ID: 1102438176

View in Genome Browser
Species Human (GRCh38)
Location 12:112941577-112941599
Sequence GAGAGCTGTGCCCCGGCCCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102438176 Original CRISPR GAGAGCTGTGCCCCGGCCCG AGG (reversed) Exonic
900226628 1:1536168-1536190 GTGAGCTGTGACCCTGGCCGTGG - Intronic
900671355 1:3856951-3856973 CGGAGCGGTGCCGCGGCCCGGGG + Exonic
902578333 1:17392519-17392541 GAGAGCTGGGCCACTGCCCTGGG + Intronic
903375788 1:22864996-22865018 AAGAGCTGTGGCTCGGGCCGGGG + Exonic
903765338 1:25730598-25730620 GAGAGCTGTCTCCTGGGCCGTGG + Intronic
904039557 1:27575952-27575974 TCGGGCTCTGCCCCGGCCCGGGG + Intronic
911440582 1:97921079-97921101 GAGAGCGCAGCCCCGCCCCGGGG - Intergenic
912576049 1:110674106-110674128 GAGAGCTCCGGGCCGGCCCGGGG - Exonic
913240353 1:116824944-116824966 GAGAGCTGTCCTCCTGCCCATGG + Intergenic
914242096 1:145859034-145859056 GAGAGTTGTGCGCCGGTCCCTGG - Exonic
914353389 1:146860026-146860048 GAGAGCTGTGGCCAGGGCAGAGG + Intergenic
915005444 1:152630690-152630712 GTGAGCTGTACCCCAGCCCAGGG - Intergenic
915677336 1:157543936-157543958 GAGAGCTATGCCACAGCCCATGG + Intronic
915722236 1:157993768-157993790 GGAAGCAGTGCCCCGGCCCCGGG - Intronic
916189762 1:162167463-162167485 GAGAGCTGGGCTCTGGACCGGGG + Intronic
919809502 1:201399670-201399692 CCGCGCTGTGCCGCGGCCCGGGG + Intergenic
1066441202 10:35440623-35440645 CAAAGCTGTGCCCCGGACAGGGG - Intronic
1067046154 10:42986230-42986252 GAGAGCTGTCCCCTGGCCAAGGG + Intergenic
1067688380 10:48481585-48481607 CAGAGCTGTGCCCCTGTCCTGGG + Intronic
1069920629 10:71813374-71813396 GTGTGCTGTGCCCCAGCCTGGGG + Intronic
1070267066 10:74913806-74913828 GAGAGCTGTGCCCAGTGCCGGGG + Intronic
1072662274 10:97370354-97370376 GAGCTCTGTGCCCTGGCCCTGGG - Intronic
1075059669 10:119247007-119247029 CAGATCCGTGCCCTGGCCCGAGG + Intronic
1075060018 10:119250095-119250117 GAGTGCTGTGCCCAGACCTGTGG + Intronic
1075199166 10:120387801-120387823 CAGAGCTGTTCCCCGTCCCATGG - Intergenic
1076372710 10:129965231-129965253 GGGCGCTGTGGCCCGGCCCTCGG + Intergenic
1076690725 10:132222785-132222807 GGGTGCTGAGCCCCGGCCCGTGG + Intronic
1076791057 10:132776953-132776975 ATGAGCTGTGCCCTGGCCGGCGG + Intronic
1082809877 11:57473476-57473498 GAGAGCTGTGAACCGGCCAGTGG + Intronic
1083197957 11:61102289-61102311 GAGAGCACTGCCCCAGCCCTGGG + Intergenic
1083446021 11:62708528-62708550 GAGAGCTGTCCCCAGGCCTCTGG + Intronic
1084439756 11:69166169-69166191 GAGATCCGTGCCCAGGACCGAGG - Intergenic
1087389072 11:97511965-97511987 GAGAGCTGTGTCACGGGCCATGG - Intergenic
1091974023 12:4810543-4810565 GAGAGCTCTGGGCCGGCCAGGGG + Exonic
1096522405 12:52191773-52191795 GGGAGCTGAAGCCCGGCCCGGGG + Exonic
1096871720 12:54596723-54596745 GAGAGCTGAGCCCCAGCACCTGG - Intergenic
1097268827 12:57761757-57761779 GAGAGCTGTGCCCAGCCTCTGGG + Intergenic
1099873286 12:88374227-88374249 GAGATCTGAGCCCTGGCCCTTGG - Intergenic
1101454179 12:104812699-104812721 GACAGCTGTGCAGTGGCCCGGGG + Intronic
1102438176 12:112941577-112941599 GAGAGCTGTGCCCCGGCCCGAGG - Exonic
1102465784 12:113130176-113130198 GAGAGCTGTCCCTCGGCCTGCGG + Intronic
1103626742 12:122225888-122225910 CAGCGCTGTGGCCCGGCCCACGG - Intronic
1104822219 12:131683755-131683777 GTGAGCTGGGCCCAGGCCTGGGG + Intergenic
1105013991 12:132774813-132774835 GGGAGCTGTGCCCAGGCGCCCGG - Intronic
1108433862 13:50382368-50382390 GAGAGCTCTGACCAGGCCCATGG + Intronic
1111046696 13:82823187-82823209 TAGAGGTGAGCCCCGGACCGGGG - Intergenic
1117546554 14:56798287-56798309 GCGACCGGCGCCCCGGCCCGCGG + Intergenic
1120107654 14:80515283-80515305 GTGAGCTCTGCCCCAGCCCAGGG + Intronic
1121951400 14:98173880-98173902 GAGAGCTGTGCACTGGCTGGAGG + Intergenic
1122558493 14:102593641-102593663 GTGAGCTGCGCCTCGGCCAGGGG + Intronic
1122599709 14:102915195-102915217 GAGAGCAGTCACCCGGCACGAGG - Intergenic
1122814174 14:104304119-104304141 GTGAGCTCTTCCCCAGCCCGAGG - Intergenic
1127564451 15:60173144-60173166 AAGAGCTGGGCCCTGGTCCGTGG - Intergenic
1128149775 15:65355611-65355633 CGCAGCTGCGCCCCGGCCCGCGG + Intronic
1129461053 15:75700294-75700316 GAGAGCTGGACCCCAGCCTGGGG + Intronic
1129723767 15:77891431-77891453 GAGAGCTGGACCCCAGCCTGGGG - Intergenic
1132538384 16:495265-495287 GGGGGCTCTGCCCCGGCCCTGGG - Intronic
1132959537 16:2614227-2614249 GGCAGCTGTGCCGCTGCCCGTGG - Intergenic
1136234235 16:28904554-28904576 GTGAGGTGGGCCCCGGCCCTGGG - Exonic
1139490235 16:67282077-67282099 GAAGGCTGTGCCCCAGCCCATGG + Exonic
1139980634 16:70855492-70855514 GAGAGCTGTGGCCAGGGCAGAGG - Intronic
1140407688 16:74721862-74721884 AAGAGGTGTGCACCGGCACGCGG + Intronic
1141791574 16:86239694-86239716 GACAGCTGTCCCCAGGCCTGGGG - Intergenic
1141955768 16:87370457-87370479 GAGAGCTTTGCCCAGCCCTGGGG + Intronic
1142659035 17:1414922-1414944 CAGAGCTGTGGCCTGGCCAGCGG + Intergenic
1142801152 17:2346706-2346728 GTGTGCTGTTCCCAGGCCCGAGG + Intronic
1142836860 17:2593862-2593884 GCGCGCTGGGCCCGGGCCCGGGG - Exonic
1143381021 17:6496431-6496453 GAGAGAAGAGCCCAGGCCCGGGG - Intronic
1143600287 17:7941065-7941087 GAGAGCTGTGTTCCAGCCCATGG + Intronic
1144637851 17:16922154-16922176 GAGGGCTGTGTCCCGGACCATGG + Intergenic
1150336473 17:64334222-64334244 GAGAGCTGGGCGCTGGCCCGGGG - Intronic
1150692719 17:67378728-67378750 GGGAGCTGCGCCCAAGCCCGCGG - Intronic
1151531038 17:74704854-74704876 GAAAGCTGTGGCCCTGCCCTTGG - Intronic
1151662675 17:75526836-75526858 AAGAGCTGTGGCCCAGCCCGGGG + Intronic
1151956651 17:77383487-77383509 GAGACCTGTTCCCTGGCCCCTGG + Intronic
1152594852 17:81233122-81233144 GAGGGCTGTGCCCCTGGCTGTGG - Intronic
1157338233 18:46756728-46756750 GGGAGCTCTGCCGCGGCCAGGGG + Exonic
1157354024 18:46917190-46917212 GAGCCCTGAGCCCCGGCCCGCGG - Intronic
1160520889 18:79507346-79507368 GAGGGCTGTGCCGGGGCCGGTGG + Intronic
1160575092 18:79848701-79848723 TCCAGCTGTGCCCCAGCCCGTGG - Intergenic
1160730846 19:641001-641023 CAGGCCTCTGCCCCGGCCCGAGG - Intronic
1161420634 19:4174488-4174510 GAGAGCTGTGCTCCAGGCCAGGG - Exonic
1163747618 19:19057588-19057610 GAGAGCTGTGGACAGGCCAGAGG + Exonic
1165406389 19:35633706-35633728 GAGAGCTGGGCCTAGGCCTGGGG + Exonic
1167049353 19:47069056-47069078 GGGGCCTGTGCCCCGGCCCCTGG + Intronic
1167276505 19:48543397-48543419 GGGGGCAGTGCCCTGGCCCGAGG + Intergenic
925160739 2:1681668-1681690 GAGAGCTGTGCACCTGCTCACGG - Intronic
927643241 2:24859297-24859319 GAGGGCTGTGCCTCTGCCTGTGG - Intronic
929033694 2:37671773-37671795 GGTACCTGTGCCCTGGCCCGGGG + Exonic
929857562 2:45650095-45650117 GAGCGCTGGGCCCCGGGGCGCGG - Intergenic
931418099 2:62100386-62100408 GAGGGCTGTGCCACGGGCCACGG - Intronic
931563336 2:63588179-63588201 GACAGGTGAGCCCTGGCCCGAGG - Exonic
933744229 2:85559028-85559050 GAGAGCTGAGCCCCCGCTCCTGG + Exonic
935946369 2:108289992-108290014 CACAGCTGTGCCCAGGCCCTCGG + Intronic
936055414 2:109258594-109258616 GCCAGCTGTGGCCCGGCCTGGGG - Intronic
936707000 2:115086861-115086883 GAGAGCTGTGTCATGGGCCGTGG + Intronic
937993077 2:127674942-127674964 GCGAGCTGCGCCTCGGCCAGGGG + Intronic
940646791 2:156400322-156400344 GAGCGCTGGGCCCGGGCTCGAGG + Intergenic
944911050 2:204310718-204310740 GAGAACTGGGCCTCGGCCGGGGG - Intergenic
948054826 2:235003279-235003301 GAGAGCTAGGCCCTGGCCAGGGG - Intronic
948415326 2:237798803-237798825 GAGAGCGGGGCGCTGGCCCGTGG + Exonic
948851717 2:240711527-240711549 GGGAGCTGAGCCCCGGCCTTGGG - Intergenic
948958551 2:241314967-241314989 GCGGGTTGTGCCCCGGCCCGGGG - Intronic
1170562674 20:17570296-17570318 GTGAGCCGTGCCTCAGCCCGGGG + Intronic
1174113867 20:48213982-48214004 GACAGCGGTGCCCTGGCGCGGGG + Intergenic
1174167977 20:48598549-48598571 GACAGCGGTGCCCTGGCGCGGGG - Intergenic
1178662768 21:34521179-34521201 GAGGCCTGAGCCCCGGCCCCAGG - Intronic
1179951372 21:44710519-44710541 GAGAGCTGTGGCCCGGTGCCGGG + Intronic
1180706317 22:17812254-17812276 GGCAGCTGTGTCCCGACCCGAGG + Intronic
1180857594 22:19058217-19058239 GAGAGCTGTCCTCCTGCCCATGG - Intronic
1181670643 22:24424131-24424153 GAGACCAGTTCCCCGGCGCGGGG + Intronic
1182550961 22:31100516-31100538 GAGGGCTGTGCCCCGGGGAGAGG - Intronic
1182765022 22:32752587-32752609 GACAGCAGAGCCCCGGCACGCGG - Intronic
1183057523 22:35315966-35315988 CACGGCTGTGCCCCGGCTCGGGG - Intronic
1183521943 22:38300664-38300686 GAGAGCTGGGCCCCAGCCAGTGG + Intronic
1184067416 22:42128585-42128607 GAGAGGTGTGCCCGGGTCAGGGG - Intronic
1184070146 22:42142280-42142302 GAGAGGTGTGCCCGGGTCAGGGG - Intergenic
1184071895 22:42151896-42151918 GAGAGGTGTGCCCGGGTCAGGGG - Intergenic
1184814415 22:46859495-46859517 CAGTGCTGTGCCCCTTCCCGGGG + Intronic
1184814452 22:46859649-46859671 CAGTGCTGTGCCCCTTCCCGGGG + Intronic
1184814489 22:46859803-46859825 CAGTGCTGTGCCCCTTCCCGGGG + Intronic
1184814572 22:46860162-46860184 CAGTGCTGTGCCCCTTCCCGGGG + Intronic
1184814632 22:46860419-46860441 CAGTGCTGTGCCCCTTCCCGGGG + Intronic
950704750 3:14772897-14772919 GTGAGCCAGGCCCCGGCCCGGGG + Exonic
952963730 3:38608461-38608483 GAGAGCTGAGGCCCTGCCCAGGG - Intronic
956659405 3:71583340-71583362 CAGAGCTGGGCCTCGACCCGGGG + Intronic
958785523 3:98593306-98593328 TCGAGCCGTGCCCCAGCCCGCGG + Exonic
961633213 3:128316753-128316775 GAGGGCTGTGCCCCGGTTCACGG - Intronic
968701456 4:2059920-2059942 GGGAGCTCCGCGCCGGCCCGAGG - Intronic
969304394 4:6317501-6317523 GAGAGCAGAGCCCAAGCCCGCGG - Intergenic
969621188 4:8279758-8279780 ATGTGCTGTGCCCCTGCCCGTGG + Intronic
969918274 4:10511273-10511295 GAGAGCTGTGTCACGGGCCATGG + Intronic
971480922 4:27114423-27114445 GAGAGCTGTACGCAGGCCCTGGG - Intergenic
978741874 4:112145816-112145838 CAGAGCTGCGGCGCGGCCCGCGG - Intronic
987099800 5:14581854-14581876 GGGCGCTGGGCCTCGGCCCGTGG - Exonic
993983745 5:94572958-94572980 GAGAGCTGTGCCATGGGCCATGG - Intronic
1001269898 5:170303108-170303130 CAGAGCTGTGTCCAGGCCTGGGG - Intergenic
1001965792 5:175908928-175908950 TAGAGCTGAGCACCTGCCCGAGG - Intergenic
1002251154 5:177930268-177930290 TAGAGCTGAGCACCTGCCCGAGG + Intergenic
1003068018 6:2919809-2919831 GAGGGCTGTGCCACGGGCCATGG - Intergenic
1005582462 6:27247926-27247948 GAGAGCTCTGCCCAGGGCCTGGG + Exonic
1005859185 6:29888233-29888255 GTGACCTGCGCCCCGGGCCGGGG - Intergenic
1005875415 6:30007078-30007100 GTGATCTGCGCCCCGGGCCGGGG - Intergenic
1006043191 6:31271568-31271590 GTGACCTGCGCCCCGGGCCGGGG + Intronic
1006052779 6:31356657-31356679 GTGACCTGCGCCCCGGGCCGGGG + Intronic
1006436355 6:34027817-34027839 GGGATCTGTGCCCCACCCCGAGG - Intronic
1007635569 6:43297953-43297975 GAGAGCTGGCCCCAGGCCCCAGG + Intronic
1010703294 6:79077748-79077770 GAGAGCTGAGCCCCGCGCCCCGG + Intronic
1012398764 6:98827806-98827828 GAGGGCTGCTCCCAGGCCCGAGG + Intergenic
1016863999 6:148747912-148747934 GTGAGCGGTGCCTCGCCCCGGGG - Intronic
1019099696 6:169619440-169619462 GAGGGCTGTGTCACGGGCCGTGG - Intronic
1019102971 6:169647044-169647066 GCAAGCTGTGCCCCTGCCTGGGG - Intronic
1019307375 7:342237-342259 GTGAGCTGTTCTCCGGCCCCCGG - Intergenic
1019385341 7:752445-752467 GCGAAGTGTGGCCCGGCCCGTGG - Intronic
1019573222 7:1723643-1723665 CAGGGCTGTGCCCCGGCCTGGGG + Intronic
1019639303 7:2094712-2094734 GCGAGCTGTGCTCCTGCCCCGGG - Intronic
1034470430 7:151251825-151251847 GAGAGATGCGCCGCGGCCTGCGG + Intronic
1034815904 7:154171676-154171698 GAGAGCTGTGCTGCAGCCCAGGG + Intronic
1035185865 7:157125504-157125526 CAGAGCTGAGCGCCGGCCCCAGG + Intergenic
1035322918 7:158045518-158045540 GAGAGGTGTGCCCCAGGACGTGG + Intronic
1035417759 7:158704455-158704477 GAGGGCAGTGCCCGCGCCCGGGG + Intronic
1035682458 8:1497914-1497936 GAGGGCTGTGCCACGGGCTGTGG - Intergenic
1035876846 8:3199734-3199756 AAGAGCGGTGCCTCTGCCCGCGG - Exonic
1037672179 8:21024455-21024477 GAGAGCAGTGGCCGGGCGCGGGG - Intergenic
1041739850 8:61146468-61146490 GAAATCTGTGCCCAGGCCCATGG + Intronic
1048985292 8:139731706-139731728 GGGAGCTGTGCCCAGGACAGGGG - Intronic
1049415714 8:142493942-142493964 CAGACCTGGGCCCCTGCCCGTGG - Intronic
1049662243 8:143824662-143824684 GAGAGCTGTGCTCCTGCCCCAGG + Intronic
1052763668 9:32618524-32618546 GAGAGCTGTTCCCAGGCACAGGG + Intergenic
1055321673 9:75088495-75088517 GAGTGCTCCGCCCCGCCCCGCGG - Intergenic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1061376182 9:130226189-130226211 GAGAGGTGGGCCACGGCCCAAGG + Intronic
1061398100 9:130354399-130354421 CAGAGCTCTGTCCCGGCCCTGGG + Intronic
1062230793 9:135480293-135480315 GGGAGCTTTGGCCCGGCCCGGGG + Intronic
1062370489 9:136236273-136236295 GAGGGCTGTGTGCCGGCCCCTGG + Intronic
1062451722 9:136618555-136618577 GAGAGCTGTGCCCCGGGAACCGG - Intergenic
1062710007 9:137970248-137970270 GACAGCTGTGCCCCAGCCATGGG - Intronic
1185712239 X:2313746-2313768 GAGGGCTGTGTCACGGGCCGTGG - Intronic
1186496577 X:10015980-10016002 CCGAGCTCTGCCCGGGCCCGGGG - Intronic
1188061387 X:25606091-25606113 GTGAGCTGTGCCCCCTCCCATGG + Intergenic
1192161820 X:68794124-68794146 GAGAGCTGGGCTCAGGCCTGGGG - Intergenic
1192522380 X:71814292-71814314 GTGTGCTGGGCCCCAGCCCGGGG + Intergenic
1194292431 X:92091487-92091509 GAGAGCTGTGTCACGGGCCATGG - Intronic
1200609938 Y:5316063-5316085 GAGAGCTGTGTCACGGGCCATGG - Intronic