ID: 1102433921

View in Genome Browser
Species Human (GRCh38)
Location 12:112905555-112905577
Sequence TAAGGTAGTGAAACTCTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102433921 Original CRISPR TAAGGTAGTGAAACTCTTGC AGG Intergenic
906649724 1:47503990-47504012 CAAGCCAGGGAAACTCTTGCTGG + Intergenic
911931987 1:103915948-103915970 TAAGGTAGAGAAAATGCTGCTGG + Intergenic
912582521 1:110733777-110733799 AAAGGAGGTCAAACTCTTGCTGG - Intergenic
913483545 1:119313162-119313184 TAAGATAGTGGAGCTCTTGAGGG - Intergenic
916241751 1:162647306-162647328 TAAGGAAATGAATCTCTTTCTGG - Intronic
917787254 1:178471956-178471978 TAAGGTAGTAAAACTCCTTTTGG + Intronic
920194262 1:204216382-204216404 TAAGGGTGCAAAACTCTTGCTGG - Intergenic
1065885875 10:30076512-30076534 TAAGATACTGAAAATCTTGAGGG - Intronic
1068855912 10:61797126-61797148 AAAGTTGGTGAAACTCTTGAAGG - Intergenic
1073504333 10:103971139-103971161 TAAAGTAGTGAAGCTTTTTCAGG - Intronic
1074879982 10:117648458-117648480 TGAGGTATGGAAACTCTTGAGGG - Intergenic
1077598210 11:3553049-3553071 TGAGATAGAGAAACTCTGGCAGG - Intergenic
1080621751 11:33992697-33992719 TTAGGTGGGGGAACTCTTGCAGG - Intergenic
1084254292 11:67928916-67928938 TGAGATAGAGAAACTCTGGCAGG - Intergenic
1084818581 11:71666967-71666989 TGAGATAGAGAAACTCTGGCAGG + Intergenic
1088183188 11:107135242-107135264 TAATGTCCTGAAACTCTTTCAGG - Intergenic
1102362245 12:112298147-112298169 TATTATAGTGAAACTCTTGACGG - Intronic
1102433921 12:112905555-112905577 TAAGGTAGTGAAACTCTTGCAGG + Intergenic
1105205354 13:18218666-18218688 GAAGGTAGTGGCAGTCTTGCTGG + Intergenic
1105835036 13:24202777-24202799 AAAGGTAGTGAAACACTCCCAGG + Intronic
1117067483 14:52024855-52024877 GAAGGTAATCAAAGTCTTGCAGG + Intronic
1118867960 14:69718137-69718159 AAGGGTAGTGAGACTCTGGCTGG + Intergenic
1120193616 14:81461309-81461331 TCAGGAAATGAATCTCTTGCTGG + Intergenic
1124861780 15:33448998-33449020 TTGAGTAGTGAAACTCTTTCCGG - Intronic
1132200494 15:99951096-99951118 GCAGGAAGTGAAACTCTTACAGG - Intergenic
1132335270 15:101044381-101044403 TAAAGCAGTGAAACCCTGGCAGG - Intronic
1138723915 16:59115228-59115250 TGAGGAAGTGAAAGTTTTGCAGG + Intergenic
1141304020 16:82844343-82844365 TAAGGTAATAAAACTCTGGGAGG + Intronic
1154109053 18:11550371-11550393 GAAGGTATAGAAACTCATGCTGG + Intergenic
1158543660 18:58378352-58378374 AAAGGTAGAGAAACACTTGGGGG + Intronic
1159036636 18:63284484-63284506 AAAGGTAGAGAGACTCTTCCTGG + Intronic
1164047796 19:21557477-21557499 TAAAATGGTAAAACTCTTGCAGG + Intergenic
926533372 2:14080984-14081006 TAAGATAGTGAATATCTTACTGG - Intergenic
931910448 2:66893861-66893883 CAAGGTTGTGAAACTCTTAGTGG - Intergenic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
936290440 2:111219485-111219507 TAAGGTAATGAAAGTGTTTCAGG + Intergenic
941052213 2:160747787-160747809 TGAGGTAGAGAAACTCTGGGTGG + Intergenic
941482646 2:166036512-166036534 TAAGGTCCTGAATCTCTTTCTGG - Exonic
947124655 2:226854753-226854775 TCAGGTAGTGATACTCTTTATGG - Intronic
948245667 2:236483085-236483107 TAAAGTAGTCAAACTCATGAGGG - Intronic
1173036663 20:39418201-39418223 GAAGGTAGTGAAACCCTGGAGGG + Intergenic
1177818408 21:26003426-26003448 CAAGGCAGTGAAACTCTTGGGGG - Intronic
1185200673 22:49502387-49502409 TAAGGATCTGAAGCTCTTGCAGG - Intronic
950752236 3:15138817-15138839 TGAGATAGAGAAACTCTGGCAGG + Intergenic
952347171 3:32498872-32498894 AAAGGTAGTGAAACTGAGGCCGG - Intronic
953786999 3:45918686-45918708 GAAGGTGGTGAAACTATTTCAGG - Exonic
957068368 3:75545468-75545490 TGAGATAGAGAAACTCTGGCAGG - Intergenic
961106586 3:124248122-124248144 ATAGGTGGTGAACCTCTTGCAGG + Intronic
963922825 3:150922502-150922524 TAAAATAGTGACATTCTTGCAGG + Intronic
967024420 3:185551650-185551672 TAAGCTAGTAAAACCATTGCTGG - Intronic
969012720 4:4080035-4080057 TGAGATAGAGAAACTCTGGCAGG - Intergenic
969741145 4:9027739-9027761 TGAGATAGAGAAACTCTGGCAGG + Intergenic
969800488 4:9560617-9560639 TGAGATAGAGAAACTCTGGCAGG + Intergenic
970020820 4:11566603-11566625 TAATTCAGTGAAACTCTTGGTGG - Intergenic
972316424 4:37930903-37930925 AAAGGTAGAGAAAATCTTACTGG + Intronic
974362924 4:60906187-60906209 TTAGCCAGTGAAACTCTTCCAGG - Intergenic
977011762 4:91644132-91644154 TAAGTTAGCGAAAATCTTCCTGG - Intergenic
983130932 4:164019281-164019303 TATGGTAGTGGAAATCCTGCAGG - Intronic
984016940 4:174437942-174437964 TAAGGTTGTGAAATTCTAGACGG + Intergenic
986375251 5:7124503-7124525 TGAGGTAATGCAGCTCTTGCAGG + Intergenic
986653518 5:9988527-9988549 GAAGGAAGGGAAACACTTGCAGG - Intergenic
993446804 5:88023005-88023027 TTTGGTAGGGAAACTCTAGCAGG - Intergenic
994843354 5:104953258-104953280 TAAGGAAGTGCAACCATTGCAGG - Intergenic
999096882 5:148987431-148987453 TAAGGTGTTGAAACTCTCCCAGG + Intronic
999185524 5:149704871-149704893 TAAAGTAGTAAAACTGTTTCAGG - Intergenic
1001607123 5:172969290-172969312 TAAGGAACTGAAACTCTGGAAGG - Intronic
1005490916 6:26346204-26346226 TAAAGGAGTGAAACTCTTCCTGG - Intergenic
1007320967 6:41028507-41028529 TGAGGTAGTGCAGCTCCTGCAGG + Exonic
1010402736 6:75465489-75465511 TTAGGCACTGAAGCTCTTGCAGG - Intronic
1015772737 6:136785611-136785633 AAAGGAAGTGAAAGTGTTGCTGG + Intronic
1021609620 7:22444714-22444736 TTAGGAAGTGAAACCCTTTCCGG + Intronic
1024147048 7:46528120-46528142 TCAGAAAGTGACACTCTTGCTGG - Intergenic
1028123970 7:87090208-87090230 TAAGGTAGCACAACTCTTACAGG - Intergenic
1029071365 7:97901654-97901676 TGAGATAGAGAAACTCTGGCAGG - Intergenic
1029582098 7:101443819-101443841 TACAGTAGTGGGACTCTTGCAGG - Intronic
1030678179 7:112406631-112406653 TAAGTTAATGAAAATCTTGAGGG - Intergenic
1032255580 7:130294772-130294794 AAAGGTAGTGGAATTCTTCCTGG + Intronic
1036246344 8:7120319-7120341 TTAGATAGAGAAACTCTGGCAGG + Intergenic
1036254453 8:7194094-7194116 TGAGATAGAGAAACTCTGGCAGG - Intergenic
1036363042 8:8093394-8093416 TGAGATAGAGAAACTCTGGCAGG + Intergenic
1036887924 8:12573684-12573706 TGAGATAGAGAAACTCTGGCAGG - Intergenic
1036895523 8:12631789-12631811 TGAGATAGAGAAACTCTGGCAGG - Intergenic
1037040811 8:14230370-14230392 TAAGGTATTGGAACGCTTCCTGG - Intronic
1037515314 8:19625118-19625140 TAGGGTTGTGATACTCTTTCTGG - Intronic
1037692712 8:21195779-21195801 TAAGGTAGTTATACTCTTTGAGG + Intergenic
1038674918 8:29614953-29614975 TAAGGAAGAGAAACTCCTGGAGG + Intergenic
1038923088 8:32107667-32107689 TAACATACTGAAATTCTTGCAGG + Intronic
1039185665 8:34913423-34913445 TAAGATTGTGAAATTCATGCAGG - Intergenic
1049315054 8:141961517-141961539 TAAGGAAGGGAAATTCCTGCAGG + Intergenic
1050008413 9:1159305-1159327 TCAAGAAGTGAATCTCTTGCAGG + Intergenic
1054724846 9:68640030-68640052 TAAAGCAATGAAACTCTTTCGGG - Intergenic
1057745536 9:97748008-97748030 TAAGGAAGTGAAGCTCTAACTGG - Intergenic
1059006742 9:110410833-110410855 TAAGGTTGTGAATCACTTTCTGG - Intronic
1060564134 9:124574611-124574633 AAAGGTTGTCAAACTCTTGGTGG - Intronic
1060629941 9:125147121-125147143 TAAAGTAGTGAAACTTTTTGGGG + Exonic
1060730758 9:126035470-126035492 CAAAGAAGTGAAAATCTTGCTGG + Intergenic
1190904052 X:54708566-54708588 TAGGGTTGTGAAATTCGTGCAGG + Intergenic
1198892052 X:141408157-141408179 TAAGTGAGTGGAACTCTTTCTGG + Intergenic
1202095695 Y:21246457-21246479 TAAGGTATAGAAACTCATGGTGG + Intergenic