ID: 1102436127

View in Genome Browser
Species Human (GRCh38)
Location 12:112925355-112925377
Sequence CCCCTCTCCCAGCCAACCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 344}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102436120_1102436127 6 Left 1102436120 12:112925326-112925348 CCCTCACGCCTGTCTGTGAGGTG 0: 1
1: 0
2: 1
3: 5
4: 160
Right 1102436127 12:112925355-112925377 CCCCTCTCCCAGCCAACCGCAGG 0: 1
1: 0
2: 1
3: 33
4: 344
1102436115_1102436127 20 Left 1102436115 12:112925312-112925334 CCCTCCTTGCACACCCCTCACGC 0: 1
1: 0
2: 2
3: 18
4: 225
Right 1102436127 12:112925355-112925377 CCCCTCTCCCAGCCAACCGCAGG 0: 1
1: 0
2: 1
3: 33
4: 344
1102436117_1102436127 16 Left 1102436117 12:112925316-112925338 CCTTGCACACCCCTCACGCCTGT 0: 1
1: 0
2: 0
3: 24
4: 263
Right 1102436127 12:112925355-112925377 CCCCTCTCCCAGCCAACCGCAGG 0: 1
1: 0
2: 1
3: 33
4: 344
1102436121_1102436127 5 Left 1102436121 12:112925327-112925349 CCTCACGCCTGTCTGTGAGGTGC 0: 1
1: 0
2: 0
3: 10
4: 212
Right 1102436127 12:112925355-112925377 CCCCTCTCCCAGCCAACCGCAGG 0: 1
1: 0
2: 1
3: 33
4: 344
1102436114_1102436127 21 Left 1102436114 12:112925311-112925333 CCCCTCCTTGCACACCCCTCACG 0: 1
1: 0
2: 2
3: 18
4: 222
Right 1102436127 12:112925355-112925377 CCCCTCTCCCAGCCAACCGCAGG 0: 1
1: 0
2: 1
3: 33
4: 344
1102436116_1102436127 19 Left 1102436116 12:112925313-112925335 CCTCCTTGCACACCCCTCACGCC 0: 1
1: 0
2: 2
3: 29
4: 301
Right 1102436127 12:112925355-112925377 CCCCTCTCCCAGCCAACCGCAGG 0: 1
1: 0
2: 1
3: 33
4: 344
1102436119_1102436127 7 Left 1102436119 12:112925325-112925347 CCCCTCACGCCTGTCTGTGAGGT 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1102436127 12:112925355-112925377 CCCCTCTCCCAGCCAACCGCAGG 0: 1
1: 0
2: 1
3: 33
4: 344
1102436124_1102436127 -2 Left 1102436124 12:112925334-112925356 CCTGTCTGTGAGGTGCCAGGGCC 0: 1
1: 0
2: 0
3: 17
4: 208
Right 1102436127 12:112925355-112925377 CCCCTCTCCCAGCCAACCGCAGG 0: 1
1: 0
2: 1
3: 33
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102436127 Original CRISPR CCCCTCTCCCAGCCAACCGC AGG Intronic
900092609 1:926946-926968 CCCCTCCCCCATCCTACCTCAGG - Intronic
900104553 1:976735-976757 CCACTCCCCCCGCCAACCCCGGG + Intronic
900104568 1:976767-976789 CCACTCCCCCCGCCAACCCCGGG + Intronic
900104583 1:976799-976821 CCACTCCCCCCGCCAACCCCGGG + Intronic
900104598 1:976831-976853 CCACTCCCCCCGCCAACCCCGGG + Intronic
900104613 1:976863-976885 CCACTCCCCCCGCCAACCCCGGG + Intronic
900104628 1:976895-976917 CCACTCCCCCCGCCAACCCCGGG + Intronic
900104643 1:976927-976949 CCACTCCCCCCGCCAACCCCGGG + Intronic
900111871 1:1010395-1010417 CCCGTCTCCCAGCAAATCTCAGG - Intergenic
900569768 1:3352431-3352453 CCCCTCCCCCAGCCCACTGCGGG - Intronic
900611337 1:3545812-3545834 CCCCTCCCCCAGCCTCCCGCTGG + Intronic
901604799 1:10450570-10450592 CCCCTTTCCCAGACACCCGACGG - Intronic
901898123 1:12332609-12332631 ACCCTCTCCCACCCAACTCCAGG - Intronic
902659826 1:17893264-17893286 CCCCTCTCCCATACAACCCCTGG - Intergenic
902806718 1:18865607-18865629 CCCATCCTCCATCCAACCGCAGG - Intronic
903555089 1:24187308-24187330 CCCGTCTCCTAGCCCACCGCGGG + Intronic
903953907 1:27012141-27012163 CCCCTCTCCCAGCCAGGCCCTGG + Intronic
904014588 1:27409865-27409887 CCCTTGTCCCAGCCAACAGGAGG - Exonic
904078860 1:27859258-27859280 CCTCTCTCCCAGGCATCAGCAGG + Intergenic
905153102 1:35948463-35948485 CCCCGCCCCCACCCCACCGCCGG + Intronic
909102567 1:71367712-71367734 CCTCTCTCCCCGCTAACCTCTGG + Intergenic
909395404 1:75166135-75166157 GCCCTATCCCAGGCAACCCCAGG + Intergenic
911063082 1:93764450-93764472 CCCCTCTCCCACCCCAGCCCAGG + Intronic
911792970 1:102041460-102041482 CCCATCCCCCAGCCCACCGCTGG - Intergenic
911925656 1:103828452-103828474 TCCCTCTCCCCTCCAACCCCTGG + Intergenic
912500955 1:110121576-110121598 CCTCTCACCCAGACAACCTCAGG + Intergenic
912860489 1:113209713-113209735 CCCCTCTCTCACCCCACTGCAGG - Intergenic
913179082 1:116302082-116302104 CCCCCAACCCAGCCAACCTCTGG - Intergenic
913984362 1:143551720-143551742 CCCCTCCCCCAGCCAAACAAAGG - Intergenic
914764310 1:150624511-150624533 CCACTTTCCCAGCCTACCTCTGG - Intronic
915091287 1:153428242-153428264 CCCCACTCCCACCCAGCCGCTGG + Intergenic
915093825 1:153445047-153445069 CCCCACTCCCACCCAGCCGCTGG - Intergenic
915166789 1:153952364-153952386 CCCACCTCTCAGCCAACCTCAGG + Intronic
918035059 1:180861765-180861787 CCCCACTCCCACCCAAGAGCTGG - Intronic
920314567 1:205068208-205068230 CCCATCTCCGAGCCATTCGCAGG + Intronic
921925244 1:220705704-220705726 GCCCTCTCCCTGCCAGCCCCTGG - Intergenic
922498913 1:226082951-226082973 CCCCTCACCCAGCTAAGCCCGGG - Intergenic
923092769 1:230752578-230752600 CCCCTCCCCCAGCCTTCTGCAGG - Intronic
1064274298 10:13892086-13892108 CCCCTCTCCGTGGCACCCGCAGG + Intronic
1064507868 10:16053230-16053252 CCCCTCACCCACCCAACAACTGG + Intergenic
1065069010 10:22003283-22003305 CCGCTCTCCCAGCCGCGCGCCGG + Exonic
1065401057 10:25301897-25301919 CTCCTCTGCCAGGCAACTGCTGG + Intronic
1067768884 10:49109351-49109373 TCCCTCCCCCAGCCCACCGCAGG - Intronic
1067830160 10:49607146-49607168 CTCTTCTCCCCGCCAGCCGCCGG - Intergenic
1069604870 10:69732711-69732733 GCCCTCTCCCTGCCAACCCCAGG - Intergenic
1069610986 10:69772421-69772443 CACCTCTCCCAGCCTACCTCTGG + Intergenic
1070777046 10:79115802-79115824 GCCCTCCCCCATCCAACCTCAGG - Intronic
1071292418 10:84197283-84197305 CCCCACTCCCTGGCACCCGCGGG + Intronic
1072190039 10:93071310-93071332 CCCCTCCCCCAGGCCACCGCTGG - Intergenic
1074150171 10:110752201-110752223 CCCTTCTCCCCGCTAACCCCTGG + Intronic
1074447515 10:113532849-113532871 CCTCTCTGCCAGCCAACCCCTGG + Intergenic
1074503074 10:114043792-114043814 CCACTCCCCAAGCCAACCCCCGG - Intergenic
1076437214 10:130454503-130454525 CCCCACTCTCAGCCAACCAAGGG - Intergenic
1076674158 10:132139733-132139755 CCCTACTCCCCGCCAACCACTGG - Intronic
1077063435 11:627326-627348 CCCCTCCCCCAGCCGGCCGAGGG - Intergenic
1077636640 11:3846288-3846310 TCCCTCTCTCAGCCAGCCTCAGG + Intergenic
1081207531 11:40293110-40293132 CCCCTCTCCCCTCCAAACTCCGG + Exonic
1083235007 11:61345591-61345613 CACCTCCCCCAGCCCACCCCTGG - Intronic
1083298431 11:61727659-61727681 CCCCTCCCCCAGCTACCCACAGG - Intronic
1083325280 11:61869918-61869940 CCACTCCTCCAGCCAGCCGCTGG - Intergenic
1083516466 11:63263425-63263447 CCCCACTCCCAGCCAAGGGAGGG - Intronic
1083828895 11:65218487-65218509 TCCCTCTCCCAGCACACAGCGGG + Intergenic
1084315286 11:68342287-68342309 CCCCTCTCCCCACCAAAGGCTGG + Intronic
1085353444 11:75815435-75815457 CCCGTCCCCCAGCCACCCCCGGG + Exonic
1087165059 11:94994775-94994797 TCTCTCTCCCACCCAACCCCAGG - Intronic
1088078713 11:105883424-105883446 CCCCTCCCCCACCCCACGGCAGG + Intronic
1089305713 11:117524965-117524987 ACCCTATCCCCGCCATCCGCTGG - Exonic
1089496778 11:118912028-118912050 CCTCTCTCCCACCCCGCCGCAGG + Intronic
1090068762 11:123525935-123525957 CCCCTCTCCCAGCTGAAAGCTGG - Exonic
1091266767 11:134277057-134277079 CGCCTCTCCCAGGCACCCACCGG + Intronic
1091311864 11:134580549-134580571 CCCCTCCCACAGCAACCCGCAGG - Intergenic
1091710890 12:2739631-2739653 GCCCTCTCCCAGCCAAGCCCTGG + Intergenic
1091996639 12:4999021-4999043 CCCCCTTGCCACCCAACCGCAGG + Intergenic
1093376069 12:18429472-18429494 ACCCTCTCCCAGCCACCATCTGG + Intronic
1095944144 12:47744609-47744631 GCCCTGTCCCAGCCCACAGCAGG + Intronic
1096777952 12:53975069-53975091 CCCTTCTCCTAGCCCACCGCGGG - Intronic
1097106458 12:56629192-56629214 CCCCTCCCCCAGCCTCCCGCAGG - Intronic
1099779670 12:87177399-87177421 CCCCTCCCCCACCCCACCACAGG - Intergenic
1100611774 12:96195955-96195977 CCCCTTTCCCCGCCACCCCCAGG - Intronic
1100996048 12:100302213-100302235 CACCTCCCCCACCCAACCCCAGG - Intronic
1101251479 12:102939907-102939929 CTCCTCTCCCAGTCAAGTGCTGG - Intronic
1102036558 12:109773648-109773670 CCCCTCCCCCTGCCACTCGCTGG - Intergenic
1102436127 12:112925355-112925377 CCCCTCTCCCAGCCAACCGCAGG + Intronic
1102888630 12:116540776-116540798 CCCTTCTCCCCGACAACCCCTGG + Intergenic
1102985099 12:117271560-117271582 CACCGCGCCCAGCCAACCGGTGG + Intronic
1103043635 12:117717111-117717133 CCACTCTCCCAGCCCACCTTGGG + Intronic
1103640103 12:122343927-122343949 CACCTCACCCAGCCAATCACAGG - Intronic
1104577412 12:129980468-129980490 CCCATCTCCCACCCAAACTCAGG + Intergenic
1104822003 12:131682492-131682514 CCCCTCCCCCAGGCAGCCACTGG + Intergenic
1104849293 12:131863573-131863595 TCCCTCGCCCAGGCAACCTCTGG - Intergenic
1111763175 13:92492337-92492359 CCCCTCTCCCACCCCACAACAGG - Intronic
1112566039 13:100552046-100552068 CCCTTCTCCCAGCCATGTGCAGG + Intronic
1112795741 13:103054730-103054752 TCCCTTTCCCAGTCAACCCCAGG - Intronic
1116538345 14:46064554-46064576 CCACTCTCCCTCCCAACCCCTGG + Intergenic
1117277718 14:54206534-54206556 CCCCTCCCCAAGCCAATCCCAGG - Intergenic
1117944926 14:61009533-61009555 CCCCTCCCCCACCCCACAGCAGG + Intronic
1118313291 14:64708350-64708372 CCCCTCCCCCAGCCTCCGGCAGG + Intronic
1119129919 14:72162524-72162546 CCCCACTCCCATCCTACCTCAGG - Intronic
1120138868 14:80904324-80904346 CCCCTCTCCCCGCCACCCTCTGG - Intronic
1120299751 14:82691571-82691593 CCACTTTCCCAGCCTACCTCTGG - Intergenic
1121698128 14:95929323-95929345 CCCACCTCCCAGCCAAGAGCAGG + Intergenic
1122457369 14:101864819-101864841 CAGCTCTCCCACCCAACCTCAGG - Intronic
1122550311 14:102545629-102545651 CCTCTCTCAGGGCCAACCGCTGG - Intergenic
1122773534 14:104107427-104107449 CACCTCTCCCAGCCCAGCCCCGG - Intronic
1124496940 15:30192640-30192662 CCCCTCCCCCAGCCAATCCCCGG - Intergenic
1124631555 15:31340413-31340435 GCCCTGTGCCACCCAACCGCAGG - Intronic
1124746636 15:32346007-32346029 CCCCTCCCCCAGCCAATCCCCGG + Intergenic
1125325764 15:38534636-38534658 CTTCTCTCCCACCCAACTGCTGG + Intronic
1128079942 15:64850969-64850991 CACCTCTCCCAGCCTGCCTCAGG + Intronic
1128086746 15:64891895-64891917 CCCCTCCCCCAGACAACCTCAGG + Intronic
1128160829 15:65422103-65422125 CCCCTCCCCCAGTCCACTGCTGG + Intronic
1129162731 15:73755761-73755783 CCCCTCCCCCCGCCAGCCCCTGG + Intergenic
1131007185 15:88987603-88987625 TGCCTCTCCCAGGCAACCTCAGG + Intergenic
1131120669 15:89821580-89821602 TCCCTCCCCCAGCCCACCCCTGG - Intergenic
1132537107 16:487680-487702 CCCCACTCCCACCCTCCCGCAGG - Intronic
1132614091 16:831792-831814 CCCCCCTCCCAGGCACCCGCTGG - Intergenic
1132622245 16:873352-873374 CTCCGCTCCCAGCCACCGGCCGG - Intronic
1132915727 16:2342084-2342106 CCCCGCGCCCAGCCAGCCGCCGG + Intergenic
1133074165 16:3267078-3267100 CCCATATCCCAGCCAACATCAGG + Intronic
1133130694 16:3674631-3674653 CCCCTCTCCAGCCCCACCGCTGG + Intronic
1133931903 16:10239587-10239609 TCCCACTCCCGGCCATCCGCAGG + Intergenic
1134327659 16:13221805-13221827 GTCCTCTCCCAGCTAACCCCTGG + Intronic
1136778867 16:32885189-32885211 CCCCTCCCCCAGCAGGCCGCCGG - Intergenic
1136891751 16:33976329-33976351 CCCCTCCCCCAGCAGGCCGCCGG + Intergenic
1138450996 16:57093235-57093257 CCCCTGCCCCAGGCAACTGCCGG + Intronic
1140340738 16:74157471-74157493 CCCCTCCCCCACCCCACAGCAGG - Intergenic
1140931714 16:79634091-79634113 CCCCTGACCCAGCCAACCTAAGG - Intergenic
1141201343 16:81900741-81900763 GCCCTCGCCCAGCCAGCTGCGGG + Exonic
1141819953 16:86438486-86438508 CACCTCTCCCATCCATCAGCTGG - Intergenic
1141998298 16:87648653-87648675 CCCCTCTCCCAGCCCAGGGCCGG - Intronic
1142272557 16:89097950-89097972 CCCCTGTCCCAGCCAGCTGAGGG - Intronic
1203081281 16_KI270728v1_random:1147278-1147300 CCCCTCCCCCAGCAGGCCGCCGG - Intergenic
1142812602 17:2402137-2402159 CCCCGCGCCCCGCCCACCGCCGG - Intergenic
1143899439 17:10162828-10162850 TCCCTCTCCCCGCCAGCCCCTGG - Intronic
1144147341 17:12411510-12411532 CCCCTCTCCTAACCATCCCCGGG + Intergenic
1145285535 17:21503552-21503574 CCCCTCACCCAGCTAGCCACAGG - Intergenic
1146301968 17:31696455-31696477 CCCGTCTCCCAGCCAGGAGCTGG - Intergenic
1149537656 17:57444792-57444814 CCCCACCCCCCGCCAACCCCGGG - Intronic
1150208806 17:63429950-63429972 ACCCATTCCCAGCCGACCGCAGG - Intergenic
1151578486 17:74964428-74964450 CCACCCTCCCAGCCCACAGCAGG - Intronic
1151660346 17:75515398-75515420 CACCTCTCCCGGCCGCCCGCCGG + Exonic
1151765609 17:76131917-76131939 CCCCTTGCCCAGCCACCCACAGG - Intergenic
1151882447 17:76903657-76903679 CTCCTGGCCCAGCCAACAGCTGG + Intronic
1152225772 17:79092016-79092038 GCCTTCACCCAGCCAACCACAGG - Intronic
1152569668 17:81116154-81116176 CTCCCCTCCCAGCCACCAGCTGG - Intronic
1152642506 17:81455045-81455067 CCCCTCTGCCTGCCAACCACCGG - Intronic
1153765127 18:8367483-8367505 CCGCTCTCCCAGCGAAGCGAGGG - Intronic
1153805303 18:8705290-8705312 TCCCGCTCCCCGCCCACCGCCGG - Intergenic
1154364622 18:13695707-13695729 CCCCTCCCCCCACCCACCGCAGG - Intronic
1155165919 18:23232423-23232445 CCTCCCTCCCTGCCCACCGCAGG + Intronic
1156485434 18:37462624-37462646 CCCCTCTCCCAGCAAACATGAGG - Intronic
1157438601 18:47692374-47692396 CCCCTTTCCCAGCCAACCTGGGG + Intergenic
1157597613 18:48873401-48873423 CCCCAACCCCAGCCAACCTCAGG - Intergenic
1158479134 18:57804828-57804850 CCCCTCTCCCAGTCAGTTGCAGG - Intergenic
1159768748 18:72522783-72522805 ACCCTCCCCCACCCAACCCCAGG - Intergenic
1160040247 18:75338670-75338692 CCCTTCTCCCCGCCCACCCCCGG - Intergenic
1160788620 19:912819-912841 CCCCTCCCCCAGCGAGCCCCCGG + Intronic
1160868049 19:1264754-1264776 CCACTCTCCCAGGCAGCTGCAGG - Intronic
1161320234 19:3637682-3637704 CGCCTCTCCCACCCGACCACGGG - Intronic
1161900567 19:7115970-7115992 CCCCACTCCCCGCCAACCCCGGG + Intronic
1161975733 19:7607020-7607042 CCCCTCCCCCAGCGAACTGATGG + Intronic
1162271717 19:9621367-9621389 CCCCTCCCTGAGCCAACCCCAGG - Exonic
1162644153 19:12036198-12036220 CCACCCCCCCAGCCCACCGCCGG - Intronic
1162955025 19:14092694-14092716 CCCCCATCCCACCCAACCACAGG - Exonic
1163513343 19:17748600-17748622 CCCCACTCACAGCCAGCCTCTGG - Intronic
1163676755 19:18659259-18659281 CCTCTCTCCCAGCCAGTCCCAGG - Intronic
1163864680 19:19762856-19762878 CACCTCTCCCAGCCTACCCTTGG - Intergenic
1164042546 19:21506210-21506232 CCCGCCTCCCAGCAAACTGCTGG - Intronic
1164720620 19:30429155-30429177 CTCCTCTCCCAGCTAGCCCCAGG - Intronic
1165511863 19:36270754-36270776 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165512415 19:36273255-36273277 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165512962 19:36275796-36275818 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165513518 19:36278351-36278373 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165514068 19:36280885-36280907 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165514620 19:36283422-36283444 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165515172 19:36285955-36285977 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165515722 19:36288491-36288513 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165516273 19:36291028-36291050 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165516825 19:36293554-36293576 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165517378 19:36296077-36296099 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165517930 19:36298612-36298634 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165518481 19:36301147-36301169 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165519030 19:36303679-36303701 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165519580 19:36306194-36306216 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165520130 19:36308722-36308744 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165623938 19:37269859-37269881 CCCCACCCCCAGCCCGCCGCCGG + Intergenic
1165624484 19:37272400-37272422 CCCCACCCCCAGCCCGCCGCCGG + Intergenic
1165625027 19:37274927-37274949 CCCCACCCCCAGCCCGCCGCCGG + Intergenic
1165626101 19:37279990-37280012 CCCCACCCCCAGCCCGCCGCCGG + Intergenic
1165626642 19:37282517-37282539 CCCCACCCCCAGCCCGCCGCCGG + Intergenic
1165627182 19:37285038-37285060 CCCCACCCCCAGCCCGCCGCCGG + Intergenic
1165628261 19:37290090-37290112 CCCCACCCCCAGCCCGCCGCCGG + Intergenic
1165628801 19:37292615-37292637 CCCCACCCCCAGCCCGCCGCCGG + Intergenic
1165629343 19:37295141-37295163 CCCCACCCCCAGCCCGCCGCCGG + Intergenic
1165629884 19:37297666-37297688 CCCCACCCCCAGCCCGCCGCCGG + Intergenic
1165630427 19:37300194-37300216 CCCCACCCCCAGCCCGCCGCCGG + Intergenic
1165630964 19:37302732-37302754 CCCCACCCCCAGCCCGCCGCCGG + Intergenic
1166130861 19:40744784-40744806 CCCCTCTCCCAGGCCAGCGAGGG + Intronic
1166860816 19:45810018-45810040 CACCACTCCCAGCCAAGAGCTGG - Intronic
1168209584 19:54880969-54880991 CTCCTCTCCCACCCAAGTGCTGG + Intronic
1168277794 19:55286748-55286770 CTCCTCTGCCAGCCACCCCCTGG - Intronic
1168670587 19:58238353-58238375 CCTCTCTCCCAGGAAGCCGCAGG - Intronic
1168695108 19:58399923-58399945 TCCCTCTCCCACCCAACCTAGGG + Intergenic
926731898 2:16041869-16041891 ACCCTCCTCCAGCCAACCACAGG - Intergenic
927718491 2:25367932-25367954 CCCCGCTCCCTGCCAAGTGCAGG - Intergenic
929889431 2:45906887-45906909 ACACTGTCCCAGCCAAGCGCAGG - Intronic
930001317 2:46863550-46863572 GCCTTCTCCCAGCCAGCCTCGGG - Intergenic
931371852 2:61670464-61670486 CACCACGCCCAGCCAACCTCTGG + Intergenic
931704896 2:64939158-64939180 CCTCCCTCCAAGCCAACCTCTGG - Intergenic
931727373 2:65124267-65124289 CACCTCGCCCAGCCAAAAGCGGG + Intronic
933886310 2:86721137-86721159 CCCCGCTCCCAGCCGGCCCCGGG + Intronic
934686393 2:96325184-96325206 CCACTCTCCCAGCAAACCCACGG + Intergenic
935046711 2:99489778-99489800 CCCCTCCCCCACCCCGCCGCCGG + Intronic
935149128 2:100417710-100417732 CCCCACTCCCCGCGACCCGCTGG - Intergenic
936091577 2:109504903-109504925 CTCCCCACCCAGCCCACCGCTGG - Intergenic
936341619 2:111638733-111638755 CCCCTCTCCCTGCCTGCCCCTGG + Intergenic
936438445 2:112529064-112529086 CCCCTCTCCCCGGGAACGGCAGG + Exonic
936524318 2:113232592-113232614 CCACTCTCCAGGCCAACTGCAGG - Intronic
937147993 2:119663790-119663812 CCCCGTTCCCAGCCAGCCCCTGG + Intergenic
937149947 2:119679359-119679381 CTCCTCCCCCAGCCACCGGCGGG + Exonic
937288419 2:120767433-120767455 TCCCTCTCCCAGTCTGCCGCTGG + Intronic
937354853 2:121191920-121191942 GCCCTCTCCAAGCCAATCCCAGG + Intergenic
938139921 2:128787069-128787091 CCATTCCCCCAGCCAACAGCAGG - Intergenic
939004092 2:136765830-136765852 CCCTTCTCCCAGCCAGACGCGGG + Intronic
941240997 2:163037679-163037701 CACTTCTCCCTGCCAACAGCTGG - Intergenic
943445067 2:187974562-187974584 CCCAGCTCCCAGTCAACCACAGG + Intergenic
947640915 2:231707560-231707582 CCCTTCTCCCACCCCACTGCTGG - Intronic
948039396 2:234887502-234887524 CCCCTCTCCCTGCCTAGCCCTGG - Intergenic
948149360 2:235732899-235732921 CACCTCCCCCAGCCAGCCCCAGG + Intronic
948159483 2:235812440-235812462 CCCCTCGTCCAGCCTGCCGCAGG + Intronic
948517154 2:238511142-238511164 ACCATCTGCCAGCCAACCCCAGG - Intergenic
948584372 2:239009724-239009746 CCCCTGAACCATCCAACCGCAGG + Intergenic
948805678 2:240452710-240452732 CCCGTCTCCCTGGAAACCGCAGG - Intronic
1168755447 20:313835-313857 ACCCTCTCCCCGCCAAACACTGG + Intergenic
1168831405 20:847050-847072 CCCCTCTCCACGCCCACCGTGGG - Intronic
1169483366 20:6005892-6005914 CCCCTTTCCCCGCCCACCCCCGG + Intergenic
1169975303 20:11319089-11319111 CTCCTCTCCCACCCAGCCCCTGG + Intergenic
1170470308 20:16661976-16661998 CCACTCTCCCAGCCAAGGGGGGG - Intergenic
1170525127 20:17228712-17228734 CCTCTCTCCCAGCCACCGCCAGG + Intronic
1170695166 20:18651437-18651459 CACCGCTCCCAGCCAACAGCTGG + Intronic
1171127839 20:22619999-22620021 CCCCTCCCCCAACCCACCCCAGG - Intergenic
1171371122 20:24662645-24662667 CCCTACCCCCAGCCCACCGCTGG + Intronic
1172064157 20:32207599-32207621 CCCCTCTCCCCGCCGTCCCCTGG + Intronic
1172188735 20:33048947-33048969 GCCCTCTCCCAGCCTAGCCCAGG + Intergenic
1172207688 20:33176101-33176123 CCCCTCTCCCTCCCAACTGGAGG - Intronic
1172948504 20:38706611-38706633 CTCCTCTCCCAGTCATCAGCCGG + Intergenic
1173053041 20:39583727-39583749 CCCCTCTCCCTCCCATCCCCTGG - Intergenic
1173570050 20:44070185-44070207 CCCCGCTCCCAGCCAGGCTCGGG + Intergenic
1174165249 20:48579592-48579614 CACCGCTCCCGGCCAACCACAGG + Intergenic
1174795337 20:53517654-53517676 CACCTCTCCCCGCCACCCCCGGG + Intergenic
1175774150 20:61642315-61642337 CCCCTCTGCCATCCACCTGCTGG - Intronic
1175832912 20:61976776-61976798 GCCCAGTCCCAGCCAACCCCAGG - Intronic
1175913748 20:62416265-62416287 CCCCTGTCCCCCCCAACCCCTGG - Intronic
1176100537 20:63362411-63362433 CCCCCCTCCCTGCCCACCTCTGG + Intronic
1176428209 21:6561496-6561518 CCCCCCCCCCACCCAACCACAGG + Intergenic
1178388720 21:32180917-32180939 CCCTTCTCCCAGTCAGCCACTGG - Intergenic
1178628919 21:34242569-34242591 TTCCTTTCCCAGCCAACCTCTGG - Intergenic
1179568760 21:42265550-42265572 CCCCTGTCTCTGCCAGCCGCTGG - Intronic
1179703699 21:43169812-43169834 CCCCCCCCCCACCCAACCACAGG + Intronic
1180626817 22:17199168-17199190 CCCGTCCCCCAGCCAACCTTTGG - Intronic
1180800568 22:18630037-18630059 ACACCCTCCCAGCCAGCCGCTGG + Intergenic
1180851800 22:19025594-19025616 ACACCCTCCCAGCCAGCCGCTGG + Intergenic
1181221151 22:21365225-21365247 ACACCCTCCCAGCCAGCCGCTGG - Intergenic
1181288757 22:21774423-21774445 CCCCGTGCCCAGCCAACCACAGG - Intronic
1181425998 22:22839407-22839429 CACCCCTCCCAGCCAACCTCAGG - Intronic
1182309073 22:29391911-29391933 CCCCTCTCCCTGCAAACTGTAGG - Intronic
1184456050 22:44609931-44609953 CCCATCACCCAGCCACCCACTGG + Intergenic
1185107556 22:48882933-48882955 GCCCACTCCCAGCCCACCGGGGG + Intergenic
950008049 3:9704106-9704128 CCCCAGCCCCAGCCAGCCGCGGG + Intronic
950446763 3:13043053-13043075 CCCGTCGCCCAGGCAACGGCAGG - Intronic
950543192 3:13624506-13624528 CCCCATTCCCAGCCATCCCCGGG + Intronic
953540616 3:43814519-43814541 CCAATCTCCCAGCCAACTCCTGG - Intergenic
954086698 3:48250258-48250280 CCCCTCTCCTCTCCAACCTCTGG + Intronic
954200435 3:49020703-49020725 CCCCGCCCCCCGCCAACGGCTGG - Intronic
954427644 3:50451822-50451844 CCCCACTCCTAACCAACCCCAGG + Intronic
954717550 3:52533965-52533987 CCCCTCCCCCAGCCAGTCTCCGG + Intronic
954800768 3:53185840-53185862 CCCTTCCCCCAGCCTACCCCAGG + Intronic
956151308 3:66245982-66246004 CCCCACTCCTAGGCAACCACTGG + Intronic
957673780 3:83340331-83340353 CCCCTCTCCCAACCCACAACAGG + Intergenic
960069228 3:113410296-113410318 CCCCTCTCCCACCCCACGACAGG + Intronic
960717579 3:120592673-120592695 CCCTTCTTCCAGCCAAACACAGG + Intergenic
961039627 3:123668498-123668520 CCCCTCCCCCACCCTACCTCTGG - Intronic
961207625 3:125098778-125098800 CCCCTCTGACAGCAAACTGCTGG - Intronic
962460710 3:135609987-135610009 CCCTTCTCCCACCCAACAACAGG - Intergenic
962498416 3:135965706-135965728 CGCCCCGCCCAGCCACCCGCAGG - Exonic
964011913 3:151901790-151901812 CCTCACTCCCAGCCAAGCTCTGG - Intergenic
964621444 3:158723641-158723663 CCTCTCTCTCAGCCAACCCTGGG + Intronic
966974186 3:185070555-185070577 CCCTTCTCCCACCCAAACACAGG + Intergenic
968007675 3:195254289-195254311 CCCCTCACCCTCCCAACCACAGG + Intronic
968178134 3:196568858-196568880 CCCCTGTCAGTGCCAACCGCCGG - Exonic
968489907 4:884394-884416 TCCCTCTCCCAGCCCACTCCTGG - Intronic
968520467 4:1032679-1032701 GCCCTCGCCCAGCCAGCTGCTGG - Intergenic
968678006 4:1895895-1895917 CCCCTCTACCAGCCAGCCCAGGG - Intronic
968830660 4:2931653-2931675 ACCCGCTCCCAGCCTACAGCAGG - Exonic
968939597 4:3631056-3631078 CCCCCCTCCCACCCCACCCCAGG - Intergenic
969283051 4:6184357-6184379 CCCTACTCCCAGCCCACTGCTGG + Intronic
969566145 4:7979363-7979385 CCCATCTCCCACCCTCCCGCAGG + Intronic
970601478 4:17643814-17643836 CCCCACTCCCAGCCCTCAGCAGG - Intronic
970931148 4:21513615-21513637 CCACTCTCACAGCAAACCACTGG - Intronic
972423562 4:38912147-38912169 CACCGCACCCAGCCAAGCGCAGG + Intronic
972883437 4:43454948-43454970 ACCCTCTCCCTGCCAGCCTCTGG + Intergenic
976235421 4:82891304-82891326 CCCGCCTCCCAGGCTACCGCCGG - Intronic
978522578 4:109631969-109631991 CCCCTTTCACAGCCCACCTCTGG + Intronic
980030214 4:127819650-127819672 GCCCTCTCCCTGCCAGCCACAGG + Intronic
984860125 4:184230439-184230461 CCTCTCTCCCTGCCAGCCCCCGG + Intergenic
987387189 5:17341270-17341292 TCCTTCTCCCAGGCAACCTCTGG - Intergenic
987952431 5:24692615-24692637 CACCTCTCTAAGCCAACCACTGG - Intergenic
990438704 5:55821957-55821979 ACGCTCTCCCAGCCAGCGGCGGG + Intergenic
996228903 5:121036745-121036767 CCCCTCTCCCACCCCACAACAGG + Intergenic
997453950 5:134004380-134004402 CGCCTCTCGCCGCCAGCCGCAGG + Intronic
997527776 5:134564540-134564562 CGCATATCCCAGCCAGCCGCTGG + Exonic
998181411 5:139948072-139948094 CTCCTCCCCCACCCAACCCCTGG + Intronic
998406238 5:141876288-141876310 CCCCGCACCCAGGCCACCGCGGG + Intronic
1001522614 5:172405465-172405487 TCCATCTCCCAGCCAACAGTGGG - Intronic
1001698992 5:173693116-173693138 CCTCTTTCCCTGCCAACCTCAGG + Intergenic
1002310905 5:178313176-178313198 CCCCTAGCCCAGCCCACCGATGG - Intronic
1003157199 6:3606921-3606943 CCGCTCCCCCCGCCAACCTCAGG - Intergenic
1004836578 6:19538256-19538278 CACCTCCCCAAGCCAACTGCTGG + Intergenic
1006642779 6:35497293-35497315 CCCCGCTCCCGGGCACCCGCCGG + Intergenic
1007264818 6:40588065-40588087 CCCCACTCCCAGCCTAGGGCCGG - Intergenic
1007342623 6:41201156-41201178 CACTGCCCCCAGCCAACCGCAGG + Exonic
1007644508 6:43369671-43369693 CCCCTCGCCCAGCCTCGCGCCGG - Intergenic
1008590241 6:52986774-52986796 CCTCCCTCCCAGCCAACAGCAGG - Intronic
1011509926 6:88088998-88089020 CCCCTTTCCCAGACAGCTGCTGG + Intergenic
1012757748 6:103253117-103253139 CCCCTCTCCCACCCCACGACAGG - Intergenic
1013663443 6:112322619-112322641 GCCCTCTATCAGCCAACAGCTGG + Intergenic
1013720373 6:113019082-113019104 CCCCTCTCCCTGCCAGGAGCAGG - Intergenic
1013883509 6:114933821-114933843 CTCCTCTCCCAACCAAGTGCTGG + Intergenic
1013933741 6:115568536-115568558 CCCCTCTCCCACCCTCCCCCCGG - Intergenic
1014265471 6:119271790-119271812 CACCACGCCCAGCCAACCCCCGG + Intronic
1015156499 6:130102187-130102209 CCCATCTCCCATCCATCCACAGG + Intronic
1016989329 6:149918525-149918547 CCCCTCTCCCTTCCTACCCCAGG - Intronic
1019406187 7:885470-885492 CCCCACTCCCAGAGCACCGCTGG - Intronic
1019486174 7:1290371-1290393 CCCTTCTCCCTGCCAACCTCGGG - Intergenic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1022136993 7:27458139-27458161 CCCCATTCCCTCCCAACCGCAGG + Intergenic
1023861395 7:44219558-44219580 CCCCTCTCCCATCCACCCCCAGG + Intronic
1024776057 7:52787476-52787498 TCCCTATCCCAGCCACCCACAGG - Intergenic
1026220524 7:68392529-68392551 CCCGTCTCCTTGCCAACCACGGG - Intergenic
1026454310 7:70557374-70557396 CACCTCTGCCAGCCAAGGGCTGG - Intronic
1026853941 7:73741022-73741044 CCACTAACCCAGCCACCCGCAGG - Intergenic
1026926149 7:74195310-74195332 CCCCATTCCCTCCCAACCGCAGG - Exonic
1028301905 7:89210489-89210511 CCCATCCCCCACCCAACCCCTGG + Intronic
1029458840 7:100684204-100684226 GCCTTCTCCCAGCCCACCCCAGG + Intronic
1032161693 7:129515927-129515949 CACCGCTCCCGGCCAACCTCAGG - Intergenic
1033165610 7:139036140-139036162 CCCCTCGCCCGGCCTCCCGCAGG - Intergenic
1035044639 7:155955552-155955574 CCCCTTCCCCAGCCCACAGCCGG - Intergenic
1035457399 7:159017476-159017498 CCCCTCTTCCAGCCAGCCCAGGG + Intergenic
1037734744 8:21556880-21556902 CCCTTCTCCCAACCCACCCCAGG + Intergenic
1039134780 8:34309195-34309217 CCCTCCTCCCAGCCAGCCCCTGG - Intergenic
1039572654 8:38600004-38600026 CACCTCACCCAGCCAATCCCAGG + Intergenic
1040391395 8:46953586-46953608 CCCCTCCCCTAGCTAACCGTGGG - Intergenic
1044623641 8:94215475-94215497 CCCCTCTGCCCCCCAACTGCAGG - Intronic
1048176521 8:132157526-132157548 ACACTCTCCCAGCCAGCCACTGG - Intronic
1049190733 8:141285974-141285996 CCCCCACCCCAGGCAACCGCAGG - Intronic
1049277479 8:141727021-141727043 CCTCCCTCCCAGCCGCCCGCTGG + Intergenic
1049719843 8:144110734-144110756 CCCACCTCCTAGCCTACCGCAGG - Exonic
1049807588 8:144547972-144547994 CCCCTCGCCCTGCCAGCAGCTGG - Exonic
1050472600 9:6008161-6008183 GCCCCCTCCCAGCCCCCCGCTGG - Intergenic
1050813635 9:9781012-9781034 CCACCCTCCCTGCCAACCCCTGG - Intronic
1051389721 9:16551322-16551344 CTCCTGTCCCAGCTAACAGCTGG + Intronic
1053001224 9:34578154-34578176 CCCCTCGCCCACCCGCCCGCCGG - Intronic
1053073418 9:35114501-35114523 ACCCTCTCCCAGCCAGCCCAGGG + Intronic
1056510204 9:87297355-87297377 CCCATCTCCCAGCCAAAGGAAGG + Intergenic
1057276592 9:93679271-93679293 CCCCTCTCCCACCCAGTCTCGGG - Exonic
1057725308 9:97564193-97564215 CCCCTCCCCCAGCCACACACAGG - Intronic
1060490456 9:124080367-124080389 CACCTTGCCCAGCCAACCCCAGG + Intergenic
1061043822 9:128153854-128153876 CCCCTCTGCCAGCCCACTGTGGG + Intergenic
1190618413 X:52262107-52262129 ACACTCTCCCAGCCAGCCCCTGG + Intergenic
1191606255 X:63065942-63065964 CCCCTTCCCCAACCAACCTCCGG - Intergenic
1191861159 X:65667568-65667590 CCCGCCTCCCCGCCGACCGCTGG - Intronic
1192923938 X:75736220-75736242 CCCCTCCCCCACCCCACCACTGG + Intergenic
1195082918 X:101387638-101387660 CACCTCTCCCAGCCATCAACAGG + Intronic
1197169161 X:123412017-123412039 TCTCTCTCCCAGCCTACAGCTGG + Intronic
1198312064 X:135433734-135433756 CCCCGCTCTCTGCCAGCCGCAGG - Intergenic
1199629232 X:149764650-149764672 CCCCTCACCCACCCAACCCCTGG + Intergenic
1200097598 X:153671512-153671534 CCCCACTCCCAGCAAGCCTCAGG + Intronic
1200155365 X:153972116-153972138 CCCCTCGCCCGGCCGTCCGCGGG + Intergenic
1200213240 X:154356179-154356201 CCCGGCTCCCAGCCAACCGCAGG + Intronic