ID: 1102438918

View in Genome Browser
Species Human (GRCh38)
Location 12:112946703-112946725
Sequence CAGGGGACTCAGAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 663
Summary {0: 1, 1: 0, 2: 6, 3: 64, 4: 592}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102438918_1102438930 15 Left 1102438918 12:112946703-112946725 CCTTCTTCCTTCTGAGTCCCCTG 0: 1
1: 0
2: 6
3: 64
4: 592
Right 1102438930 12:112946741-112946763 AGGTGTGCCTACAGGGGTTGTGG 0: 1
1: 0
2: 0
3: 16
4: 144
1102438918_1102438927 7 Left 1102438918 12:112946703-112946725 CCTTCTTCCTTCTGAGTCCCCTG 0: 1
1: 0
2: 6
3: 64
4: 592
Right 1102438927 12:112946733-112946755 CCTCTCACAGGTGTGCCTACAGG 0: 1
1: 0
2: 0
3: 10
4: 119
1102438918_1102438931 19 Left 1102438918 12:112946703-112946725 CCTTCTTCCTTCTGAGTCCCCTG 0: 1
1: 0
2: 6
3: 64
4: 592
Right 1102438931 12:112946745-112946767 GTGCCTACAGGGGTTGTGGAAGG 0: 1
1: 0
2: 2
3: 6
4: 170
1102438918_1102438922 -5 Left 1102438918 12:112946703-112946725 CCTTCTTCCTTCTGAGTCCCCTG 0: 1
1: 0
2: 6
3: 64
4: 592
Right 1102438922 12:112946721-112946743 CCCTGCCGATGCCCTCTCACAGG 0: 1
1: 0
2: 0
3: 7
4: 146
1102438918_1102438929 9 Left 1102438918 12:112946703-112946725 CCTTCTTCCTTCTGAGTCCCCTG 0: 1
1: 0
2: 6
3: 64
4: 592
Right 1102438929 12:112946735-112946757 TCTCACAGGTGTGCCTACAGGGG 0: 1
1: 0
2: 0
3: 5
4: 133
1102438918_1102438928 8 Left 1102438918 12:112946703-112946725 CCTTCTTCCTTCTGAGTCCCCTG 0: 1
1: 0
2: 6
3: 64
4: 592
Right 1102438928 12:112946734-112946756 CTCTCACAGGTGTGCCTACAGGG 0: 1
1: 0
2: 0
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102438918 Original CRISPR CAGGGGACTCAGAAGGAAGA AGG (reversed) Intronic
900745400 1:4357266-4357288 TAGGGGAGCCAGAAGGGAGATGG - Intergenic
900861040 1:5231581-5231603 CATAGGAAGCAGAAGGAAGAGGG + Intergenic
901160372 1:7172738-7172760 CACTGGACTCAGCAGAAAGAAGG + Intronic
901856626 1:12048529-12048551 CAGAGAACTTGGAAGGAAGAAGG - Intergenic
901902823 1:12380591-12380613 CAGGGGTCTGAGAAGTAGGAAGG + Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903183791 1:21618492-21618514 CAGGGGACTCAGCGAGATGAGGG - Intronic
903218951 1:21858277-21858299 CATGGGAATCAGAGGGAAAAGGG - Intronic
904419485 1:30382450-30382472 TCGGGGACTCGGAAGGAACAGGG - Intergenic
904883780 1:33720444-33720466 AAGGGGATTCAGAAGGATGAAGG + Intronic
907304890 1:53507935-53507957 CATGGGGCTCACATGGAAGACGG - Intronic
907391539 1:54161427-54161449 CAGGGGAGTCGGATGGAAGAGGG + Intronic
907403241 1:54238549-54238571 CAGGGGACACAGGAGGAAGTGGG + Intronic
908959377 1:69676936-69676958 CTGGAGACTCAGAAGGGAAAGGG - Intronic
909742288 1:79045379-79045401 TAGGGGAGCCAGAAGGGAGATGG + Intergenic
910257100 1:85259291-85259313 CAGGGGGCTCAGGAGAAAGGGGG + Intronic
910861008 1:91742309-91742331 CAAGGGATTCAGAATGAACAAGG - Intronic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
910952650 1:92667177-92667199 CAGGAGGCTCAGGGGGAAGACGG + Intronic
911456251 1:98127868-98127890 CAGGGGCCTCAGATTGCAGAAGG + Intergenic
911727845 1:101260987-101261009 CAAGGAAATCACAAGGAAGAAGG - Intergenic
912825754 1:112901639-112901661 CAGGGGACTCTAAAGGAGTAAGG + Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915100362 1:153494991-153495013 AAGGGCTCTCAGAAGGAAGGTGG - Intergenic
915128931 1:153683890-153683912 GTGGGGACCCAGAGGGAAGAGGG + Intronic
915719634 1:157975057-157975079 AAGGGGACTAAGAAGAAAGTGGG - Intergenic
915734446 1:158075909-158075931 CATGGGTCTCAGAGGGAGGAAGG + Intronic
915950015 1:160183467-160183489 CAGGGGAATCAGAGAAAAGAGGG - Intronic
916167689 1:161978368-161978390 CTGGGGATACAGAAGGCAGAGGG - Intergenic
916408766 1:164524293-164524315 CAGGAGGCTGAGATGGAAGAGGG - Intergenic
916935081 1:169619357-169619379 CAGGGCAATGAGAAGCAAGAAGG - Intronic
917562095 1:176168820-176168842 AAGGGAAGTCAGGAGGAAGAGGG + Intronic
918730869 1:187994501-187994523 CAGGGGCCTCAGAAGGACTTTGG + Intergenic
918809284 1:189094445-189094467 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
920492889 1:206431755-206431777 GAGGGGATGGAGAAGGAAGAGGG + Intronic
921728779 1:218553527-218553549 CAGGAGACTCAAAGGGAAGAGGG - Intergenic
922213579 1:223503272-223503294 CAGGTCCCTCAGGAGGAAGATGG + Intergenic
922353009 1:224750286-224750308 CATGGGAGACAGAAGGAAGAGGG - Intergenic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
922822322 1:228493140-228493162 CAGGAGGCTGAGAAGGAGGAGGG + Exonic
922876058 1:228940700-228940722 CAGGGGACCCAGTGGGACGAGGG - Intergenic
923079690 1:230641953-230641975 CTGGGAACTCATAGGGAAGAAGG - Intergenic
923080197 1:230646043-230646065 CAGGGTCCTGAGAAGGGAGAGGG - Intronic
923180558 1:231514568-231514590 CTGGGGACTCCAAAGGTAGAAGG - Intergenic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
924309370 1:242724188-242724210 TGGGGGACAGAGAAGGAAGAAGG - Intergenic
924946798 1:248851904-248851926 GAAGGGGCTCAGAGGGAAGATGG - Intronic
1062999871 10:1906324-1906346 CATGTGGCACAGAAGGAAGATGG + Intergenic
1062999885 10:1906425-1906447 CATGTGGCACAGAAGGAAGATGG + Intergenic
1063613255 10:7580924-7580946 CAAGGGCCTCTGAAGGAAAAAGG - Intronic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064276166 10:13907034-13907056 CAAGGGCCTGAGAAGGTAGAAGG - Intronic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1066412956 10:35191779-35191801 GAGGGAGCTCAGCAGGAAGAGGG - Intronic
1067514705 10:46928566-46928588 CTGGGGGCTCAGAGGGAAGCAGG - Intronic
1067647551 10:48123247-48123269 CTGGGGGCTCAGAGGGAAGCAGG + Intergenic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1069524320 10:69154197-69154219 CAGGGGATTCAGCAGGTAAATGG + Intronic
1069537354 10:69264716-69264738 CAGGGGATTCAGCAGGTAAATGG - Intronic
1069859435 10:71461293-71461315 CAGGGGACTCCGAGGGAGAAAGG - Intronic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070774332 10:79101012-79101034 CAGGAGCCTTTGAAGGAAGAGGG + Intronic
1071133595 10:82426197-82426219 CAGGGGTCTCAGAGTGAAGATGG - Intronic
1071605619 10:86985757-86985779 CAAGAGACTCAGAAGAAACAGGG - Intergenic
1072525669 10:96269510-96269532 CATGGCAGTGAGAAGGAAGAGGG - Intronic
1072555407 10:96511036-96511058 CTGTGGACTCAGAATGCAGAGGG - Intronic
1072817873 10:98527459-98527481 CAGGGGCCTTAGAAGGGAGAGGG - Intronic
1073044450 10:100628562-100628584 GAGGGGACTAGGAAGGCAGAGGG + Intergenic
1073496806 10:103899113-103899135 CTGGGCACTCACAAGGAAGGAGG - Intronic
1073787056 10:106901169-106901191 CAAGGGAGTCAGCAGGAACAGGG + Intronic
1074567699 10:114596204-114596226 CAGGGGAGTTAGAATGGAGATGG - Intronic
1075093709 10:119457608-119457630 CTGGGGACTCAGTAGGGAGAAGG - Intronic
1075301814 10:121331465-121331487 CAGAGGACTCAGTTGGGAGAAGG - Intergenic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075393733 10:122112570-122112592 CAGGAGCCTCAGAAAGAAGCTGG - Intronic
1075419963 10:122293449-122293471 CAGGGGACACACATTGAAGAGGG + Intronic
1075684462 10:124353997-124354019 CAAGGGACCCAGGAGGGAGATGG - Intergenic
1075705226 10:124496641-124496663 CAGGGGACCCAGAAGGCAGACGG - Intronic
1076356966 10:129860319-129860341 CAGGGGGCTTAACAGGAAGAGGG + Intronic
1076729400 10:132430977-132430999 CAGGGTCCCGAGAAGGAAGATGG + Intergenic
1077349629 11:2086450-2086472 CAGGGGACTCAGCAGGTGGACGG + Intergenic
1078110659 11:8389203-8389225 CAGGGGACACAGCTGTAAGAGGG + Intergenic
1078183319 11:9030455-9030477 CAGGGCACTGAGATGGAGGAGGG + Intronic
1078713981 11:13822001-13822023 CAGGGGAATCAGGCAGAAGAAGG - Intergenic
1079318142 11:19427338-19427360 AAAGGGAAGCAGAAGGAAGAAGG - Intronic
1079339094 11:19597437-19597459 CAGGGAAGTCAGTAGTAAGATGG - Intronic
1079341976 11:19618811-19618833 AAGTGGAGTAAGAAGGAAGATGG + Intronic
1079433681 11:20422860-20422882 CAGGGGACTCAGAAGAAGTAGGG + Intronic
1079659501 11:23021006-23021028 CAGACAACCCAGAAGGAAGAAGG - Intergenic
1079837248 11:25350345-25350367 CTGGGGGCTCACAAGGAAGGAGG + Intergenic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1080695745 11:34601593-34601615 CAAGGCACTCAGAGGGCAGAAGG - Intergenic
1081800050 11:45852298-45852320 GAGGGGACTCTGAAGGAAACTGG - Intronic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1082953508 11:58844014-58844036 CACATGACACAGAAGGAAGAAGG + Intronic
1082969909 11:59009274-59009296 CACATGACACAGAAGGAAGAAGG + Intronic
1082997537 11:59265660-59265682 CAGGGGACTCTGAAGGGACAAGG - Intergenic
1083603190 11:63961523-63961545 CTAGGGGCTCAGAAGGCAGAGGG + Intergenic
1083869352 11:65477456-65477478 CTGGGGACACGGCAGGAAGAAGG + Intergenic
1083962360 11:66021447-66021469 GTGGGGACTCCAAAGGAAGAGGG - Intronic
1084406464 11:68976803-68976825 GAGGGAACCCAGAAGGCAGAGGG + Intergenic
1084740527 11:71136475-71136497 CAGGAGACTCAGAAGGGTGGTGG + Intronic
1084830299 11:71763584-71763606 TGGGGGAGTCAGAAGGGAGATGG - Intergenic
1084894314 11:72254365-72254387 CAGAGGATTCAGTAGGAACATGG + Intergenic
1084937368 11:72594317-72594339 CAGAGGGTGCAGAAGGAAGATGG - Intronic
1085792183 11:79505715-79505737 CGGAGGACTGAGCAGGAAGATGG - Intergenic
1086033967 11:82394587-82394609 CAGGGTTCCCAGAAGAAAGATGG + Intergenic
1086309394 11:85519336-85519358 CAGGTCACTCTGAAGCAAGAAGG - Intronic
1086445602 11:86867546-86867568 CTAGGGTCTCAGAAGGAGGATGG - Intronic
1087461410 11:98453417-98453439 CGGGGGAGCAAGAAGGAAGATGG + Intergenic
1087850285 11:103019843-103019865 AAGGGGAGTGAGAAGGAAGAAGG + Intergenic
1088599632 11:111462984-111463006 AAGGGGAGTGAGAAGAAAGAAGG + Intergenic
1088687093 11:112293716-112293738 CATGGCACTCAGCTGGAAGAGGG - Intergenic
1088860210 11:113791699-113791721 CAGGGGCCTGAGAAGGTAGCGGG + Intergenic
1088910990 11:114192457-114192479 CAGGGGACTAAAGTGGAAGAAGG + Intronic
1089849363 11:121482953-121482975 CAGGAGACCAAGAAGGAAGTGGG - Intronic
1090136359 11:124203564-124203586 CTGGGGAGTCAGAAGAAAGGAGG + Intergenic
1090641637 11:128734335-128734357 CTGAGTACTCAGATGGAAGAAGG + Intronic
1091142232 11:133245042-133245064 CAGGGAAATCATGAGGAAGATGG - Intronic
1092279549 12:7089205-7089227 CAGGGGATCCAGGAGGAAGTTGG + Intronic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1094322101 12:29195858-29195880 ATGGGGACTCAGAAGGACGAGGG - Intronic
1095184613 12:39187047-39187069 CTGGGGACCCAGAAGGGAGATGG - Intergenic
1096001629 12:48135086-48135108 CAGGAGACTCAGAAGCCAGAAGG - Intronic
1096414430 12:51401379-51401401 TAGGGGAGCCAGAAGGGAGATGG + Intronic
1096532165 12:52249015-52249037 CAGGAGACTGAGAAGGCACATGG + Intronic
1096899283 12:54858063-54858085 CAGGGGATTCGAAAGGAACATGG - Intronic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1098179612 12:67832259-67832281 CAGGAGAGGCAGATGGAAGATGG + Intergenic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1099972658 12:89515926-89515948 CAGGGGAATTTGAAGGAAGGAGG - Intronic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102612303 12:114123035-114123057 CAGGGGTCACAGCTGGAAGAGGG + Intergenic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103185443 12:118953164-118953186 CAGAGGACTCAGAATAAGGAAGG + Intergenic
1103871235 12:124093761-124093783 CAGGGAAGGCAGCAGGAAGAGGG + Intronic
1104247907 12:127060864-127060886 CAGGAGAGTCAGAAAGGAGATGG - Intergenic
1104832505 12:131763298-131763320 CAGGTGACTGAGAGGGAAGTGGG - Intronic
1105387384 13:19943955-19943977 GAGGGGAATGAGAAGGGAGATGG + Intergenic
1106182961 13:27383879-27383901 CGGGGGAGCCAGAAGGGAGATGG - Intergenic
1107104719 13:36630753-36630775 AAGGGTACTCAGAAGAAATAGGG + Intergenic
1107859501 13:44647508-44647530 CAGCAAACTGAGAAGGAAGAGGG + Intergenic
1107963623 13:45579879-45579901 CAGGGCACTCTGAAGAAAGCAGG + Intronic
1108209533 13:48124405-48124427 CAGAGGAATCAGAAGAAAGGTGG - Intergenic
1108756605 13:53510552-53510574 CAGGGCACTGAGATGGAAGTGGG - Intergenic
1112591814 13:100770351-100770373 CAGGACTCCCAGAAGGAAGAGGG - Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112786126 13:102953510-102953532 CAGGGGACAGACACGGAAGATGG + Intergenic
1113843207 13:113371702-113371724 GAGGGGCCTCAGGAGGAAGGAGG - Intergenic
1113890373 13:113732254-113732276 CAGGGAAGTCAGAAGGGAGAGGG - Intronic
1114080407 14:19198457-19198479 GTGGGGCCTCAGGAGGAAGAGGG + Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114255935 14:21001389-21001411 GAGGGGACTCTGAAGGAGGGCGG + Exonic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1115178727 14:30596905-30596927 GAGGGTACTCAGAAGGAAACAGG - Intronic
1115530210 14:34320100-34320122 CAGAGGACTCAGGAGGAATCTGG + Intronic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1116385844 14:44328847-44328869 CAGGGGACTTGGAGGGGAGAGGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117831989 14:59760970-59760992 CAAGGGACTCAGAACTAGGAGGG - Intronic
1117902829 14:60552872-60552894 GATGGGACTCTGAAGGAGGATGG + Intergenic
1119543689 14:75456906-75456928 CTGGGGACTCAGGACCAAGAGGG - Intronic
1119950430 14:78738822-78738844 CAGGGAAATAAGAAGGCAGATGG + Intronic
1120129990 14:80795322-80795344 CAGATAACACAGAAGGAAGAGGG - Intronic
1121036082 14:90704734-90704756 AACAGGACTCAGAAGAAAGATGG + Intronic
1121105952 14:91279827-91279849 CAGGGGCCTGGGAAGGAAGGGGG + Intronic
1121847849 14:97189566-97189588 GAGAGGAATCAGAAGGAAAAGGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1121864843 14:97353209-97353231 CAGGGGACTCCGGTGGAAGGAGG - Intergenic
1122254883 14:100469246-100469268 CAGGAGACGCAGAGGGAAAATGG + Intronic
1122272991 14:100576655-100576677 CAGGGGACACAGATGGTACAGGG + Intronic
1122638026 14:103139229-103139251 CAGGAGACTCCGCAGGAGGAAGG + Intergenic
1123807810 15:23893186-23893208 CAGGAGACACAAAAGCAAGAAGG + Intergenic
1123830982 15:24136879-24136901 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123836064 15:24194254-24194276 CAGGGTATGCAGAAGGAACATGG + Intergenic
1124026010 15:25966516-25966538 CAGCGTGCTCAAAAGGAAGAGGG + Intergenic
1124117713 15:26862915-26862937 CTGGAGACTTAGAAGGGAGAAGG + Intronic
1124142418 15:27088858-27088880 TAGAGGACTCTGAAGGGAGACGG + Intronic
1124829374 15:33133138-33133160 CAGTTAACTCACAAGGAAGAGGG + Intronic
1125004631 15:34803389-34803411 CAGGGAACACAGAAAGTAGATGG - Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1127714545 15:61636719-61636741 TTGGGGACTCAGAAGGGAGGTGG + Intergenic
1128038415 15:64547593-64547615 CAGGTTACTCAGGAGGATGATGG + Intronic
1128227334 15:66011241-66011263 GAGGGGACTGAGAAGGAAGGTGG + Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128551965 15:68603693-68603715 CAGAGGACACAGCAAGAAGACGG + Intronic
1129224150 15:74156684-74156706 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
1130059306 15:80558199-80558221 CAAGGGACTTAGAAGGAGGCTGG - Intronic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1130868297 15:87950522-87950544 AAGGGGACTGAGAAAGAACATGG + Intronic
1130884461 15:88081641-88081663 CTGGGGGCTCAGAAGGAAGGGGG - Intronic
1132976535 16:2713893-2713915 CAGCAGACCCAGAAGGAAGAGGG - Intronic
1133354139 16:5123625-5123647 TGGGGGAGCCAGAAGGAAGATGG + Intergenic
1134195188 16:12154370-12154392 CAGGGGTGTCAGAGGGGAGAGGG - Intronic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136345980 16:29676328-29676350 TAGGGTACCCAGAAGGAAAAGGG + Intronic
1136505861 16:30702644-30702666 CATTGCACTCAGAAGGAAGGAGG - Intronic
1136692155 16:32039858-32039880 CAGGGGACTCAGAACCACTAGGG + Intergenic
1136792698 16:32983296-32983318 CAGGGGACTCAGAACCACTAGGG + Intergenic
1136877158 16:33870758-33870780 CAGGGGACTCAGAACCACTAGGG - Intergenic
1137649858 16:50110522-50110544 GAGCGGCTTCAGAAGGAAGAAGG + Intergenic
1138021111 16:53482367-53482389 AAGGGCACTCAGCAGGAAGCAGG + Intronic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138339863 16:56281569-56281591 AAGGGGACTGAGAAGGAGGGAGG - Intronic
1138451810 16:57097788-57097810 CAGGGGACTCCCATGGAGGAGGG - Intronic
1140665687 16:77225132-77225154 CAGGAGAGACAGAAGGAAAATGG - Intergenic
1141363600 16:83420911-83420933 CAGGGGAAAAAGAAGTAAGACGG + Intronic
1141495414 16:84406423-84406445 CAGGGGCCAGAGAATGAAGAAGG - Intronic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1141850661 16:86643268-86643290 AAGGGGTGGCAGAAGGAAGATGG - Intergenic
1142259031 16:89033792-89033814 AGGGGGACTCAGGAGGTAGAAGG + Intergenic
1203094908 16_KI270728v1_random:1244775-1244797 CAGGGGACTCAGAACCACTAGGG + Intergenic
1142572146 17:881969-881991 CAGGGGACTGTGCAGGGAGATGG + Intronic
1142713602 17:1736400-1736422 CAGGGGTCTCAGCAGGAGGCAGG + Intronic
1142956546 17:3526898-3526920 CGAGGGTCTCAGCAGGAAGATGG + Exonic
1143292360 17:5840961-5840983 TGGGGGAGTCAGAAGGCAGATGG + Intronic
1144390469 17:14788945-14788967 CAGGGGAGACAGAAGTGAGATGG - Intergenic
1145997770 17:29114414-29114436 GAGAGGATTCAGAAGGAAAATGG - Intronic
1146170911 17:30632376-30632398 CAGGGGCCTGAGAAGGTAGTGGG + Intergenic
1146344362 17:32048380-32048402 CAGGGGCCTGAGAAGGTAGTGGG + Intronic
1147319351 17:39636643-39636665 CAGGGGAAGCAGGAGGAAAAGGG + Intergenic
1147424389 17:40339100-40339122 CAAGGGCCTCAGCAGGAAGCAGG - Intronic
1147587525 17:41660881-41660903 CAGGGGATTCACCAGGAGGAGGG + Intergenic
1147892485 17:43727147-43727169 CTGGGGACTCAGAATCAAGGAGG - Intergenic
1148063281 17:44851070-44851092 CAGAGGCCACAGAAGGAAGCAGG + Exonic
1148137748 17:45305897-45305919 CAGTGGACACAGAAGCCAGATGG - Intronic
1148445401 17:47734150-47734172 CAGAGGACTCACAAGGGAGACGG + Intronic
1148598770 17:48878262-48878284 CAGAGCCCTCAGCAGGAAGAGGG + Intergenic
1149132174 17:53316122-53316144 CAGGGGAGTCAGAAGGGAGATGG + Intergenic
1149600270 17:57888928-57888950 CAGGGGAGGAAGAAAGAAGATGG + Intronic
1150018982 17:61591187-61591209 CAGGGAACGCGGAAGCAAGATGG + Exonic
1150217545 17:63478825-63478847 CAGGGGACTCAGAAGTGATCCGG + Intergenic
1150646089 17:66978392-66978414 GAGGGGACCCAGAGTGAAGATGG + Intronic
1151210994 17:72543593-72543615 CAGGGGACATGGAAGGGAGAGGG - Intergenic
1152158099 17:78648104-78648126 CTGTGGAGTCAGAAGGAAGCCGG + Intergenic
1152411331 17:80124832-80124854 CAGCTGCCTCACAAGGAAGAGGG + Intergenic
1152551652 17:81033375-81033397 CAGGGAACACAGCAGGAAGCTGG + Intergenic
1153785460 18:8529803-8529825 CAGAGCACTGAGAAGGAACACGG + Intergenic
1153816608 18:8795784-8795806 CAGGGGGCTCAGGAAGTAGAGGG + Intronic
1153857372 18:9163360-9163382 CAGAGAACTCAGAAATAAGATGG - Intronic
1154138898 18:11805513-11805535 CAGGAGACTCAAAAGGGTGAGGG - Intronic
1154145211 18:11861266-11861288 CAGGGACCCTAGAAGGAAGAAGG - Intronic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156035385 18:32760879-32760901 CAAGGGCATCAGAAGGAAGTGGG - Intronic
1156924849 18:42563856-42563878 CAGGAGACAGAGCAGGAAGAAGG + Intergenic
1157436232 18:47671802-47671824 GAGGGCACTCAGAATGAGGATGG + Intergenic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157555218 18:48609081-48609103 CTGTGGACTCTGAAGGTAGATGG - Intronic
1158447335 18:57532785-57532807 GAAGAGACTCAGAGGGAAGACGG - Intergenic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158857244 18:61554873-61554895 AAGGAAACCCAGAAGGAAGAGGG + Exonic
1160331623 18:77998081-77998103 GAGGCGACACAGAAGGAAGAAGG + Intergenic
1160416105 18:78712135-78712157 CGTGAGACTCAGCAGGAAGATGG + Intergenic
1160495453 18:79371738-79371760 CAGGGGACACAGAAGACAGCAGG - Intronic
1160501803 18:79405160-79405182 CAGGGGACTCAAAAGTGAGGAGG + Intronic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1160770668 19:829303-829325 GAAGGGACTCAGATGGAGGAGGG + Intronic
1161086868 19:2339493-2339515 CAGGCGGCTCAGCAGGAAGAGGG - Intronic
1161652459 19:5493589-5493611 CCGAGGACTCAGACAGAAGAGGG - Intergenic
1161719707 19:5896046-5896068 CAAGGCACACAGAAGGAAGGCGG + Intronic
1163056916 19:14726870-14726892 TGGAGGGCTCAGAAGGAAGAAGG - Intronic
1163272525 19:16262757-16262779 CTGGGGAGTCAGAAGTAGGATGG - Intergenic
1163501671 19:17680036-17680058 GAGGGGTCTCAGAGGGAAAAGGG + Intronic
1163669811 19:18620835-18620857 GAGGGGACATAGAAGGAAAAAGG - Exonic
1164441249 19:28282287-28282309 CAGGGGAGTCAGAAAGAAGATGG - Intergenic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
1165268859 19:34687401-34687423 CAGGTCTCTGAGAAGGAAGAAGG + Intergenic
1165776922 19:38410089-38410111 CAGGGGACCTGGAAGGAGGAAGG + Exonic
1166593916 19:44027602-44027624 CAGGGGCATCAGCAGGGAGAAGG - Intronic
1167511237 19:49896324-49896346 CAGGGGACTCTGAAGGAATGGGG - Intronic
1167628400 19:50607525-50607547 CAGGGGACTGAGAAAGAGGATGG - Intergenic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1168189347 19:54726557-54726579 CAGGGGACTGAAGAGGAAGATGG + Intronic
1168199630 19:54805293-54805315 CAGGGGACTGAAGGGGAAGATGG + Intronic
1168351426 19:55678340-55678362 CAGGGGCCCCAGCAGGAAGGAGG + Intronic
1168559096 19:57368530-57368552 CAGGGGACCCTGAAGGAAGAGGG - Exonic
1168578168 19:57531056-57531078 CATGGGAATCTGTAGGAAGAGGG - Exonic
925419699 2:3702493-3702515 CCGGGGCCTCAGGAGGCAGATGG - Exonic
925556294 2:5134620-5134642 CAGGGCCCTCAGCAGGAGGAGGG + Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
926104804 2:10143429-10143451 CAGGGCACTCAGCTGGAACAAGG - Intronic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
926740208 2:16104271-16104293 CAGGGGACTAAGAAAAAAGAAGG + Intergenic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
927147572 2:20176908-20176930 GAGGGGACTCAGAATGAAATGGG - Intergenic
927680185 2:25133770-25133792 CAGGGGACACAGAGGGGAAAAGG - Intronic
927758176 2:25725483-25725505 CAGTGGTCTCAGGAGGAGGAAGG - Intergenic
927858394 2:26541895-26541917 CAGCTGCCTCAGAAGGAAGGAGG - Intronic
929470748 2:42190263-42190285 GGGGGGACTCAGCAGGAGGAGGG - Intronic
929570913 2:43022318-43022340 CAGGGCAGTCAGAATGAAGGCGG + Intergenic
930265980 2:49199542-49199564 CAGGGGACACAGAGGGACAATGG - Intergenic
930681780 2:54264487-54264509 CAGGGAGCTTAGAATGAAGAAGG + Intronic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
931217457 2:60260003-60260025 CAGGAGACCCAGGAGGAAGCTGG - Intergenic
931973461 2:67616174-67616196 CTGGGAACTCAGAAGGAACTAGG + Intergenic
933249784 2:80016355-80016377 CAGGCTGCTCAGAAGGAAGGAGG + Intronic
933252065 2:80039577-80039599 CACTGGAGTCAGACGGAAGATGG - Intronic
933315222 2:80706815-80706837 CGGGGGAGCCAGAAGGAAGATGG - Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934513139 2:94964348-94964370 CAGGGGACACAGAATCACGATGG - Intergenic
935081085 2:99795373-99795395 CTGGGGACTCAGAAGGGCAATGG + Intronic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
937820760 2:126308084-126308106 CGGGGGAGCCAGAAGGGAGATGG + Intergenic
938070845 2:128307395-128307417 CATGTGACTCAGCTGGAAGATGG + Intronic
938321827 2:130371224-130371246 CTGGGGAGTCCGGAGGAAGAGGG - Exonic
938952441 2:136267350-136267372 GAAGGTACTCAGAAGGAAAAAGG - Intergenic
938969814 2:136421793-136421815 CAGGGAAGTCAGAGGGAAAAAGG - Intergenic
938970219 2:136424707-136424729 CAGGGGAGGCAGCAGGACGAAGG + Intergenic
939512000 2:143118634-143118656 CAGGGGACTAGGATAGAAGATGG - Intronic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
940255531 2:151724301-151724323 CAGGGGCATCAGGAGGAAGCAGG + Exonic
940347281 2:152640775-152640797 AAGGAGACTGAGAAGAAAGAAGG - Exonic
940600503 2:155853191-155853213 CAGCGGACTCAAAAAGAAAAGGG + Intergenic
940667852 2:156630976-156630998 CAGGGCAGTCAGGAGGCAGACGG + Intergenic
941062730 2:160866129-160866151 CAAGGGACTCAGAAACAAGGAGG + Intergenic
941920228 2:170842698-170842720 CAGGGGCCTCCCAAGGAAAATGG + Intronic
941974398 2:171386998-171387020 TTGGGGAGTCAGAAGGGAGATGG - Intronic
942320687 2:174733063-174733085 CATGGAACCCAGAGGGAAGACGG - Intergenic
942322772 2:174750422-174750444 CATGGGACACAGGAAGAAGATGG + Intronic
942538211 2:176988023-176988045 CAGGGGATGCAGAAGAGAGAAGG - Intergenic
944082401 2:195802859-195802881 GAGGAGACTCAGAAGGGTGAAGG - Intronic
944137441 2:196414662-196414684 CAGGGGCCTCAGAGGCCAGATGG - Intronic
944751877 2:202717666-202717688 CAGGGGGCTCAGAACAGAGAAGG - Intronic
945359738 2:208882916-208882938 GATGTGACTCAGAAGGAAAAAGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946056091 2:216903187-216903209 CAGAGGACTCAGAAGAAGGCAGG - Intergenic
946152421 2:217785504-217785526 CCGGGGACACAGGAGGCAGAGGG - Intergenic
946154317 2:217797237-217797259 CAGGGGACTCAGCAGTGAGGTGG - Intergenic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
946482887 2:220073811-220073833 AAGGGGAGGCAGAAGGAAAATGG + Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947073258 2:226315025-226315047 CCTGAGACCCAGAAGGAAGAAGG - Intergenic
947830773 2:233139996-233140018 CTGAGGGCTCAGGAGGAAGAGGG + Intronic
947855259 2:233319637-233319659 CAGGGCACCCAGGAGGAAGGTGG - Intronic
1168795695 20:609133-609155 CAGGAGACTGAGAAGAAAGGAGG - Intronic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169301039 20:4442334-4442356 CTGGGGACTCCAAAAGAAGAGGG + Intergenic
1169373018 20:5043179-5043201 CTGGGGAGCCAGAAGGAAGCTGG - Intergenic
1169498915 20:6140804-6140826 AAGGGGACTAAGCAGCAAGAGGG + Intergenic
1169697284 20:8404510-8404532 CAGGGGAGAAAAAAGGAAGAAGG - Intronic
1170260543 20:14401650-14401672 CAGGGGACTTACAAAGAAAAAGG - Intronic
1171370999 20:24661780-24661802 CAGGAGCGTCAGAAGGAAGCAGG + Intronic
1171399480 20:24862867-24862889 CAGGCTACTCAGCAGGCAGAGGG + Intergenic
1171401122 20:24873537-24873559 CAGGGGTGTCAGGAGGAAGTAGG - Intergenic
1171416609 20:24985798-24985820 GTGAGGTCTCAGAAGGAAGAGGG + Intronic
1171801444 20:29623493-29623515 CAGGGCAATCAGAAAGGAGAAGG + Intergenic
1172162020 20:32875403-32875425 CAGGGGGCACAGAAGGGAGATGG - Intronic
1172768684 20:37364441-37364463 CAGGGGCCCCACAAGGAGGAGGG - Intronic
1173522404 20:43709784-43709806 CGGGGGAAACAGAAGGGAGAGGG - Intronic
1173607977 20:44345461-44345483 GAGGGCACTTAGAATGAAGAAGG - Intronic
1173866683 20:46317004-46317026 CAGGAGTCTCAAAAGGAAGATGG + Intergenic
1174367835 20:50067118-50067140 CACAGGACTCAGAAGTGAGAGGG - Intergenic
1174531627 20:51219146-51219168 CTGGGGACTCAGAAGTAACCTGG - Intergenic
1174627569 20:51928013-51928035 CAGGGGAATTAGAAGTAAGGAGG + Intergenic
1175140752 20:56859001-56859023 CAGGTCCCTCTGAAGGAAGAGGG - Intergenic
1175527423 20:59645026-59645048 CAGGGGACTCCGAAAGAGAAAGG - Intronic
1176079680 20:63266006-63266028 CTGGGGTCTCAGGATGAAGACGG + Intronic
1177264469 21:18765040-18765062 TGGGGGAGCCAGAAGGAAGATGG - Intergenic
1178737686 21:35167488-35167510 CAGGGAACTGAGAAAGTAGAGGG + Intronic
1179031125 21:37720490-37720512 CAGGGGACCTTGAAGGAGGAGGG + Intronic
1179425217 21:41272403-41272425 CAGAGTACTCAAAAGGAAGAAGG - Intronic
1179937159 21:44613083-44613105 CAGGGGACCCAGCAGGCAGGTGG - Intronic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1180500369 22:15924227-15924249 GTGGGGCCTCAGGAGGAAGAGGG - Intergenic
1180790273 22:18572057-18572079 AAAGGGGCTCAGAAGGAAGGGGG - Intergenic
1181231465 22:21423258-21423280 AAAGGGGCTCAGAAGGAAGGGGG + Intronic
1181247186 22:21511610-21511632 AAAGGGGCTCAGAAGGAAGGGGG - Intergenic
1181759894 22:25051077-25051099 CAGGGGCCTCAGAGGCCAGAAGG - Intronic
1182016664 22:27046084-27046106 GAGTGGCCTCAGAAGGAAGGAGG - Intergenic
1182626182 22:31648221-31648243 CAGGGGACGCAGCAGGAACATGG + Intronic
1182943584 22:34301210-34301232 GAGAGAACTCAGAGGGAAGAAGG + Intergenic
1183063771 22:35350224-35350246 CAGGGGAGCCAGGAGGGAGAGGG - Intergenic
1183375013 22:37458252-37458274 CAGGGGGCTGGGGAGGAAGATGG + Intergenic
1183569033 22:38638274-38638296 CAGAGGACTGAGCAGGAAGTGGG + Intronic
1184403534 22:44287255-44287277 CAGTGGCCTCTGTAGGAAGATGG + Intronic
1184606427 22:45577181-45577203 GAGGGGACTCAGATGGGAGTTGG - Intronic
1184610342 22:45599273-45599295 CAGGGCAGTCAAAAGGAGGATGG - Intronic
1184804185 22:46781818-46781840 CGGGGCTCTCAGATGGAAGAGGG - Intronic
1184834823 22:47014913-47014935 CAGGCAGCTCAGAAGGGAGAGGG - Intronic
1184969215 22:48003221-48003243 CAGGGGACCTGGAAGGAAGGTGG + Intergenic
1185274341 22:49943885-49943907 CACGCTACCCAGAAGGAAGAAGG + Intergenic
1185281107 22:49970267-49970289 CAGGGGTCTCAGAAGCACAAGGG + Intergenic
949918923 3:8986247-8986269 CTGGGGGCTCAGAGGGATGAGGG - Intronic
950090382 3:10290531-10290553 CAGGGCACTCAGCAGGGAGGGGG + Intronic
950141682 3:10620298-10620320 CTGGGAACTCTGGAGGAAGACGG + Intronic
951197132 3:19836642-19836664 CAGAGCACTGAGAAGGAACATGG + Intergenic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
954460176 3:50622026-50622048 CCTGGGAACCAGAAGGAAGATGG - Intronic
954966350 3:54614586-54614608 CTGGGGAATGAGAAGGAAGGAGG - Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
955612810 3:60775687-60775709 GAGAAGACTCAGAAGGGAGAGGG - Intronic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
956749326 3:72333714-72333736 CAGGGGACTCCAAAGGAGGAGGG + Intergenic
956914908 3:73860750-73860772 TGGAGGACTCAGAAAGAAGAAGG + Intergenic
957058050 3:75459313-75459335 TGGGGGAGCCAGAAGGAAGATGG + Intergenic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
957959244 3:87227710-87227732 GAGGTGAGTCAGAAGCAAGAGGG - Intronic
960023949 3:112987816-112987838 TAGGGGAGCCAGAAGGGAGATGG + Intergenic
960569565 3:119172558-119172580 CAGGAAACTCTGGAGGAAGATGG - Intronic
960639478 3:119812336-119812358 CAGGAGACTCAGAAGGTTTAGGG - Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961295403 3:125880402-125880424 TGGGGGAGCCAGAAGGAAGATGG - Intergenic
961377820 3:126478519-126478541 AAGGGGACTGAGAAAGAAAAAGG + Intergenic
961643871 3:128382066-128382088 CAGGAGACTCAGAGAGGAGAGGG - Intronic
961747877 3:129077143-129077165 GAGAGGAATGAGAAGGAAGAGGG - Intergenic
961902349 3:130225291-130225313 CAGGGGACTCTGAAAGGGGAGGG - Intergenic
962449930 3:135504584-135504606 GAGGGAACTCAGGAGGGAGAGGG - Intergenic
963384912 3:144580469-144580491 GAAGTGACTGAGAAGGAAGATGG + Intergenic
964689399 3:159433075-159433097 CAGCGCACTTGGAAGGAAGAAGG + Intronic
964762000 3:160143026-160143048 CAGGGGCTGGAGAAGGAAGAGGG + Intergenic
965255771 3:166408823-166408845 CAGGTGACTCAGAAGGTTGCTGG - Intergenic
965342391 3:167506147-167506169 GAAGGGAGGCAGAAGGAAGAGGG - Intronic
966319891 3:178690516-178690538 GAGGAGAATGAGAAGGAAGAAGG + Intronic
966580879 3:181561458-181561480 CTGGGAACTCAGAAGTAATAAGG + Intergenic
966834533 3:184038806-184038828 CAGGGGGCTCAGAATGGACAAGG + Exonic
966843326 3:184106524-184106546 CAGGGGGCTCAGAATGGACAAGG + Exonic
967131930 3:186478541-186478563 CAGGGGTTTCAGAAGGAGGTTGG - Intergenic
967674561 3:192281194-192281216 TAGAGGATTCAGAGGGAAGATGG - Intronic
968071894 3:195789315-195789337 CAGGGGGCCCAGAAGGACAATGG - Exonic
968358484 3:198128001-198128023 AAGGAGATTCAGCAGGAAGATGG - Intergenic
968442301 4:630077-630099 CAGGGGACACAGAACCCAGAGGG + Intronic
968869587 4:3234925-3234947 CAGGGCACTCAGGAAGTAGAGGG + Intronic
969365900 4:6694167-6694189 CAAGGGGCTCAGAGGCAAGAGGG + Intronic
969629933 4:8330117-8330139 CAGGGGACTGAGAGGGAAGTGGG + Intergenic
970234486 4:13944768-13944790 TGGGGGAGTCAGAAGGAAGATGG + Intergenic
970606205 4:17684363-17684385 TAGGGAACTCAGCAGGAAGAAGG + Intronic
970955393 4:21805063-21805085 CAGAGGGCTGAGAAGGCAGAAGG + Intronic
971370814 4:26017362-26017384 GAGGGGCCTCCCAAGGAAGAGGG - Intergenic
971495607 4:27261232-27261254 CAGGGGAATCAGAAGAATAATGG + Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
972349721 4:38225531-38225553 CAGGGGACCCAGAAGGCAGAAGG - Intergenic
972368071 4:38394500-38394522 CAGGGGACAAAGAAGGAAAGGGG + Intergenic
972449521 4:39182645-39182667 CAACGAACTCAGAAGGGAGAGGG - Intronic
973871685 4:55172787-55172809 CAGGGGCCGCAGCAGGGAGAAGG - Intergenic
974168456 4:58235044-58235066 CAGGTCAGTCAGAAGGGAGAAGG - Intergenic
975323600 4:73035915-73035937 CAGAGGACACACAGGGAAGAAGG - Intergenic
977342888 4:95782264-95782286 CAGAGGAGTGAGAAGAAAGATGG - Intergenic
977756949 4:100682782-100682804 CAGGGGAGCCAGAAGGGAGATGG - Intronic
978718931 4:111882179-111882201 CATCAGAGTCAGAAGGAAGAGGG + Intergenic
979742136 4:124165338-124165360 TAGGGGAGAGAGAAGGAAGAGGG - Intergenic
980808033 4:137838278-137838300 CTGGGGACTAAGAAGCCAGATGG - Intergenic
980979670 4:139643473-139643495 CAGGGTGCTGAGGAGGAAGAAGG - Intergenic
981562525 4:146063438-146063460 CAGGGGACTCAGTGGGGAGATGG + Intergenic
981669437 4:147270465-147270487 TTGGGGACTAAGAGGGAAGAGGG - Intergenic
981716633 4:147758595-147758617 CAGGGGACAAAGAATGGAGAAGG - Intronic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
982004235 4:151049249-151049271 TAGGAGAGCCAGAAGGAAGATGG + Intergenic
982054998 4:151539675-151539697 CAGGGCACTCAGCAGGGAGTGGG - Intronic
982078570 4:151763593-151763615 CAAGGAACTCAGAAGGTAGCTGG + Intergenic
983898523 4:173107108-173107130 TAGGAGACTCAGGAAGAAGAAGG + Intergenic
983998429 4:174213511-174213533 CAGGGGGCTCAGTTGGAAGGTGG + Intergenic
984261249 4:177445337-177445359 CGGGGGAACCAGAAGGGAGACGG - Intergenic
984637885 4:182133019-182133041 CAGGCGAGTCAGGAGGAGGAGGG + Intergenic
985096406 4:186416933-186416955 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
985440057 4:189976301-189976323 AAGGAGATTCAGCAGGAAGATGG + Intergenic
985652281 5:1112560-1112582 GAGGGGGCGCAGAAGGAGGAGGG - Intergenic
986127789 5:4899432-4899454 CAGGGAAGTCAGAAGGACCAGGG - Intergenic
986684005 5:10259937-10259959 CAGGTGACTGAGGAGCAAGAAGG + Intronic
987130002 5:14851345-14851367 TTCGGGGCTCAGAAGGAAGATGG + Intronic
987141727 5:14953375-14953397 GAGGGGACTCAGGAGAAAGAGGG + Intergenic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
989090156 5:37722048-37722070 CAGGAAGCTCTGAAGGAAGATGG - Intronic
989112745 5:37922969-37922991 CTGAGAACTCAGAAGGAAGAAGG - Intergenic
989981707 5:50653760-50653782 CAAGAGAATCAGGAGGAAGAGGG - Intergenic
990288915 5:54329041-54329063 GAAGAGACACAGAAGGAAGATGG - Intergenic
992159845 5:73990646-73990668 GAGGGGAGTCAGCAGGGAGAAGG - Intergenic
993691281 5:91003830-91003852 CGGTGGACTCAGATGTAAGAAGG + Intronic
994311923 5:98282953-98282975 TAGGAAACACAGAAGGAAGAAGG - Intergenic
994633412 5:102314004-102314026 AAGGGAACTCAGAGGGGAGAGGG + Intergenic
995184636 5:109259119-109259141 TAGAGGAGTGAGAAGGAAGAGGG + Intergenic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
996012687 5:118498762-118498784 CAGGGCAATCAGACGGGAGAAGG - Intergenic
996486598 5:124042268-124042290 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
996489796 5:124080306-124080328 CATGGGATTCTGAAGAAAGAAGG - Intergenic
996996136 5:129698862-129698884 CAGGGGACTCCAAAGCAAAATGG + Intronic
998172696 5:139881851-139881873 CTGGGGCTTCAGAAAGAAGAGGG - Intronic
999823620 5:155253233-155253255 CAGGGGACTCAGCAGTGACAAGG - Intergenic
999968823 5:156838378-156838400 CAGAGGAATCTGAAGGAAGGCGG + Intergenic
1000112343 5:158120931-158120953 AAGGTGACTCAGAAGGAATAGGG + Intergenic
1000881075 5:166698254-166698276 TAGGGGACTCAGACATAAGATGG - Intergenic
1001181151 5:169521886-169521908 TAGGGGAGCCAGAAGGGAGATGG - Intergenic
1001217008 5:169865647-169865669 CAGGGGTCTCAGAAGGCCCAAGG + Intronic
1001293359 5:170481914-170481936 ACGGGGGCTCAGAAGCAAGAAGG - Intronic
1001455097 5:171854231-171854253 TAGGGAAGTGAGAAGGAAGAGGG - Intergenic
1001461820 5:171922521-171922543 AAGGCAATTCAGAAGGAAGAAGG + Intronic
1001952788 5:175827864-175827886 CAGGGCACGCAGGAGGCAGATGG - Intronic
1002761507 6:205988-206010 CAGGTGACTCAGCAGGAGGCTGG - Intergenic
1003762762 6:9198908-9198930 CTGGTGACTCAGCAAGAAGAGGG - Intergenic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004475602 6:15968322-15968344 CTGGGGCTGCAGAAGGAAGATGG + Intergenic
1005205542 6:23399293-23399315 CTGGGGACTCAGGAGGGAAAGGG - Intergenic
1005821519 6:29603465-29603487 CAGGGGACTCAGGAAGCAGGGGG - Exonic
1005926783 6:30451506-30451528 CAGGAGGCTCTGAAGGAAGAGGG + Intergenic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006152756 6:31998079-31998101 CAAGAGACACAGAATGAAGAAGG - Intronic
1006159064 6:32030816-32030838 CAAGAGACACAGAATGAAGAAGG - Intronic
1006285473 6:33090556-33090578 CAGGAGATTCAGAACGAAAAGGG + Intergenic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1006670384 6:35726639-35726661 ATAGGGACTCAGAAGAAAGAAGG - Intronic
1006703663 6:35997894-35997916 CAGAGCACTCACCAGGAAGAAGG + Exonic
1006972517 6:38061291-38061313 AAGGGTAATCAGAAGGAAAAAGG - Intronic
1007068660 6:39018625-39018647 CAGATGACTCAGGAGGAAGATGG - Intronic
1007781920 6:44259278-44259300 CAAGGGACTGAGAAGGAGAATGG + Exonic
1008300965 6:49838818-49838840 AAGGGGACTCACAAGCAAGAGGG + Intronic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1009705030 6:67239032-67239054 CAGGGGACTCAGAGGGGACAGGG - Intergenic
1009714916 6:67378945-67378967 AAGGGGAAACAGAAGGAAAAGGG - Intergenic
1010022064 6:71171872-71171894 CAAGGCAAGCAGAAGGAAGAAGG - Intergenic
1010402252 6:75459492-75459514 GAAGGGACTGAGAAGGAAGGAGG - Intronic
1011639594 6:89406587-89406609 TAGGGGAGCCAGAAGGGAGACGG - Intronic
1012072434 6:94639908-94639930 TGGGGGAGCCAGAAGGAAGATGG - Intergenic
1013380629 6:109566704-109566726 CTGGAGACTCAGAAGGGAGCAGG + Intronic
1014813820 6:125913314-125913336 CAGAGGTCTCTTAAGGAAGAAGG - Intronic
1015006551 6:128288958-128288980 CATGGGATTCAGATGGAAAATGG - Intronic
1015197355 6:130537755-130537777 CAGAGAACTGAGAAGGAACATGG + Intergenic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1015352668 6:132241194-132241216 CAGGGGCCTCAGTTGGAAGACGG + Intergenic
1015552168 6:134423056-134423078 TAGGGAACTCAGATGGAAGTGGG + Intergenic
1016098362 6:140065999-140066021 CAGGTAACTCAGAAAAAAGAAGG + Intergenic
1016110328 6:140215564-140215586 ATGGAGACTCAGAAGTAAGAGGG - Intergenic
1016668639 6:146674199-146674221 GAGGGGAGTAAGAAGGAAGTGGG + Intronic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017646075 6:156541029-156541051 GAGGGAATTCAGAGGGAAGAGGG + Intergenic
1018246812 6:161831800-161831822 GAGAGGAGGCAGAAGGAAGAGGG + Intronic
1018545888 6:164934781-164934803 CAGGCGCCTCAGCAGGATGAGGG + Intergenic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018851848 6:167646118-167646140 CAGGTGACTAAGAAAGAAGGGGG + Intergenic
1019558349 7:1643576-1643598 CTGGGGACTCAGAGGGAATGGGG + Intergenic
1020241196 7:6396419-6396441 CTGGGGACGAAGAAGGAACAAGG + Intronic
1021274725 7:18636265-18636287 CAGGGGACACAGCAGTAAGAGGG - Intronic
1022525973 7:31037564-31037586 CAGGGTGCTCAGAAGAGAGATGG - Intergenic
1022528643 7:31053477-31053499 TAGGGGGCTCAGAAGGGACAGGG + Intronic
1023842030 7:44103517-44103539 CAGAGGACCCAGAAGGCAGGTGG - Intergenic
1024863499 7:53874939-53874961 CTGGGGACTCAGAGGCAGGAAGG + Intergenic
1026070995 7:67119483-67119505 CCGAAGACTCAGAAGGGAGAAGG - Intronic
1026842682 7:73679243-73679265 CCGGAACCTCAGAAGGAAGAGGG + Intergenic
1027225552 7:76241401-76241423 CAGGGGTCTCAGATGGAAAAGGG + Intronic
1027689820 7:81330386-81330408 CAAGGGATCCAGAAGGAAAAAGG - Intergenic
1027694494 7:81392590-81392612 TAGGGGCCCCAGAAGGAATAGGG + Intergenic
1028417330 7:90595195-90595217 CAGGGGAGAGAGAAGGAAGGTGG - Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1029350517 7:100009993-100010015 CAGGGGACTGAGTAGTAAGCAGG + Intergenic
1029552929 7:101247571-101247593 CAGGGGACACAGGAAGATGAAGG + Intronic
1030011464 7:105172355-105172377 CAGGGGAGTAGGAAGGAAGAAGG + Intronic
1030626719 7:111853113-111853135 CACGGGACTAGGAAGGAACAAGG + Intronic
1031655792 7:124353210-124353232 CAGCTGACTTAGTAGGAAGAAGG + Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031792578 7:126126617-126126639 TAGGGTAATCAGAAGTAAGATGG + Intergenic
1031978530 7:128108824-128108846 CATGGGACTCAGTAGCAGGAAGG + Intergenic
1032507831 7:132449414-132449436 AAGTGGACTCAGAAGGCAGGAGG + Intronic
1032543166 7:132721148-132721170 CTGGTGATTCAGAAGGAAGCAGG - Intronic
1032653160 7:133900674-133900696 CAGGGGACAGGGAAGGAAAATGG + Intronic
1032794660 7:135268190-135268212 CAGTGGACCCAGGAGGAAGGAGG - Intergenic
1033969604 7:147023751-147023773 CAGGTGACTCAGAAGGCAACTGG - Intronic
1034280526 7:149850808-149850830 CAGGTGGATCAGAAGGAGGAAGG + Intronic
1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG + Intergenic
1034535041 7:151721079-151721101 GAGGGGACACAGAGGGCAGAGGG + Intronic
1034827067 7:154275292-154275314 GAGGGGACACAGAGGGAAGGAGG - Intronic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035814612 8:2526125-2526147 CAGGGATCTCAGAAGGATGAAGG + Intergenic
1035954901 8:4066224-4066246 CAGGAGACAAAGAAGGAAGGAGG - Intronic
1036385946 8:8281719-8281741 TAGGGTACTCAAAAGGGAGAAGG - Intergenic
1036415568 8:8544602-8544624 CACTGGAATCAGAAGGAACAGGG - Intergenic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1037144203 8:15553808-15553830 CAGGTGACTGAGAAGGTAGGAGG + Intronic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1037501434 8:19489456-19489478 GATTGGCCTCAGAAGGAAGAAGG - Intronic
1037835131 8:22211148-22211170 CAGTGGACTCTTAGGGAAGACGG - Intronic
1038092757 8:24272359-24272381 CAGTGTAGTCAGAAGGAAGGTGG - Intergenic
1039007842 8:33060490-33060512 CAGGGAACTCTGAAGCAGGACGG - Intergenic
1039291082 8:36095126-36095148 AGGGGGACTCAGGAGGAGGAAGG + Intergenic
1039438947 8:37581394-37581416 CTGGGGGCACAGAAGGAACATGG - Intergenic
1039588658 8:38728607-38728629 CAGGTGGCGCAGAAGGGAGAGGG + Intronic
1040690960 8:49937872-49937894 AAAGGAACTCAGAAGGAGGAGGG - Intronic
1041304363 8:56445459-56445481 CTGGGCTGTCAGAAGGAAGATGG - Intronic
1041513791 8:58677595-58677617 TAGTGGCCTCAAAAGGAAGAGGG + Intergenic
1041648489 8:60277885-60277907 AAGGGGAATCTGAAGGAGGAAGG + Intronic
1042478253 8:69274589-69274611 CAAGGGACCCAAAAGGAAGCTGG + Intergenic
1042672073 8:71275325-71275347 TACGGGACTTAGGAGGAAGAAGG + Intronic
1042765416 8:72315850-72315872 CAGGAGACAGAGAGGGAAGAGGG + Intergenic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1044627190 8:94245578-94245600 GAGGGGACACAGAGGGAAGAAGG - Intergenic
1044890942 8:96835021-96835043 GAAGGGCCTCAGAAGCAAGAGGG + Exonic
1045938499 8:107710982-107711004 TGGGGGAGTCAGAAGGGAGATGG + Intergenic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047228763 8:122978350-122978372 CAGGGGACTGAGAAAGAATGAGG - Intergenic
1047948934 8:129911799-129911821 CAGGAGATCCAGAAGTAAGAAGG - Intronic
1048484793 8:134836961-134836983 TAATGGACTCAGAAGCAAGAGGG - Intergenic
1048672302 8:136736758-136736780 CAGGTGAGTCAGAAGGCAGAGGG + Intergenic
1048879166 8:138859016-138859038 CTGGGGACCGAGAAGGGAGATGG - Intronic
1048968304 8:139629728-139629750 CTGGGGACACAGCAGGAAGGTGG - Intronic
1049332458 8:142062214-142062236 CAGGGAACTGGGAATGAAGAAGG - Intergenic
1049978858 9:885408-885430 TAGGGGAGTCAGAAAGGAGATGG + Intronic
1050479300 9:6073393-6073415 TCGGGGAGTCAGAAGGGAGACGG - Intergenic
1053166272 9:35846244-35846266 CCAGGGACTCTGAAGGGAGAAGG - Exonic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1054826744 9:69581027-69581049 CAGGGGACACAGATCAAAGATGG + Intronic
1054898289 9:70338717-70338739 CAATGGACTCAGAATGAAAAAGG - Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055379702 9:75692782-75692804 CAGGGAATACAGAAAGAAGATGG - Intergenic
1055855914 9:80688208-80688230 CATGGGACTCACAAAAAAGATGG - Intergenic
1056390000 9:86132126-86132148 AGGGGGACTCCTAAGGAAGAAGG - Intergenic
1056468147 9:86879126-86879148 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
1057267602 9:93629639-93629661 CAGGGGGCAGGGAAGGAAGAGGG - Intronic
1057318245 9:93986441-93986463 CAGGGGACTCAGGATGATTAAGG - Intergenic
1057439170 9:95070109-95070131 CATGGGACTGAGCAGGTAGACGG + Intronic
1058923954 9:109643513-109643535 CAGGAGACTCAGAGGGAATGTGG - Intronic
1059051174 9:110927025-110927047 CAGGTGACTCAGATGCAAGGTGG + Intronic
1059373330 9:113861649-113861671 CAGAGAACTCAGCAGGAGGATGG - Intergenic
1059786444 9:117591402-117591424 CAGGGCCCTGAGAAGGAAAATGG - Intergenic
1060204602 9:121675112-121675134 TTGGCGACTCAGCAGGAAGATGG - Intronic
1060341532 9:122781545-122781567 TAGAGGACTCAGAAGCAAGGTGG + Intergenic
1060494164 9:124105718-124105740 AAGGGGACACAGAGGGAAGGAGG - Intergenic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061587182 9:131576683-131576705 CAGGGGTCTCAGAAAAGAGATGG + Intergenic
1061898025 9:133658603-133658625 CAGGGGACCCTGGGGGAAGAAGG - Exonic
1062277762 9:135738820-135738842 CAGGGGAGTGAGAAGGAAGGAGG - Intronic
1062604780 9:137341789-137341811 CAGGGGAGTCAGAGGAAACAGGG + Intronic
1062604796 9:137341849-137341871 CAGGGGAGTCAGAGGAAACAGGG + Intronic
1062604808 9:137341895-137341917 CAGGGGAGTCAGAGGAAACAGGG + Intronic
1062604909 9:137342295-137342317 CAGGGGAGTCAGAGGAAACAGGG + Intronic
1062604921 9:137342341-137342363 CAGGGGAGTCAGAGGAAACAGGG + Intronic
1187274891 X:17808569-17808591 CTGGGAAGTAAGAAGGAAGATGG - Intronic
1188080246 X:25829784-25829806 AAGTGGATTCAAAAGGAAGACGG - Intergenic
1190708076 X:53047521-53047543 CAGGGGATTCAGATGCAAGTGGG + Intergenic
1191585646 X:62823730-62823752 CAGGGAAGTCAGGAAGAAGAAGG + Intergenic
1191738831 X:64416386-64416408 CAGAGCATTCAGAAGGAACATGG - Intergenic
1191764488 X:64682365-64682387 CAGGGGACACAGGAGGAAGGGGG + Intergenic
1191875182 X:65788348-65788370 CAGCTGACTCAGAAGCAAGACGG + Intergenic
1192212488 X:69136817-69136839 TAGGGCACCCAGAAGGAAGCAGG + Intergenic
1192591563 X:72364235-72364257 AAGGAGACTGAGAAGGAACAGGG - Intronic
1192942101 X:75923282-75923304 CAGGGCAATCAGGAAGAAGAAGG + Intergenic
1195367292 X:104138711-104138733 CGGGGGAACCAGAAGGGAGATGG + Intronic
1195619589 X:106939637-106939659 GAGGGGACTGAGTAGGAAGGAGG - Intronic
1196002067 X:110796327-110796349 CAGGGGAGTCAGAGGGTAGTCGG - Intergenic
1196287132 X:113896097-113896119 CAGGGGACTCAGTAGAAGAAGGG - Intergenic
1197411413 X:126120739-126120761 CAAGTGACTCAGGAGAAAGAGGG - Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1198064209 X:133080258-133080280 CAGGAGAATCAGAAGAAAGAAGG + Intronic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198423857 X:136496277-136496299 CAGGGGAGACAGAATTAAGATGG - Intergenic
1199142628 X:144331436-144331458 CGGGGGAGCCAGAAGGGAGATGG + Intergenic
1199489252 X:148380490-148380512 CAGGGGAGTCAGCACCAAGAAGG + Intergenic
1200128398 X:153828969-153828991 CCGGGAACTGAGAGGGAAGAAGG + Intronic
1200910060 Y:8523971-8523993 ATGGGGAGCCAGAAGGAAGATGG - Intergenic
1201145241 Y:11061156-11061178 CAGGAGACTCAGAAGTGTGATGG + Intergenic
1201481345 Y:14442880-14442902 CATGGGAGTTAGAAGCAAGATGG - Intergenic
1201645531 Y:16225815-16225837 GAGTGGACTGAGGAGGAAGAAGG + Intergenic
1201657282 Y:16359499-16359521 GAGTGGACTGAGGAGGAAGAAGG - Intergenic
1202111115 Y:21421701-21421723 ATGGGGACCCAGAAGGCAGATGG + Intergenic