAGG + Intronic
1151222967 17:72627052-72627074 TCAGGGGCTTAGGGAAGGAGTGG - Intergenic
1151929612 17:77223887-77223909 GCAGAGGCTGTGGTGTGGTGTGG + Intergenic
1152535451 17:80948192-80948214 TCAGAGGCTCAGGTGTCCAGGGG - Intronic
1152928026 17:83096704-83096726 TCACTGGCTTAGGTGTGCACCGG + Intergenic
1154926808 18:20944244-20944266 TGGGAGGCTTAGGTGGGGGGAGG + Intergenic
1156031103 18:32713332-32713354 ACAGTGGCTTAGGTGGGAAGGGG - Intronic
1156523283 18:37740146-37740168 TCAGTGGGTTAGGTGTACAGAGG - Intergenic
1160161908 18:76479817-76479839 TCAGGGTCCTGGGTGTGGAGGGG - Intronic
1160591246 18:79945751-79945773 GCAGAGGCTGAGGCCTGGAGGGG - Intronic
1160598544 18:79994796-79994818 CCAGAGGGTTAGGGGTAGAGTGG - Intronic
1161026291 19:2038833-2038855 TCTCAGGCCTTGGTGTGGAGGGG + Exonic
1161420602 19:4174373-4174395 TCAGAGGCTGGGGTGTGGCAGGG + Exonic
1164432542 19:28200738-28200760 CCAGAGGCTTCAGTGGGGAGGGG - Intergenic
1164782198 19:30901882-30901904 TGAGAGGCTTAGATGAGGAAGGG + Intergenic
1165252938 19:34555226-34555248 TCAGAGCCGTTGGTGTGGTGAGG + Intergenic
1165404469 19:35621284-35621306 GCAGAGGCTGAGGTGGGCAGAGG - Intronic
1166035426 19:40164791-40164813 TGGGAGGCTTTGGTGGGGAGAGG - Intergenic
1167605994 19:50481461-50481483 TTAGAGGCTGAGGCGTGGGGTGG + Intronic
1167736115 19:51295558-51295580 TCAGAGGCATAGATGTGGAGGGG + Intergenic
1168639167 19:58019472-58019494 TGAGAGGCGAACGTGTGGAGTGG - Intergenic
926926754 2:17995392-17995414 TGAGAGCAATAGGTGTGGAGAGG - Intronic
927642227 2:24852518-24852540 TCACAGGCTGAGGAGAGGAGGGG + Intronic
929461759 2:42107108-42107130 TGAGAGGCTCAGGTGTTGAAAGG - Intergenic
929570289 2:43018646-43018668 ACAGTGGCATGGGTGTGGAGGGG + Intergenic
929606689 2:43239423-43239445 TCAGAGGCTGAGATTTGTAGTGG - Intronic
930508784 2:52318149-52318171 TCAGAGGAGTAAGTGAGGAGAGG + Intergenic
932470590 2:71952702-71952724 GCAGAGGCTGAGGTGTTGAGAGG - Intergenic
932714431 2:74091001-74091023 ACATAGGCTTTGGTGTAGAGAGG - Intronic
932819347 2:74886428-74886450 GCACAGCCTTGGGTGTGGAGGGG + Intronic
933727512 2:85435112-85435134 TCAGCTGCTGAGGTGAGGAGGGG + Exonic
934869999 2:97854925-97854947 TCAGAGACTTAGGTGTGCACAGG - Intronic
936792439 2:116165416-116165438 TGACAGGCTTAGAGGTGGAGGGG + Intergenic
943023106 2:182598698-182598720 TCAGAGGCTTTGGTAGGGTGAGG - Intergenic
943113551 2:183637681-183637703 TTAAAGGAGTAGGTGTGGAGAGG + Intergenic
946120652 2:217511063-217511085 TCAGAGGCGTCTGAGTGGAGGGG - Intronic
946982265 2:225230278-225230300 TCAGTGTCTTAGTTGGGGAGGGG - Intergenic
947910359 2:233796502-233796524 TCAGAGGGTTGGGTGTGGGGAGG - Intronic
948768820 2:240236926-240236948 TCAGAGGCACAGGGGTGCAGGGG - Intergenic
948931577 2:241135747-241135769 CCAGAGGCTCAGGGGTGGTGGGG - Intronic
1169153151 20:3306257-3306279 TCAGAGGATGGGGTGTGGGGAGG - Intronic
1171332379 20:24351853-24351875 TCAGTGGTTTAGGTGTTCAGCGG + Intergenic
1171409437 20:24936187-24936209 TCAGAGGCTCAACTGTGGAAGGG - Intergenic
1171923295 20:31168265-31168287 TCAAAGGCATAGGAATGGAGAGG + Intergenic
1174118026 20:48241329-48241351 TTAGAGAATTGGGTGTGGAGGGG - Intergenic
1174875558 20:54223190-54223212 TGTGAGGCTTAGGTGTGTGGGGG - Intronic
1174882176 20:54292015-54292037 TCTGTGGGTTAGGTGGGGAGAGG - Intergenic
1177154669 21:17489677-17489699 TCACAGTCTTAGATGTAGAGAGG - Intergenic
1179117276 21:38505348-38505370 GGAGAGGGTGAGGTGTGGAGAGG - Intronic
1182050573 22:27310019-27310041 TGTGAGGCTTAGGGGAGGAGAGG - Intergenic
1182462036 22:30490052-30490074 TCAGAGGGGTGGGTGTGAAGGGG + Exonic
1182535428 22:30998743-30998765 CCAGAGGCTGAGGTGCTGAGTGG + Intergenic
1183588204 22:38765358-38765380 TCAGAGTCTTAGGCCTGGGGAGG - Intronic
1184332524 22:43835185-43835207 TCAGAGCCCTTGGTGTGGGGTGG + Intronic
1184334500 22:43845272-43845294 CCGGAGGCTGATGTGTGGAGGGG - Intronic
950228877 3:11258953-11258975 TCAGAGACTTGGGTGATGAGTGG - Intronic
951776090 3:26311830-26311852 TCAGAATCTTGGGGGTGGAGAGG + Intergenic
952737991 3:36709385-36709407 TCAGAGGCTGAGGAGTGCACTGG + Intergenic
953930739 3:47004610-47004632 TCAGAGGGGCAGGGGTGGAGGGG - Intronic
954068442 3:48125514-48125536 TCAAAGGCTTGGCTGTGAAGAGG - Intergenic
955490785 3:59480047-59480069 TCAGAGGCTCATGTGGGGAGGGG + Intergenic
955508179 3:59652950-59652972 TCACATGCTTAGTTGTGCAGAGG - Intergenic
956500975 3:69884906-69884928 TCATAGGCTTAGTTGTGTAAAGG - Intronic
956597808 3:70987480-70987502 TCAGAGGCTAAATTATGGAGAGG - Intronic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
962027472 3:131563663-131563685 TTACAGGCTAAGCTGTGGAGTGG + Intronic
962822457 3:139064527-139064549 TCAGAGGTTTAGGGGAGGACAGG - Intronic
962953247 3:140240924-140240946 TAAGAGGCTGAGGTGGGGAGTGG + Intronic
963068398 3:141281856-141281878 TCACAGGCTCAAGCGTGGAGTGG + Intronic
966162953 3:176987012-176987034 TGAGAGGCTGAGGTGGGGGGCGG + Intergenic
966840608 3:184084040-184084062 ACAGAGGCTCAGTCGTGGAGTGG - Intergenic
967969590 3:194989123-194989145 GCTGAGGCTTAGGAGTGGATGGG - Intergenic
968911972 4:3480998-3481020 TCAGAGGGTAAGGGGTGGAGGGG + Intronic
969623941 4:8293073-8293095 TCAGAGGCTTAGGGAGGGGGAGG + Intronic
969957863 4:10910484-10910506 TCAGGGGCATAGGTGTGGGAGGG + Intergenic
971419369 4:26461440-26461462 TCACAGGGTTGAGTGTGGAGAGG - Intergenic
973817314 4:54630990-54631012 TCAGAGTCAGAGGTGTGAAGAGG - Intergenic
976196832 4:82540353-82540375 TAGGAGGCTGAGGTGTGGGGAGG - Intronic
976311140 4:83614792-83614814 CCAGAGGCATAAGTGTGCAGTGG + Intergenic
977521426 4:98089200-98089222 TCAGAGGGTAAGGTTGGGAGGGG - Intronic
978894951 4:113875385-113875407 GCAGAGCCTTAGGTTTTGAGAGG - Intergenic
979238056 4:118423916-118423938 TGAGGGACTTAGGTATGGAGAGG + Intergenic
979698441 4:123640485-123640507 TCAGTGGGGTAGGTGTGGTGAGG + Intergenic
986430287 5:7674287-7674309 TCAGTGGTTTCGGTGTGGGGTGG + Intronic
986475153 5:8122298-8122320 TCTGAGGCTTAGGTGAAGACAGG - Intergenic
986535301 5:8780275-8780297 GCAGAGGGTTAGGAGTGAAGGGG + Intergenic
989195373 5:38711443-38711465 TCAGAACCTTAGGTGTGAACTGG + Intergenic
990167462 5:53010517-53010539 TCACAGGCTTAGAGATGGAGAGG + Intronic
991275295 5:64840077-64840099 TCAGAGATTTAGCTCTGGAGAGG - Intronic
991494682 5:67215530-67215552 TGAGAGGCTTATGTGGGGTGAGG - Intergenic
992173525 5:74127297-74127319 GCACAGGCTTGAGTGTGGAGAGG - Intergenic
993527492 5:88984263-88984285 TAAGAGGCTTTTGTGTAGAGAGG + Intergenic
997928808 5:138055365-138055387 TCAGAGGCTGGGAAGTGGAGAGG - Intergenic
997946655 5:138208895-138208917 TCAGAGGCTGAGGTGGGAGGAGG - Intronic
998007285 5:138665439-138665461 TCAGAGGGTAAGCTGAGGAGAGG + Intronic
998775763 5:145599874-145599896 TCAGATTCTTGGGTGTTGAGGGG - Intronic
999175557 5:149629410-149629432 CCAGAGCCCTAGGTGTGGAGAGG + Intronic
1000016624 5:157283524-157283546 GAAGAAGCTTAGGTGTGGAGAGG + Intronic
1001622758 5:173102495-173102517 TCTGAGGCTTGGGTCTGTAGAGG + Intronic
1004816764 6:19319468-19319490 TCAGAGGCTTGGGTTAAGAGAGG - Intergenic
1004912312 6:20298833-20298855 CCAGAGGTTGGGGTGTGGAGAGG - Intergenic
1005501344 6:26431481-26431503 ACAGGGGCTGAGGTCTGGAGTGG - Intergenic
1005740581 6:28786946-28786968 GCACTGGCTTAGGTGTGGAGAGG + Intergenic
1005850999 6:29821905-29821927 ACAGAGCCTTAGGTGTTGAGGGG - Intergenic
1006449813 6:34099410-34099432 ACAGGGGCTTCGGGGTGGAGGGG + Intronic
1006746762 6:36348225-36348247 TGAGAGGCTGAGGTGAGGGGAGG - Intergenic
1007282614 6:40723520-40723542 TCAGGGGCTCAGGTTAGGAGCGG - Intergenic
1007744646 6:44036037-44036059 TCAGTAGCTCAGGTGTGGTGAGG + Intergenic
1013985978 6:116194434-116194456 TCAGAGGCTAAGATGTGGAAGGG + Intronic
1014100170 6:117502638-117502660 TCAGAGACTTTGGGATGGAGAGG + Intronic
1014331963 6:120079266-120079288 TAAGAAGCTTTGGTGAGGAGTGG + Intergenic
1015756876 6:136616545-136616567 TGGGAGGCTGAGGTGGGGAGAGG - Intronic
1016109914 6:140210252-140210274 ACAAAGGCTCAGGTGTGGAAAGG - Intergenic
1016156147 6:140810613-140810635 TCAGAGGGTTAAGTGGGGAGAGG + Intergenic
1016312754 6:142751913-142751935 TCTGAGGGTTGGGTGTGGAAGGG - Exonic
1018027701 6:159818695-159818717 TCAGAGGCTTTGCTGGGAAGCGG + Intronic
1018647470 6:165961657-165961679 TCAGAGGCAGAAGTTTGGAGGGG - Intronic
1019051501 6:169187010-169187032 ACAGAAGCTCAGGTGTGGTGGGG + Intergenic
1019775409 7:2909519-2909541 GCAGAGGGTGAGGGGTGGAGGGG - Intronic
1020918748 7:14233833-14233855 TCTGGGGAGTAGGTGTGGAGTGG - Intronic
1022024196 7:26430597-26430619 TCTAAGACTTAGGGGTGGAGAGG - Intergenic
1022090585 7:27105554-27105576 GCAGAGGTTGAGGTGCGGAGAGG + Intergenic
1023933920 7:44725596-44725618 TCAGAGGCTTAGGTGGGCTTGGG - Intergenic
1023956599 7:44891649-44891671 TCTGAGGCTGAGGAGAGGAGAGG + Intergenic
1024995077 7:55267950-55267972 TCAGAAGGTTAGGACTGGAGTGG - Intergenic
1025872118 7:65444721-65444743 GCAGAGGCTGAGGTGGGGATAGG - Intergenic
1025874854 7:65471388-65471410 CCAGAGGCAGAGGTGTGGTGAGG + Intergenic
1026650403 7:72211201-72211223 GCAGAGACTGAGGTCTGGAGAGG - Intronic
1027144952 7:75688065-75688087 TTAGTGGCTGAGGTGTGGAGGGG - Intronic
1028573359 7:92317298-92317320 TCAGAGGCCTGGGCTTGGAGGGG + Intronic
1029457352 7:100677959-100677981 TCAGAGCCTTAGGTGGGGAGGGG - Intronic
1031133697 7:117862292-117862314 CCAGAGCCCTAGGTGTGGGGTGG + Intronic
1031564344 7:123276853-123276875 TCGGAAGCTTAGTTGGGGAGAGG - Intergenic
1034432453 7:151047986-151048008 TCAGAGGCCTGAGTGTGGGGAGG + Intergenic
1034804966 7:154081324-154081346 TCAGAGTCTAAGGTGTTGAAAGG - Intronic
1036755950 8:11471256-11471278 TCAGCGGCCGAGGTGAGGAGTGG + Intronic
1037162014 8:15784748-15784770 CCAGAGGCTGAGGAGAGGAGAGG + Intergenic
1040834765 8:51719887-51719909 TCACAGTCTTAGATGTAGAGAGG - Intronic
1040933556 8:52760525-52760547 TCAGAGGCATAAATGTGGAGTGG + Intergenic
1041762073 8:61378030-61378052 TCAGAGGCTTAGGTGAGAGGAGG - Intronic
1042339344 8:67662846-67662868 TCAGAGGGTTAGTAGGGGAGAGG - Intronic
1042388975 8:68211010-68211032 TCTGAGACTTAGTTGAGGAGGGG + Intronic
1045204049 8:100018167-100018189 TCACAGGCACAGGTGTAGAGAGG - Intronic
1046414070 8:113887854-113887876 TCAGGGGCTATGATGTGGAGAGG - Intergenic
1046785954 8:118266823-118266845 CCAGAGGCTAGGGGGTGGAGGGG + Intronic
1047885792 8:129248929-129248951 TCAGAGGCTGAGGCTTGAAGGGG - Intergenic
1048970178 8:139641108-139641130 TCAGAGCCTCAGGGATGGAGAGG - Intronic
1049391182 8:142372519-142372541 ACAGAGGCTGCGGGGTGGAGCGG + Intronic
1050484897 9:6123797-6123819 GCAGAGGCACAGGTCTGGAGAGG - Intergenic
1057676714 9:97141617-97141639 TCAGAGGCTTAGGGGCAGAAGGG - Intergenic
1057861666 9:98645591-98645613 TCAGAACCTTAGGGGTGGGGTGG - Intronic
1059509700 9:114833145-114833167 TCAGAAATTTGGGTGTGGAGGGG + Intergenic
1060332441 9:122685752-122685774 CCAGTGGCTGAGGTGTGGTGGGG - Intergenic
1060352988 9:122875918-122875940 TCAAAGGCTTAGGTGAAGAAGGG + Intronic
1187409149 X:19033276-19033298 TAAGAGGCATAGGAGTAGAGGGG - Intronic
1188689021 X:33106268-33106290 TCAGAGACTCAGAAGTGGAGGGG + Intronic
1190482954 X:50895816-50895838 TCAGAGGCTTAGAAAAGGAGGGG + Intergenic
1192152367 X:68720177-68720199 TCAGAGGATCAGGTGGGGTGAGG - Intronic
1192417109 X:70991343-70991365 TCAGAGGCTTGGGAGGGTAGTGG - Intergenic
1192714381 X:73624331-73624353 ACAGAGGCTTAGATTTTGAGAGG + Intronic
1193321225 X:80123720-80123742 CCAGAGGCTGAGAAGTGGAGTGG - Intergenic
1193982410 X:88199170-88199192 TCGGAGACTCAGGTGTGGGGAGG + Intergenic
1195669735 X:107459523-107459545 TCAGTGGATTGGGTGGGGAGGGG - Intergenic
1197370686 X:125622104-125622126 CCAGGGGGTTTGGTGTGGAGGGG - Intergenic
1198040727 X:132849013-132849035 TCAAATGCATAGGTTTGGAGAGG + Intronic
1199743655 X:150758262-150758284 CCAGAGGACTGGGTGTGGAGGGG - Intronic
1200410398 Y:2855181-2855203 TCAGAGCCTGAGGTGTAGGGAGG - Intronic
1200744651 Y:6893267-6893289 TCAGACCCATAGGTGTGGTGAGG - Intergenic
1200801758 Y:7393492-7393514 GCAGAGGGTTAGGTGGGGAAAGG - Intergenic