ID: 1102443270

View in Genome Browser
Species Human (GRCh38)
Location 12:112979654-112979676
Sequence CAAGCTGGACACTTTGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102443270 Original CRISPR CAAGCTGGACACTTTGATCT GGG (reversed) Intronic
901431068 1:9215286-9215308 CACGCTGGCCATTTTGTTCTGGG - Intergenic
902673993 1:17995696-17995718 CGCCTTGGACACTTTGATCTTGG - Intergenic
904541719 1:31238341-31238363 CATGCTGGACTCCTTGTTCTGGG - Intronic
918202152 1:182277715-182277737 CAAGGTGGACTCTTTGGTCCTGG - Intergenic
921634840 1:217480057-217480079 ATAGCTGGAGACTTTGGTCTGGG + Intronic
922183792 1:223256787-223256809 CCTGCTGGAAATTTTGATCTGGG - Intronic
1066481199 10:35797066-35797088 GAAGCTGGATACTTTTATTTTGG + Intergenic
1067346032 10:45439871-45439893 CAAGCTGCAGACCCTGATCTGGG + Intronic
1072051223 10:91705500-91705522 GAGGCTGGACACTTTGACTTTGG - Intergenic
1073036875 10:100570082-100570104 CAGCCGGGACACTTTCATCTCGG - Intergenic
1075395571 10:122124550-122124572 CTAGCTGGACACTTGGGGCTGGG - Intronic
1075823175 10:125331349-125331371 CCAGATGGCCACTTTGACCTTGG - Intergenic
1086148768 11:83585274-83585296 CAGGATGGAGACATTGATCTGGG + Intronic
1086291839 11:85319899-85319921 CAAGCTGTAAACTTTGACTTAGG - Intronic
1087245716 11:95833995-95834017 CAAACTGAACATTTTCATCTGGG + Exonic
1089000755 11:115050272-115050294 CAAGCTGGAGACGTTGGGCTGGG - Intergenic
1089227357 11:116936852-116936874 CATGCTGTACACTTTGCTCAGGG + Intronic
1089665534 11:120015841-120015863 CAAGTTGGACCTTTTGCTCTTGG - Intergenic
1090750206 11:129739986-129740008 CCAGCTGCACACTTGGATTTTGG - Intergenic
1091745124 12:2987065-2987087 CAAGCTGAACACTTGGTTTTGGG + Intronic
1092344370 12:7703279-7703301 CATACTGTACACTTTGATTTTGG + Intergenic
1096695437 12:53345462-53345484 AGAGCTGGCCCCTTTGATCTAGG + Intergenic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1105530588 13:21215569-21215591 CAAACCTGACACTTTGATCCTGG + Intergenic
1105598219 13:21860338-21860360 CAAGTTGGAAACTTGGAACTTGG - Intergenic
1106788782 13:33133226-33133248 CAAGCTGGGCACTGTGGCCTGGG + Intronic
1106880544 13:34124773-34124795 CAAGCTGTATACATTAATCTTGG + Intergenic
1108223499 13:48263423-48263445 CATGCTGGAAACTGTGGTCTTGG + Exonic
1109093754 13:58084235-58084257 CCAGTTGGATACTTTGATCCTGG - Intergenic
1111884347 13:94000567-94000589 CAAGTTGGACAGTTGGAACTGGG + Intronic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1114531923 14:23401889-23401911 CCAGCTTGACACTTTGATCTGGG + Intronic
1114885326 14:26842689-26842711 CAGGCTGAACAATTTTATCTGGG - Intergenic
1114907151 14:27144246-27144268 CAAGCTGGTCGCTCTGATATGGG - Intergenic
1115296260 14:31830753-31830775 CAGGCAGGATACTTTGATCTGGG + Intronic
1119785526 14:77310755-77310777 CTAACTGGAGACTTAGATCTTGG - Intronic
1121887659 14:97559429-97559451 CAACCTGGTCAGTTTCATCTGGG - Intergenic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1125754715 15:42055660-42055682 CAATCTGGACATTTTAATTTAGG - Intergenic
1129433672 15:75520362-75520384 CAGGATGAGCACTTTGATCTGGG - Intronic
1129517131 15:76163610-76163632 CCAGCTGGCCACTTGGAACTGGG + Intronic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1133520819 16:6554921-6554943 CCAGCTGGAGAATTTGACCTAGG + Intronic
1135027381 16:19009100-19009122 CAAGCAGGAAACTTGGATCTTGG - Intronic
1138862811 16:60778616-60778638 CAAACTTGACCCTTTTATCTTGG + Intergenic
1139259467 16:65577882-65577904 CAAGTCGGCCACTGTGATCTAGG - Intergenic
1139330921 16:66189339-66189361 CAAGCTGGTGGGTTTGATCTCGG - Intergenic
1142788626 17:2245361-2245383 CAAGCTGGAAACTGCAATCTGGG + Intronic
1146182453 17:30706909-30706931 CAGGCTGGACACCTGGATCTGGG - Intergenic
1146666603 17:34709199-34709221 CAAGCTGGCCTCTTTGTTCCTGG + Intergenic
1149510664 17:57238469-57238491 CAAGGTGGACTCATTGATGTAGG - Intergenic
1151186614 17:72369458-72369480 CAATCTGGTCCCTTTGAGCTGGG - Intergenic
1151564328 17:74889135-74889157 CAAGCTGGGCCATTGGATCTGGG - Intronic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1157930028 18:51811647-51811669 TAAGCTAGACAGTTTGTTCTTGG + Intergenic
1159216852 18:65403456-65403478 CAAGCTGGATACTTTCATTGGGG + Intergenic
1159986033 18:74841818-74841840 CAAGCTGGATACTTGAGTCTAGG - Intronic
1161540300 19:4846801-4846823 CCAGAAGGACACTCTGATCTTGG + Intronic
1165053138 19:33155914-33155936 CAAGGTGGACATTTTGAGCTGGG - Intronic
1165804230 19:38570827-38570849 CAGGCTGGACACCTGGATCCTGG + Intronic
1166695799 19:44851000-44851022 GAAGCTGGACACCTGGGTCTAGG - Intronic
927395958 2:22651535-22651557 CAATCTGGACCCTTTGGACTTGG - Intergenic
927507885 2:23626466-23626488 AGAGCTGGGCACTTAGATCTTGG + Intronic
929542643 2:42834208-42834230 CTAGCTGGAGGCTTTGAGCTGGG + Intergenic
932280945 2:70491384-70491406 CAAGCTGAAAACTTTGGTTTGGG - Intronic
935480517 2:103582458-103582480 CAAGTTGGGCCCTTTCATCTAGG - Intergenic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
947014712 2:225606265-225606287 ACCTCTGGACACTTTGATCTGGG - Intronic
948701808 2:239765317-239765339 GAAGCTGGCCACGTTGCTCTGGG - Intronic
1169611855 20:7389941-7389963 CATGCTGGAATCTGTGATCTAGG - Intergenic
1171191520 20:23162727-23162749 CAAGCAGGACCCTCTGAACTGGG - Intergenic
1171427395 20:25057553-25057575 CGAGCTGGGCACGTGGATCTGGG + Intronic
1172056521 20:32158107-32158129 CAACCTGGTCACCTTGATCTTGG - Intronic
1172669484 20:36625054-36625076 CATGCTGGACACTCTGCTCTGGG + Intronic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1178349119 21:31859146-31859168 CAAGCTGGAATGTATGATCTCGG + Intergenic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
952488840 3:33845590-33845612 TAAGAAGGACACTTTGATGTAGG + Intronic
955792361 3:62601832-62601854 GAAAGTGAACACTTTGATCTGGG + Intronic
958689106 3:97438834-97438856 CAAGCTTGACCCTTTGATATAGG + Intronic
958730102 3:97952277-97952299 CAGCCTGGACACATTGATCATGG + Intronic
959193392 3:103144576-103144598 TAAGCTGGCCAATTTGATCAAGG - Intergenic
962462816 3:135630341-135630363 CAAAATGGACACTTTGATGGAGG - Intergenic
963273430 3:143307735-143307757 CAGGCTGGAGACCTTGATCCAGG - Intronic
964195651 3:154061485-154061507 CAAAGTGGATACTTTGATCATGG - Intergenic
964417166 3:156459509-156459531 CAAGCTGGACATTTATATATGGG + Intronic
965728947 3:171749492-171749514 AAAGCTAGACATTGTGATCTTGG - Intronic
966807585 3:183819042-183819064 CTAGCTGGACACTTCCACCTTGG - Intronic
971444030 4:26723184-26723206 CAAGGAGGACACTTTTCTCTGGG + Intronic
971456708 4:26851990-26852012 CAAGCTGGAGATTTAGATTTAGG - Intergenic
974355886 4:60812252-60812274 CAAGATGGGCTCCTTGATCTTGG - Intergenic
978716328 4:111847417-111847439 ACATCTGGAAACTTTGATCTGGG - Intergenic
983819360 4:172173422-172173444 CAAGCTGCACCCTCTGGTCTAGG - Intronic
984436873 4:179720259-179720281 CCAGCTGGTCCCTTTGTTCTCGG - Intergenic
985194854 4:187418914-187418936 GAGGCTGGACAATTTCATCTGGG - Intergenic
987095691 5:14547198-14547220 AAAGCTGGAGAGTTTAATCTTGG - Intergenic
988739805 5:34059174-34059196 CACCCTGTACACCTTGATCTTGG - Intronic
989651924 5:43700023-43700045 AAATCTGCACACTTTGTTCTTGG - Intronic
990706247 5:58532796-58532818 CAAGCTAGACTAATTGATCTTGG + Intergenic
992331853 5:75725189-75725211 CAAGATGGAGACTATGACCTGGG - Intergenic
995015803 5:107307329-107307351 CAAGCTGGTCACTTGGCTCAAGG - Intergenic
996581756 5:125039048-125039070 CCATCCTGACACTTTGATCTTGG - Intergenic
996631661 5:125640013-125640035 CAGGCTGCACCCTCTGATCTTGG - Intergenic
996919704 5:128753487-128753509 GAAGCTGGGCACTTTGAGCAAGG - Intronic
999202227 5:149824649-149824671 CAAGCTGGACAGATGGTTCTGGG + Intronic
1000228237 5:159290597-159290619 CAAGCTGGACACTTAATCCTGGG - Intergenic
1003400856 6:5789661-5789683 CAAACCTGACACTTTGATCCTGG - Intergenic
1004275039 6:14228659-14228681 CAAGCTGCACACTCTGATGTGGG + Intergenic
1006575897 6:35045615-35045637 CAAGCTGGACACCATGAATTAGG + Intronic
1007497332 6:42269146-42269168 CAAGCTGGACTCTTTCACCCAGG - Exonic
1012300364 6:97579984-97580006 CAAGCTGGACACCTTAGTTTAGG + Intergenic
1016887891 6:148975492-148975514 CACACTGGACACTTTGATCATGG - Intronic
1020501385 7:8925881-8925903 CAGTCTGGACATTTTGATTTCGG + Intergenic
1023738044 7:43251934-43251956 CAAGCTGGACCCAGTGCTCTGGG + Intronic
1024966197 7:55023976-55023998 CAAGCTGGCCAGTTTGAATTTGG + Intronic
1029475555 7:100781689-100781711 CAGGCTGGAGTCTATGATCTCGG + Intronic
1035969645 8:4233603-4233625 CAACCAGGACACCTTGATCTTGG + Intronic
1039434220 8:37548484-37548506 CATGCTGGATCCTTTGATCAGGG - Intergenic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1041691253 8:60689833-60689855 TAAGCTGAATACTTTGATGTCGG - Intronic
1041692489 8:60702551-60702573 GAAGGTGGAGACTGTGATCTTGG + Intronic
1043264911 8:78253725-78253747 CAAGCTGGACAAATTGATGAAGG + Intergenic
1046833858 8:118777770-118777792 CAAGCTGGTCACTTATATATGGG - Intergenic
1046887875 8:119388268-119388290 CAAGCTGGACACTTGTCACTGGG + Intergenic
1047290575 8:123526176-123526198 CAAGCTGGTTATTATGATCTTGG - Intronic
1048253810 8:132889569-132889591 CAAGGTTAACACATTGATCTTGG + Intronic
1049241666 8:141540481-141540503 CAGGAGGGACACCTTGATCTGGG - Intergenic
1057970799 9:99555464-99555486 CCAGCTGGACACTAAGACCTGGG - Intergenic
1059254795 9:112919893-112919915 CAAGTTGGTCACATTCATCTGGG - Intergenic
1060644015 9:125262375-125262397 CAAGCTGGACACACGGGTCTGGG + Intronic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1186165900 X:6825587-6825609 CAAGCTGGAGACTTAGAGGTGGG - Intergenic
1186942170 X:14521558-14521580 CAAGCTGGACACCCTGATGCTGG - Intergenic
1187142020 X:16602955-16602977 CAAGCTGGCTTCTTTGACCTTGG + Intronic
1187807693 X:23139187-23139209 CCTGCTGGGCACCTTGATCTTGG - Intergenic
1198735389 X:139779061-139779083 CAATCTGGGCACTCTGATGTTGG - Intronic