ID: 1102434158

View in Genome Browser
Species Human (GRCh38)
Location 12:112907613-112907635
Sequence CTCAAGGTCTTGCAGCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 8, 3: 39, 4: 260}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102434158 Original CRISPR CTCAAGGTCTTGCAGCCAGC AGG (reversed) Intronic
901493816 1:9610170-9610192 CCCGAGGCCTTGCTGCCAGCTGG - Intronic
904411920 1:30329796-30329818 CTCAAGGTCAGACAGCCAGGAGG + Intergenic
905326309 1:37154527-37154549 TGCAGGGTCTTGCAGCTAGCTGG - Intergenic
905877194 1:41439815-41439837 CACAAGGTCTTGCTTCCAGCTGG - Intergenic
908134603 1:61117755-61117777 CTCAAAGCCTTGTACCCAGCAGG - Intronic
908412894 1:63884512-63884534 CTCAAGGTCACGCAGCTAGTTGG + Intronic
911329908 1:96515067-96515089 TCCAGGGTCATGCAGCCAGCAGG + Intergenic
912480352 1:109978125-109978147 CTCCTGGCTTTGCAGCCAGCTGG - Intergenic
912949130 1:114108451-114108473 CTCAAGGTCTCACAGCTAACTGG - Intronic
913259331 1:116984456-116984478 CTCAAGGTCATGTAGTCAGCAGG - Intronic
914685760 1:149977517-149977539 CTCAAGTACTTTCAGCCAGCTGG + Exonic
915067397 1:153237623-153237645 CTCAAGGCCATTCAGCTAGCAGG + Intergenic
916581508 1:166113618-166113640 CTCCAGTCCTTCCAGCCAGCTGG - Intronic
917935303 1:179860739-179860761 ATAATGGCCTTGCAGCCAGCTGG - Intronic
922994133 1:229942720-229942742 CTCAAGCTCTTTTGGCCAGCAGG + Intergenic
1063631215 10:7735220-7735242 CCCAAGCTCTTCCTGCCAGCTGG + Intronic
1066313849 10:34223870-34223892 CTCAAGGACACACAGCCAGCAGG + Intronic
1067029495 10:42870895-42870917 CTGAAGGTCTTCCAGCCAGGAGG + Intergenic
1067202455 10:44185027-44185049 CCCATGGTCTTGAAGCCCGCAGG - Intergenic
1068366020 10:56051174-56051196 CTCAAGGTCTTGCAATCAGTAGG + Intergenic
1068826895 10:61451038-61451060 CTCAAGGTCTGACAGCAAGTAGG + Intronic
1069697477 10:70397474-70397496 CTCACGGTCATACAGCAAGCTGG + Intergenic
1070319487 10:75343868-75343890 CACAAGGCCTTGCACCCACCAGG - Intergenic
1070838209 10:79464648-79464670 CTGATGGTCTTGCTGCAAGCAGG + Intergenic
1074113556 10:110439234-110439256 CCCAAGGTCTTCCAGCCAGCAGG + Intergenic
1075685818 10:124364544-124364566 CTCAAGGTCCTGAGGCCATCTGG - Intergenic
1076305127 10:129460922-129460944 CTCAAGGGCTGGCACACAGCAGG + Intergenic
1077087887 11:763656-763678 CTCAAGGTAGTGCAGCCGGCAGG + Intronic
1079835953 11:25333076-25333098 CTCAAGATCAAGCAGTCAGCAGG - Intergenic
1080458031 11:32432717-32432739 CTGTGGGTTTTGCAGCCAGCAGG - Intronic
1081576272 11:44320152-44320174 CTCAAGGTCTTGGGGCCTGAAGG + Intergenic
1081888997 11:46524560-46524582 CCCAAGGTCTCACAGCCAGTGGG - Intronic
1083233128 11:61335688-61335710 CCCAAGGTCACACAGCCAGCAGG - Intronic
1083420181 11:62547851-62547873 CTCATGATCTTGCAGCAAGGAGG - Intronic
1084960340 11:72713104-72713126 CTCAGGGTCTGACAGGCAGCTGG + Intronic
1085663301 11:78389884-78389906 CTGAAGTTCTTGCACACAGCAGG + Intronic
1086805863 11:91241224-91241246 TGCAAGGATTTGCAGCCAGCAGG - Intergenic
1086858669 11:91898491-91898513 CTCTAGGTCATGCAGCTACCAGG + Intergenic
1089355727 11:117851458-117851480 CTCAAGGTCTTTCATGAAGCCGG - Intronic
1089408771 11:118220868-118220890 CTCAGGGTCTTTCAGCCCTCAGG - Intronic
1089655876 11:119946572-119946594 CTCAAGGGCTTACAGGCTGCAGG + Intergenic
1091618099 12:2065296-2065318 CTCCTGGTCTTTCAGACAGCTGG - Intronic
1095140449 12:38656597-38656619 CTCAAGATCATGCAGGCAACAGG - Intronic
1095956907 12:47812146-47812168 CCCAGGGCCTTGAAGCCAGCTGG - Intronic
1096037396 12:48484365-48484387 CTCAAGGTCCTGCAGCTGTCTGG - Intronic
1096802002 12:54116611-54116633 CCCAAGGTTGTACAGCCAGCAGG - Intergenic
1098147962 12:67516935-67516957 CCCAAGGTTATGCAGCTAGCAGG + Intergenic
1101159488 12:101958942-101958964 CCCAAGATCTTACAGCTAGCAGG - Intronic
1101708332 12:107241643-107241665 CTCAAGGTCTTGCAGCTTGCTGG - Intergenic
1102347389 12:112168706-112168728 CCCAAGGTCATGCAGCCAGCTGG - Intronic
1102434158 12:112907613-112907635 CTCAAGGTCTTGCAGCCAGCAGG - Intronic
1102474882 12:113182196-113182218 CCCAAGGTCACACAGCCAGCAGG + Intronic
1102503061 12:113366047-113366069 CTCAATGTCTGGCAGCCAGTAGG + Intronic
1102870224 12:116408415-116408437 CTCAAGGTCACACAGCCAGTGGG - Intergenic
1102889923 12:116550621-116550643 CCCAAGGTCATGCAGCTAGATGG - Intergenic
1102985159 12:117272052-117272074 CTCAAGGTCACACAGCTAGCCGG - Intronic
1104120698 12:125796749-125796771 CTCAAGGTCTTACATCCCACTGG + Intergenic
1104866691 12:131960170-131960192 TTCAAGGCCACGCAGCCAGCAGG - Intronic
1104888716 12:132128118-132128140 CTCAAGGAATTCCAGCCAGCAGG + Intronic
1105927845 13:25023748-25023770 CTCAAGGTCTTTCAGGGACCTGG + Intergenic
1106100976 13:26695047-26695069 CTCAGGGGCGTGCAGACAGCAGG - Intergenic
1108594572 13:51938284-51938306 CTCATGGTCTTGCAGGAAGGTGG - Intronic
1113862483 13:113497269-113497291 CTGCAGGTCTTGCACACAGCTGG - Intronic
1120559767 14:85976217-85976239 CTGGAGGTGTTGCAGCCATCTGG - Intergenic
1121428988 14:93873616-93873638 CTCCAGATCTCGCCGCCAGCAGG - Intergenic
1124170188 15:27366256-27366278 CCCACGGTCATGCAGCCAGCTGG + Intronic
1124240188 15:28021852-28021874 AGCAAGGTCTGGCAGACAGCTGG + Intronic
1125734300 15:41912824-41912846 CTCAAGGTCATACAGCTAGTTGG + Intronic
1125774495 15:42199414-42199436 CTCACGGTCACGCAGCCAGGGGG + Intronic
1126372626 15:47963405-47963427 GTCAATGGCTTGCTGCCAGCAGG - Intergenic
1126430928 15:48583475-48583497 CTTAAGGTCTTACAGCCACCTGG + Intronic
1126789516 15:52208284-52208306 CTAAACGTCTTACAGCCAGAAGG + Intronic
1127660168 15:61093339-61093361 CTCAAGGGCTTGCACTAAGCAGG + Intronic
1129057041 15:72827396-72827418 CTCTTGCACTTGCAGCCAGCTGG - Intergenic
1129388056 15:75206786-75206808 CTCAAGTCCTTGGACCCAGCTGG + Exonic
1129459407 15:75692978-75693000 CACAAGGTCACACAGCCAGCTGG + Intronic
1129690521 15:77710774-77710796 CTCAAGGTCACACAGCAAGCTGG + Intronic
1129724554 15:77894908-77894930 CACAAGGTCACACAGCCAGCTGG - Intergenic
1132733421 16:1374311-1374333 TCCAAGAACTTGCAGCCAGCAGG - Intronic
1134181037 16:12047960-12047982 ATCAAGGTCTTGTAGCTAGTAGG + Intronic
1135307774 16:21381712-21381734 ATCAAGGTCTTGTAGCTAGTAGG + Intergenic
1136304518 16:29360832-29360854 ATCAAGGTCTTGTAGCTAGTAGG + Intergenic
1138090068 16:54166584-54166606 CTTTAGGTCTTGCACCCAACGGG - Intergenic
1138456038 16:57121287-57121309 CTCAAGGTCATGCAGCCAGAAGG - Intronic
1138862022 16:60770189-60770211 CTCAAGGCCCTGCAGTCAGCTGG + Intergenic
1138862028 16:60770236-60770258 CTCAAGATCCAGCAGTCAGCTGG + Intergenic
1138862034 16:60770283-60770305 CTCAAGGTCCTGCAGTCAGCTGG + Intergenic
1138862039 16:60770330-60770352 CTCAGGGTCCTGCAGTCAGCTGG + Intergenic
1138862044 16:60770377-60770399 CTCAGGGTCCTGCAGTCAGCTGG + Intergenic
1138862049 16:60770424-60770446 CTCAGGGTCCTGCAGTCAGCTGG + Intergenic
1138862052 16:60770471-60770493 CTCAAGATCCAGCAGTCAGCTGG + Intergenic
1138862055 16:60770518-60770540 CTCAAGGTCCTGCAGTCAGCTGG + Intergenic
1138862059 16:60770565-60770587 CTCAAGGTCCTGCAGTCAGCTGG + Intergenic
1138862062 16:60770612-60770634 CTCAAGATCCAGCAGTCAGCTGG + Intergenic
1138862065 16:60770659-60770681 CTCAAAGTCCTGCAGTCAGCTGG + Intergenic
1139613033 16:68072582-68072604 GTCAAGGACTTGCCACCAGCCGG + Intronic
1139615014 16:68083740-68083762 GTCAAGGCCCTGCAGCTAGCAGG + Intergenic
1141429885 16:83966020-83966042 CTCAGGGCCTGGGAGCCAGCGGG - Exonic
1143096940 17:4483203-4483225 CCCAAGGGCTTGCAGCAAGTCGG - Intronic
1146166077 17:30590022-30590044 CTTAGGGTCTTGCATGCAGCTGG + Intergenic
1146222358 17:31035554-31035576 CTTAGGGTCTTGCATGCAGCTGG + Intergenic
1146344824 17:32052501-32052523 CTTAGGGTCTTGCATGCAGCTGG - Intronic
1146354959 17:32126129-32126151 CTCAGGGCCTGGCACCCAGCAGG + Intergenic
1147167470 17:38601182-38601204 CTCAAGGTCACGCAGACATCTGG + Intronic
1148169998 17:45511061-45511083 CTTAGGGTCTTGCATGCAGCTGG + Intergenic
1148199756 17:45742172-45742194 CCCAAGGTCTTGTTGGCAGCAGG - Intergenic
1148204377 17:45770737-45770759 ATCAAGGTCATGCAGCCAGTTGG + Intergenic
1148279210 17:46334755-46334777 CTTAGGGTCTTGCATGCAGCTGG - Intronic
1148301427 17:46552608-46552630 CTTAGGGTCTTGCATGCAGCTGG - Intronic
1148511819 17:48177483-48177505 CTCAAGATCTCACAGCTAGCAGG + Intronic
1149379112 17:56075054-56075076 CTCAAGGTCATTAAGCTAGCAGG + Intergenic
1149541730 17:57472585-57472607 CTCAAGGTCATGAGGCCAGTTGG - Intronic
1149639214 17:58192386-58192408 CCCAAGGCCATGCAGCCAGGCGG + Intergenic
1150401080 17:64856657-64856679 CTTAGGGTCTTGCATGCAGCTGG + Intronic
1150781198 17:68123685-68123707 CTTAGGGTCTTGCATGCAGCTGG + Intergenic
1151361932 17:73594128-73594150 CCCAACGTCTGGGAGCCAGCAGG + Intronic
1152404655 17:80089913-80089935 CCCAAGGGCTGGCACCCAGCAGG - Intronic
1152574201 17:81132998-81133020 CTCAAGGTCTTGGCGGGAGCAGG - Intronic
1153186481 18:2491738-2491760 ATCTAGGTCTGCCAGCCAGCTGG + Intergenic
1154297215 18:13161735-13161757 CTCAGGGTATTTGAGCCAGCAGG - Intergenic
1154353179 18:13604230-13604252 CTAAAGGTCTTGGAGCCACCTGG + Intronic
1155144249 18:23070328-23070350 TTCAAGGTTTTGCAGTCAGTGGG - Intergenic
1155241621 18:23869187-23869209 CTCAAAGCCTTGCAGCCATCTGG + Intronic
1156232869 18:35171979-35172001 CTCAAGGTCTCACAGCTAGTGGG + Intergenic
1157625578 18:49047995-49048017 TGCAAGGTCATGCAGCCTGCTGG + Intronic
1159321084 18:66849747-66849769 CTCAAGGTCTAGCAGGCAGTGGG + Intergenic
1160811066 19:1013127-1013149 GTCCAGGACATGCAGCCAGCAGG + Intronic
1160912582 19:1481766-1481788 CCCCAGGTCTGGCTGCCAGCTGG - Exonic
1162240453 19:9348918-9348940 CCTCAGGTCTTGCAGGCAGCAGG - Intronic
1163712248 19:18853799-18853821 CTCATGGTGATGCAGCCTGCCGG + Intronic
1164707533 19:30331571-30331593 GTCAAGGTCATGCATCCAACAGG + Intronic
1164768474 19:30789711-30789733 ATCATGGTCTTTGAGCCAGCTGG + Intergenic
1165040882 19:33066607-33066629 CACAGAGTCTAGCAGCCAGCAGG - Intergenic
1167323969 19:48812869-48812891 CCCCAGGCCTTGCAGCAAGCAGG - Intergenic
1167518553 19:49938206-49938228 CCCAAGGTCACACAGCCAGCAGG - Intronic
1167586799 19:50379917-50379939 CCCCAGGTCTTCCAGCCAGCAGG - Intronic
1167595232 19:50423880-50423902 CCCAAGGTCACACAGCCAGCAGG - Intronic
925004472 2:430453-430475 CTCAGGATCCTGCAGCCTGCGGG + Intergenic
925092846 2:1169010-1169032 CAGAAGTTCTTGGAGCCAGCAGG + Intronic
925552283 2:5089654-5089676 CTCAGTGTCTTCCAGCCTGCAGG - Intergenic
926861903 2:17318642-17318664 CTCAAGGTCATGCAGTGAGTAGG - Intergenic
927010838 2:18902439-18902461 CCAAAGCTCTTGCAGCAAGCAGG - Intergenic
929443443 2:41984324-41984346 CTCAAGGTCATACAGCAAGGTGG + Intergenic
930843994 2:55881183-55881205 CTCAAGGTCTCAAAGCGAGCTGG + Intronic
930855405 2:56011217-56011239 TTCAAGGTCCTGCAGCTAGCAGG + Intergenic
934687000 2:96328278-96328300 ATCAAGGTGCTGCAGCCAGTGGG - Exonic
938112524 2:128578549-128578571 CCCAGGGTCTTCCAGCCACCTGG - Intergenic
938688352 2:133762928-133762950 CTCATGGTGTTGCAAGCAGCTGG + Intergenic
940543819 2:155057071-155057093 CTTAAAGACTTGCAGTCAGCTGG - Intergenic
941315354 2:163985246-163985268 CTCAAAGTAATGTAGCCAGCCGG - Intergenic
941620353 2:167771071-167771093 CCCAAGGACATACAGCCAGCAGG - Intergenic
941917849 2:170823746-170823768 GTCATTGTCATGCAGCCAGCCGG + Intronic
944241077 2:197485519-197485541 CTGAAGGTCTAACTGCCAGCCGG - Intergenic
945215790 2:207432675-207432697 CTCAATGTCATGTAGCCAACAGG + Intergenic
946530691 2:220566934-220566956 CTCCAGGCACTGCAGCCAGCAGG - Intergenic
946605287 2:221397930-221397952 CTAAAGGATTTGCAGACAGCTGG + Intergenic
946727361 2:222673585-222673607 CTCAAGGCGATGCAGCTAGCAGG + Intronic
947593123 2:231396111-231396133 CCCCAGGTCTTGCCGGCAGCTGG + Intronic
948578950 2:238971262-238971284 CTCAAGGACTTGGAGGCATCAGG - Intergenic
948632121 2:239308989-239309011 CTCAGTGTCTTCCAGCGAGCCGG - Intronic
948935213 2:241159423-241159445 CTCAAGGGCTAAGAGCCAGCAGG - Intronic
1168732986 20:103534-103556 CTCCAGGTCCAGCAGTCAGCTGG - Intergenic
1168961751 20:1874822-1874844 CACAGGGTCATGCAGCAAGCTGG - Intergenic
1169337138 20:4765786-4765808 CTCAAGGTCTGGCAGGCATTTGG - Intergenic
1170583335 20:17715361-17715383 CTCAAGGCCTTGCACACAGATGG + Intronic
1171853750 20:30326411-30326433 CCCAAGGTTGTACAGCCAGCAGG - Intergenic
1172027265 20:31957004-31957026 CCCAAGGTCATGCAGCCAGATGG + Intergenic
1172118983 20:32586507-32586529 CTCAAGGTCATGCAGGAAGGAGG + Intronic
1172173542 20:32959105-32959127 CACAAGGTCTGGCAGTCAGTAGG - Intronic
1172230127 20:33330811-33330833 CCCATGGTCATGCAGCCAGGAGG - Intergenic
1172767151 20:37356881-37356903 GCCAAGGTCTGCCAGCCAGCAGG - Intronic
1172805750 20:37610501-37610523 CTGAAGGTCGCTCAGCCAGCAGG + Intergenic
1173421378 20:42904422-42904444 GCCAAGGTCATGCAACCAGCTGG - Intronic
1173439056 20:43059005-43059027 GTCAAGGTCCTGCAGCCACTGGG + Intronic
1173677076 20:44845224-44845246 CCCAGGGTCTGGCATCCAGCAGG + Intergenic
1173814474 20:45976375-45976397 TCCAAGGTCATGCAGCCAGGAGG + Intergenic
1176052898 20:63130000-63130022 CTCAAGGTCCTGCTGCCATCGGG + Intergenic
1177246617 21:18533181-18533203 ATCAAGGGTTTGCAGCCTGCAGG - Intergenic
1179779930 21:43693046-43693068 CTCAAGGCCCTGCAGAGAGCAGG - Intronic
1179803011 21:43820416-43820438 CTCAACGTGCTGCAGACAGCAGG - Intergenic
1180844978 22:18975975-18975997 CCCAAGGTCATACAGCAAGCCGG - Intergenic
1181765150 22:25086250-25086272 CTTAAGGTCTTGCACACAGCAGG + Intronic
1183009545 22:34933448-34933470 CTCAAGGTCACACAGCCAGTAGG + Intergenic
1183121553 22:35733861-35733883 CTCAAGGTCATCCACCTAGCAGG + Intergenic
1183676916 22:39304327-39304349 CTGCAGGCCTGGCAGCCAGCAGG - Intergenic
1183726062 22:39590292-39590314 CTCAAGGTCCCCCAGCCAGGAGG - Intronic
1184519031 22:44981474-44981496 CCCAAGGCCTGGCAGGCAGCAGG + Intronic
1184590078 22:45476249-45476271 CACAAGGCCATGCAGCCAGAGGG + Intergenic
949130858 3:498988-499010 CTCAAGATAATGCAGCTAGCAGG + Intergenic
949167565 3:960445-960467 CTCAAGGTCACGCAGCTAGCAGG - Intergenic
950135963 3:10581122-10581144 CCCAAGGTCATGCAACCAGTAGG + Intronic
950399374 3:12758904-12758926 CTGAAAGTCTTGCAGCAAGTTGG + Intronic
950519297 3:13487044-13487066 CACAAGGTCTTGCAGGCCGTGGG + Intronic
950683606 3:14601923-14601945 CCCAAGGTCACACAGCCAGCAGG - Intergenic
951761574 3:26153115-26153137 CTCAAGGTCCTGCAACCAGTGGG + Intergenic
951797579 3:26557876-26557898 CTCAAGGTCTCACAACCAGCAGG + Intergenic
952184308 3:30952430-30952452 CTCAAGTTTTTGCAGTCAGTTGG + Intergenic
952200643 3:31123763-31123785 CTCAAACGCTTGCAGCAAGCTGG - Intergenic
952698332 3:36297011-36297033 CTCAAGGTCATGCAGTCAGCAGG - Intergenic
955297193 3:57746722-57746744 CTCTAGGGCCTGCTGCCAGCAGG + Intergenic
960485802 3:118251480-118251502 CTCAAGATGGTGAAGCCAGCTGG + Intergenic
961498283 3:127310484-127310506 CTCTAGGTCATGCAGCTACCAGG + Intergenic
961796232 3:129411059-129411081 CCCAGGGTTCTGCAGCCAGCGGG + Intronic
961797791 3:129422185-129422207 CTCAAGATCATGCAGCCAGTAGG - Intronic
961854695 3:129857975-129857997 CTGAAGGTCACACAGCCAGCAGG + Intronic
961854709 3:129858141-129858163 CTCAAGGTCACACAGCCAGCAGG + Intronic
962236780 3:133713709-133713731 CTCAGGGTCCGGCAGTCAGCAGG + Intergenic
962794978 3:138842184-138842206 CTCAAGGTCACAGAGCCAGCTGG + Intergenic
962826154 3:139102269-139102291 CTGAGGGTCTTTCACCCAGCAGG - Intronic
965020179 3:163218689-163218711 CTCATGGTCATGTGGCCAGCTGG + Intergenic
965361905 3:167752064-167752086 CTCAGGGTCTGGCAGAAAGCAGG - Intronic
967088881 3:186118302-186118324 CTCAAGGTCTTCCAGAGTGCTGG - Intronic
967183965 3:186930151-186930173 CTCAGGGTCTCGCAGTCAGCCGG + Intergenic
967552452 3:190812584-190812606 ATCAAGGTCTTGCAGTCTGAGGG + Intergenic
968549618 4:1215420-1215442 CTGAAGGGCCTGGAGCCAGCGGG + Intronic
969260270 4:6028975-6028997 CTCAAGGACTCACAGCCATCCGG + Intronic
969666484 4:8560345-8560367 CACACGGCCCTGCAGCCAGCAGG - Intronic
973793478 4:54399891-54399913 GTCAAGGTCTTGCAGACATGAGG + Intergenic
981748575 4:148073026-148073048 CTCCAGGTCCTGCAGGCACCAGG - Intergenic
984136848 4:175951954-175951976 CTCCTGGGCTTGCAGCCTGCTGG + Intronic
985069034 4:186150305-186150327 CCCAAGGTGCTGCAGCCAGGTGG - Intronic
986269655 5:6219654-6219676 CTCCATGTCATTCAGCCAGCGGG - Intergenic
986357037 5:6938774-6938796 CTCCAGGTCTGGCACCCAGCAGG - Intergenic
988891448 5:35621409-35621431 TTCAAGGTCTTACAGCTAGTAGG + Intronic
989160264 5:38384304-38384326 CTGAAGGTCTTACAGTCATCTGG + Intronic
990982163 5:61611768-61611790 CCCAAGGTCATGCAGCTAGCAGG + Intergenic
991062603 5:62394549-62394571 CTCCAGGTTTTGCAACCAGTCGG + Exonic
991303579 5:65152643-65152665 CTGCAGTTCTTGCAGCCAGAAGG + Intronic
991609206 5:68433526-68433548 CTCACAGTCATGCAACCAGCAGG - Intergenic
993039936 5:82802694-82802716 CTCCAGGTCTTGCAACAAACAGG + Intergenic
994028110 5:95108349-95108371 GTCAAGGTCTAGGACCCAGCAGG - Intronic
994589950 5:101760125-101760147 GTCATGGTCTTGCAGCCACCTGG - Intergenic
997387734 5:133486906-133486928 CTCAAAGTTATGCAGCCAGTAGG + Intronic
997648218 5:135495449-135495471 CTCAAGACATTGCAGCTAGCTGG + Intergenic
997680684 5:135748630-135748652 CTTAAGTTCTCACAGCCAGCAGG + Intergenic
998483390 5:142481298-142481320 CTCAGGGTCTTGCTGCCAGTAGG - Intergenic
999275587 5:150327834-150327856 GTCAAGGTCATGCAGCAATCAGG + Intronic
1001527053 5:172436541-172436563 CCCAAGGTCCTGTAGCCAGCAGG + Intronic
1002261220 5:177995228-177995250 CTCAAGTTCCTGCAGCCTGGTGG - Intronic
1002328041 5:178422549-178422571 CTCAGGGACGTGCAGACAGCGGG - Intronic
1002382411 5:178840182-178840204 CTCCAAGTGTTGCAGCAAGCTGG + Intergenic
1002648165 5:180672493-180672515 CTCCAAGTGTTGCAGCAAGCTGG - Intergenic
1003305409 6:4922610-4922632 CTCAGGATCTGGCAACCAGCAGG - Intronic
1004424443 6:15497831-15497853 CCCAAGGTCTAGGGGCCAGCAGG + Intronic
1005835885 6:29709347-29709369 CTCAGGGGCATGCTGCCAGCAGG - Intergenic
1006803010 6:36771350-36771372 CCCAGTGTCTTGCTGCCAGCCGG - Intronic
1009288793 6:61857776-61857798 TTCAAGGTGTTGCAGAGAGCAGG - Intronic
1009313278 6:62185010-62185032 CTTAAGATCATGTAGCCAGCAGG - Intronic
1009353339 6:62708968-62708990 CTCAAGGACTTGCAATGAGCAGG + Intergenic
1010765948 6:79777554-79777576 CTCAACCTCTTGCAACCACCGGG - Intergenic
1011215653 6:85003024-85003046 CACAAGGGTTTGCAGCCTGCTGG - Intergenic
1015495914 6:133883131-133883153 GTCATGGTGTTGCAGCCAGAAGG - Intergenic
1017375821 6:153766782-153766804 CTCAAGGTCTTGCTAACTGCAGG - Intergenic
1018095920 6:160386932-160386954 CTCACTGTCATGCAGCCACCAGG + Intronic
1018097285 6:160400160-160400182 CTCATGCTCTGGCAGCCAGAGGG + Intronic
1018172795 6:161155024-161155046 CTCAAGGACATGCTGGCAGCGGG - Intronic
1018397256 6:163387981-163388003 TTCATGGTCTTGCAGGCAGCTGG - Intergenic
1018932753 6:168252611-168252633 CTGAAGGACCTGGAGCCAGCTGG - Intergenic
1019014751 6:168871798-168871820 CCCACGGCCATGCAGCCAGCCGG + Intergenic
1019341514 7:510963-510985 GTCCTGGTCTTGCAGACAGCGGG + Exonic
1021479949 7:21104798-21104820 CACAAGCTCTTGGAGCCACCTGG + Intergenic
1022627853 7:32056508-32056530 CTAAAGGTCATGCAGCCTGTCGG - Intronic
1023712295 7:43007974-43007996 CTCAAGGTCATGCAACTAGTAGG - Intergenic
1024814489 7:53253139-53253161 TTCCAGGGCTTGCAGACAGCAGG - Intergenic
1026796122 7:73367102-73367124 CTCAAGGACTTCCAGCTGGCGGG - Intergenic
1029664803 7:101988346-101988368 CTGGAGGTTTTGCAGCCAGGAGG - Intronic
1032520421 7:132539571-132539593 CTCAAGGTTGTGCAGCTAGCCGG - Intronic
1033354334 7:140587315-140587337 CTCAATGTCCTGCGGCCAACAGG + Intronic
1033494581 7:141881214-141881236 CTCCTGGTCCAGCAGCCAGCTGG + Intergenic
1035792108 8:2316629-2316651 CCCAAGCTCTTGCAGACACCCGG + Intergenic
1035800697 8:2405076-2405098 CCCAAGCTCTTGCAGACACCCGG - Intergenic
1037193615 8:16158739-16158761 CTCAAGGTCTTAAAGCTAGTTGG + Intronic
1038672027 8:29590396-29590418 CTCATGGTCCTACAGCCAGTAGG + Intergenic
1038687099 8:29728633-29728655 GCCAAGGTCTTGGTGCCAGCAGG + Intergenic
1042870387 8:73392674-73392696 CTCAAGGTCATGTAGCCAGTTGG - Intergenic
1043359959 8:79460832-79460854 TTCAGGGTTTTGGAGCCAGCAGG - Intergenic
1047375877 8:124295587-124295609 CTCAGGGGGCTGCAGCCAGCTGG - Intergenic
1048291734 8:133186378-133186400 CTCCAGGTCTCACAGCTAGCAGG - Intergenic
1049075681 8:140394506-140394528 CTCAAGGTTATGCAGCGAACAGG + Intronic
1049208140 8:141372872-141372894 CCCAAGGTCATGCAGCTAGGAGG + Intergenic
1052311130 9:27070453-27070475 CTCAAAGTCCTCCAGCTAGCAGG - Intergenic
1053791548 9:41689704-41689726 CCCAAGGTTGTACAGCCAGCAGG - Intergenic
1054153609 9:61625067-61625089 CCCAAGGTTGTACAGCCAGCAGG + Intergenic
1054473391 9:65556195-65556217 CCCAAGGTTGTACAGCCAGCAGG + Intergenic
1055284814 9:74717049-74717071 CTCTAGGCCTTGGAGCCAGATGG - Intergenic
1055831103 9:80379786-80379808 CTCAAGTTTTTGCAGCTAGCTGG + Intergenic
1056786826 9:89598519-89598541 CTCAAGGTCACACAGCCAGGAGG - Intergenic
1057868680 9:98701654-98701676 CTCAAGAGCTGCCAGCCAGCAGG + Intronic
1059403547 9:114085764-114085786 CCCAAGGTCACGCAGCCAGTGGG - Intergenic
1059738414 9:117125635-117125657 ATCATGATCTTGCAGCTAGCAGG - Intronic
1059812938 9:117876862-117876884 CTCAAGGTCGTACATCCATCGGG - Intergenic
1060274160 9:122169735-122169757 CTCAATGGCTTGAAGCCTGCAGG + Exonic
1060471990 9:123955827-123955849 CTCAAGGTCATACAGTCAGTAGG + Intergenic
1060819785 9:126654720-126654742 CTCAGAGTCTGGCATCCAGCAGG - Intronic
1061753379 9:132796121-132796143 CCCAAGGTCATCTAGCCAGCTGG + Intronic
1062218065 9:135399797-135399819 TGGAAGGACTTGCAGCCAGCAGG + Intergenic
1186629155 X:11330124-11330146 CTCAAGGTGTTCCACCAAGCTGG + Intronic
1186875121 X:13809195-13809217 CCCAAGATCTTTCAGCCAGGAGG + Intronic
1187500753 X:19836503-19836525 CTACAGGTCTTGGGGCCAGCAGG + Intronic
1187792557 X:22966851-22966873 CTCAAAGCCATGCACCCAGCTGG - Intergenic
1189069465 X:37848301-37848323 CCCAAGGTCATACAGCCAGTAGG + Intronic
1189883408 X:45514629-45514651 ATCATGGTCTGGCTGCCAGCAGG + Intergenic
1190056767 X:47185705-47185727 CTCAAGGTTTTGCTGCAAGAGGG - Exonic
1192361486 X:70443645-70443667 GTCAAGGTCTTGCACAGAGCAGG + Intergenic
1197725543 X:129773975-129773997 CCCAAGGTTATGCAGCCAGTAGG + Intergenic
1200031258 X:153297648-153297670 CTGTAGGTCTTGCAGGAAGCAGG - Intergenic
1202370306 Y:24191643-24191665 CACAAGGTCACACAGCCAGCTGG + Intergenic
1202500478 Y:25478474-25478496 CACAAGGTCACACAGCCAGCTGG - Intergenic