ID: 1102443896

View in Genome Browser
Species Human (GRCh38)
Location 12:112986639-112986661
Sequence CCATTAGGGAACCTGAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 1, 2: 3, 3: 34, 4: 258}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102443896_1102443901 -7 Left 1102443896 12:112986639-112986661 CCTGTCTTCAGGTTCCCTAATGG 0: 1
1: 1
2: 3
3: 34
4: 258
Right 1102443901 12:112986655-112986677 CTAATGGTGTGTGCAGGTGCTGG 0: 1
1: 0
2: 4
3: 29
4: 170
1102443896_1102443904 4 Left 1102443896 12:112986639-112986661 CCTGTCTTCAGGTTCCCTAATGG 0: 1
1: 1
2: 3
3: 34
4: 258
Right 1102443904 12:112986666-112986688 TGCAGGTGCTGGCCGCAGGTGGG 0: 1
1: 0
2: 2
3: 32
4: 238
1102443896_1102443902 0 Left 1102443896 12:112986639-112986661 CCTGTCTTCAGGTTCCCTAATGG 0: 1
1: 1
2: 3
3: 34
4: 258
Right 1102443902 12:112986662-112986684 TGTGTGCAGGTGCTGGCCGCAGG 0: 1
1: 0
2: 2
3: 23
4: 239
1102443896_1102443903 3 Left 1102443896 12:112986639-112986661 CCTGTCTTCAGGTTCCCTAATGG 0: 1
1: 1
2: 3
3: 34
4: 258
Right 1102443903 12:112986665-112986687 GTGCAGGTGCTGGCCGCAGGTGG 0: 1
1: 0
2: 2
3: 30
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102443896 Original CRISPR CCATTAGGGAACCTGAAGAC AGG (reversed) Intronic
900032564 1:381757-381779 CCACTAGGGAACCTCAGGAGAGG - Intergenic
900053321 1:610819-610841 CCACTAGGGAACCTCAGGAGAGG - Intergenic
900519858 1:3100339-3100361 CCAGTAGAGGACCTAAAGACAGG - Intronic
901261591 1:7875577-7875599 CCATTGGGGGTCCTGAAGACAGG + Intergenic
901620194 1:10578832-10578854 GCATCAGTGAACCTGAAGACAGG + Intronic
903383012 1:22909735-22909757 CCATTAGCAAAAATGAAGACAGG + Intronic
904275359 1:29380317-29380339 CCATTTTGGAACCAGAAGCCTGG + Intergenic
906352591 1:45076834-45076856 GAATTAGTGAACTTGAAGACAGG - Intronic
906641679 1:47444732-47444754 CCAGCAGAGAACCTGTAGACAGG + Intergenic
906878161 1:49560386-49560408 AAATTAGTGAGCCTGAAGACAGG + Intronic
909481532 1:76132421-76132443 CCATTAAGGAACAGGAAGAGGGG - Intronic
909525528 1:76618167-76618189 CCATTAGAGAAACTGTAGCCTGG + Intronic
909653518 1:78002939-78002961 ATTTTAGAGAACCTGAAGACCGG - Intronic
910379108 1:86607537-86607559 GAATTAGTGAGCCTGAAGACAGG - Intergenic
911341059 1:96638055-96638077 CCATTAGGGAACATCAAGACTGG - Intergenic
911496657 1:98639117-98639139 GAATTAGTGAGCCTGAAGACAGG + Intergenic
912606991 1:111001632-111001654 GCATTAGTGAGCCTGAAGACAGG - Intergenic
914321755 1:146570489-146570511 GGATTAGTGAACCTGAAGACAGG + Intergenic
914861912 1:151393509-151393531 AGATTAGTGAACTTGAAGACAGG + Intergenic
914942377 1:152034662-152034684 CCCTTGGGGAACCGGATGACTGG - Intronic
915938283 1:160101560-160101582 CCATGAGGGACCCTGATGCCCGG + Intergenic
916257607 1:162805744-162805766 CCTTTAGTGACCCTGTAGACCGG + Intronic
917300464 1:173569218-173569240 GAATTAGTGAGCCTGAAGACAGG - Intronic
918476074 1:184926886-184926908 GAATTAGCGAACTTGAAGACAGG - Intronic
918671467 1:187222881-187222903 CAATTACTGAACTTGAAGACAGG - Intergenic
918961394 1:191282726-191282748 CCTTCCAGGAACCTGAAGACAGG + Intergenic
919012432 1:191982992-191983014 CCACTCGTGAGCCTGAAGACTGG - Intergenic
919043714 1:192424897-192424919 CCAATGGGGATCCTGAAGACAGG + Intergenic
921286402 1:213613608-213613630 CCATTAGAGAAGCTTAAGAAAGG - Intergenic
1064083389 10:12326380-12326402 GAATTAGTGAACCAGAAGACAGG - Intergenic
1066780897 10:38943397-38943419 ACCTTAGGGACCCTGAGGACTGG + Intergenic
1067924116 10:50490413-50490435 CCAGTAGGGACTCTGATGACTGG - Intronic
1069012180 10:63386464-63386486 CAATCAGGGAACCTGAGGACGGG + Intronic
1071109228 10:82135565-82135587 GAATTAGTGAGCCTGAAGACAGG - Intronic
1072389094 10:94964194-94964216 CCATTAGGGGACCTGTAGACAGG - Intronic
1073878531 10:107952404-107952426 CCATCAGGAAAAATGAAGACTGG - Intergenic
1074804188 10:117030765-117030787 GAATTAGTGAACTTGAAGACAGG + Intronic
1075179318 10:120195994-120196016 CCACTGGGGGACCTGAGGACAGG - Intergenic
1077740589 11:4841073-4841095 GAATTAGTGAGCCTGAAGACAGG + Intronic
1079473721 11:20806778-20806800 CAATTAGTGAACTTGAAGACAGG - Intronic
1079572037 11:21954431-21954453 GAATTAGTGAACTTGAAGACAGG + Intergenic
1081099625 11:38986263-38986285 CCACTTGTGAGCCTGAAGACTGG - Intergenic
1082989148 11:59192439-59192461 CCAAAAGGGAAGGTGAAGACAGG - Intronic
1087031796 11:93713891-93713913 GAATTAGTGAACCTGAAGACAGG - Intronic
1088425102 11:109693657-109693679 CCATCTGGGAGCCTGAAGAAAGG + Intergenic
1089762017 11:120734759-120734781 GAATTAGTGAGCCTGAAGACAGG - Intronic
1093607967 12:21117449-21117471 CAATTAGCGAGCTTGAAGACAGG - Intronic
1094169683 12:27479169-27479191 CCATCAGGGGACCTGATGACAGG - Intronic
1095802266 12:46281459-46281481 CCATTGGGGTACCTGAGAACAGG + Intergenic
1096189924 12:49609797-49609819 CCATTGAGGGACCTGTAGACAGG + Intronic
1096892451 12:54785796-54785818 CCTTTAGGGAACCTGAAAACAGG - Intergenic
1097146845 12:56947344-56947366 GAATTAGTGAACCTGAAGACAGG - Intergenic
1097540462 12:60936366-60936388 CCATTGGAGAGCCTGAACACAGG - Intergenic
1097958034 12:65506286-65506308 CCATGAGGGAAGCTGAGGCCTGG + Intergenic
1098180288 12:67840123-67840145 CCTTTTGGGAGCCTGAAGATGGG - Intergenic
1098530435 12:71535650-71535672 ACATTAGGGATCCTCAAGTCAGG + Intronic
1098839322 12:75459771-75459793 CCATTGGGGAATCTGTAGGCAGG + Intergenic
1099399753 12:82188389-82188411 CTATCTGGGAACCTGAGGACAGG + Intergenic
1099609945 12:84856006-84856028 GAATTAGTGAACTTGAAGACAGG - Intergenic
1099764009 12:86959595-86959617 GAATTAGTGAACTTGAAGACAGG - Intergenic
1100804513 12:98267443-98267465 CAATCAGTGAACTTGAAGACAGG + Intergenic
1102443896 12:112986639-112986661 CCATTAGGGAACCTGAAGACAGG - Intronic
1102898812 12:116620196-116620218 CCTTCAGGGAACCTGCAGCCAGG - Intergenic
1103201059 12:119088303-119088325 CCTTTGCGGAACCTGAAGTCAGG - Intronic
1103669403 12:122599905-122599927 CTATTTGGGAAGCTGAAGAGGGG + Intronic
1107139224 13:36979243-36979265 CACTTTGGGAACCTGAGGACAGG - Intronic
1107567586 13:41621804-41621826 CCATGAGGGAGGCAGAAGACAGG + Intronic
1108138157 13:47387400-47387422 GAATTAGTGAACCTGAAGACAGG + Intergenic
1108968256 13:56339434-56339456 CCATCAGGGGACCTGTAGGCAGG + Intergenic
1109567224 13:64132851-64132873 GAATTAGTGAACTTGAAGACAGG + Intergenic
1110359458 13:74609079-74609101 CCAGCAGGAAACATGAAGACTGG - Intergenic
1111721854 13:91956123-91956145 GCACTGGGGAGCCTGAAGACAGG + Intronic
1114762405 14:25330512-25330534 CCATGGGGGAGCCTGAAGGCAGG + Intergenic
1115108446 14:29789860-29789882 CTATCAGGGAGCCTGAAGACAGG - Intronic
1115918509 14:38344096-38344118 GAATTAGTGAGCCTGAAGACAGG + Intergenic
1117759816 14:59015155-59015177 CCACTAGGGCACCTGAAGATAGG - Intergenic
1117842853 14:59879433-59879455 CAATTAGTGAGCCTGAAGATGGG - Intergenic
1118236881 14:64013867-64013889 CCATTGGGGAAACTCAATACAGG - Intronic
1124392118 15:29269109-29269131 CCATCAAGGAAACTGAAGCCTGG - Exonic
1125195609 15:37042425-37042447 CCATTGAGGAAACTGAAGCCAGG + Intronic
1126488991 15:49215464-49215486 TAAATAGTGAACCTGAAGACAGG - Intronic
1126898878 15:53290629-53290651 CCACTAGGGGATCTGTAGACTGG - Intergenic
1133749463 16:8713222-8713244 CCATTTAGGAATCTGAAGCCCGG + Exonic
1135665590 16:24333047-24333069 CCCTTAGGAAAACTGATGACAGG + Intronic
1136715741 16:32279692-32279714 ACCTTAGGGACCCTGAGGACTGG + Intergenic
1136752170 16:32650075-32650097 ACCTTAGGGACCCTGAGGACTGG - Intergenic
1136771455 16:32845365-32845387 ACCTTAGGGACCCTGAGGACTGG - Intergenic
1136822423 16:33330387-33330409 ACCTTAGGGACCCTGAGGACTGG + Intergenic
1136828986 16:33386926-33386948 ACCTTAGGGACCCTGAGGACTGG + Intergenic
1136834052 16:33485708-33485730 ACCTTAGGGACCCTGAGGACTGG + Intergenic
1136868099 16:33771830-33771852 ACCTTAGGGACCCTGAGGACCGG + Intergenic
1136899126 16:34016060-34016082 ACCTTAGGGACCCTGAGGACTGG + Intergenic
1137527507 16:49249324-49249346 CCAGTAGGGAAACTGAGGCCTGG + Intergenic
1138150670 16:54653918-54653940 CAAGTAGAGACCCTGAAGACGGG - Intergenic
1138638559 16:58364122-58364144 CCATCAGGGAACCTGAAGACAGG - Intronic
1140011873 16:71140662-71140684 GGATTAGTGAACCTGAAGACAGG - Intronic
1140036463 16:71375115-71375137 ACACTAGGGAGGCTGAAGACAGG + Intronic
1141021978 16:80505861-80505883 CCATAAGGGAAAGTGAAGTCAGG + Intergenic
1141037479 16:80640858-80640880 GAATTAGTGAGCCTGAAGACAGG + Intronic
1142369267 16:89669409-89669431 CCATTCGGGAGCCGGAGGACTGG + Exonic
1203010864 16_KI270728v1_random:238812-238834 ACCTTAGGGACCCTGAGGACTGG - Intergenic
1203054313 16_KI270728v1_random:910059-910081 ACCTTAGGGACCCTGAGGACTGG - Intergenic
1203073879 16_KI270728v1_random:1107476-1107498 ACCTTAGGGACCCTGAGGACTGG - Intergenic
1203104075 16_KI270728v1_random:1344446-1344468 ACCTTAGGGACCCTGAGGACTGG - Intergenic
1203129439 16_KI270728v1_random:1617922-1617944 ACCTTAGGGACCCTGAGGACTGG + Intergenic
1147165798 17:38592583-38592605 CCATTGGGGAAACTGAGGCCTGG - Intronic
1150897676 17:69233293-69233315 ACATTAGGGAACTCAAAGACAGG - Intronic
1152947376 17:83205425-83205447 CCACTAGGGAACCTCAGGAGAGG + Intergenic
1155282305 18:24251985-24252007 GAATTAGTGAGCCTGAAGACAGG + Intronic
1156572615 18:38275638-38275660 GAATTAGTGAACTTGAAGACAGG - Intergenic
1159738158 18:72130226-72130248 CCTTTAGGGAACTACAAGACAGG + Intergenic
1159797061 18:72856916-72856938 CATTTAGGGAATCTGAAGCCAGG - Intronic
1161895766 19:7078898-7078920 CAATTAGTGAACTTGATGACAGG - Intronic
1161895971 19:7080557-7080579 CCATCAGGGAGCCAGCAGACAGG + Intronic
1163993663 19:21022783-21022805 CCATAGGAGAACCTGAAGTCTGG + Exonic
1165556436 19:36636567-36636589 CCTGTAGGGTACCTGAAGTCCGG + Intergenic
1166424734 19:42667580-42667602 CCCGTAGGGTACCTGAAGTCTGG + Intronic
925743822 2:7028392-7028414 CACTTAGGGAGCCTGAGGACTGG + Intronic
926332411 2:11836491-11836513 CCATTTGGGATCTTGGAGACAGG - Intergenic
926926737 2:17995226-17995248 CCATATGGGCACCTGAAGAAGGG + Intronic
928749560 2:34456321-34456343 TAATTAGTGAACCAGAAGACAGG - Intergenic
929542234 2:42831268-42831290 CCAATAGGGAACCTGGGGAAGGG + Intergenic
931535542 2:63271649-63271671 CCATAAAGAAACCTGAAGATAGG + Intronic
932569383 2:72930357-72930379 CCATTAAGGAACATCAGGACAGG + Intronic
934616194 2:95772760-95772782 CCATGAGGGTTCCTGAAGGCTGG - Intergenic
934644701 2:96051800-96051822 CCATGAGGGTTCCTGAAGGCCGG + Intergenic
934838116 2:97607890-97607912 CCATGAGGGTTCCTGAAGGCTGG + Intergenic
936818079 2:116484711-116484733 CCACCAGGGAGCCTGAGGACAGG + Intergenic
937226824 2:120375063-120375085 ACATTTCTGAACCTGAAGACAGG + Intergenic
937539647 2:122933494-122933516 CCATAAGGCAACATGAAGAGGGG - Intergenic
937608596 2:123832808-123832830 GAATTAGTGAACCTGAGGACAGG - Intergenic
938737696 2:134201440-134201462 ACATTAGGGAACCAGTAGATGGG + Intronic
939173013 2:138717465-138717487 CCATTTGTGAACCAGAAAACAGG - Intronic
940404252 2:153283176-153283198 CCATCAGGGAAACTGTAGATGGG - Intergenic
940445327 2:153770825-153770847 CCATTTGGGAACCTGTAGGTGGG - Intergenic
941678763 2:168372493-168372515 GAATTAGTGAACTTGAAGACAGG + Intergenic
942001414 2:171651851-171651873 GAATTAGTGAACTTGAAGACAGG - Intergenic
943371598 2:187023148-187023170 CCACTGGGGGGCCTGAAGACAGG + Intergenic
944945691 2:204682113-204682135 TCATTAGTGAGCCTGGAGACTGG - Intronic
945722119 2:213430245-213430267 GCATTTTGGAACGTGAAGACAGG + Intronic
945754297 2:213828252-213828274 GCATTAGTGAGCCTAAAGACAGG - Intronic
947473592 2:230420814-230420836 CCATTAGGGAAACTGGACATGGG - Intronic
1169534710 20:6525601-6525623 CCACAAGGGGACCTGAGGACAGG - Intergenic
1170311647 20:14998533-14998555 GAATTAGTGAACTTGAAGACAGG + Intronic
1172245182 20:33441203-33441225 CTATTAGGGAAACTGAAGTGTGG + Intronic
1172727184 20:37054110-37054132 CCATTAGGGAAACTGGATAAAGG + Intronic
1173127047 20:40346879-40346901 CAATTAGTGAGCTTGAAGACAGG + Intergenic
1173842184 20:46165047-46165069 CCATTAGGGAGCCTGATGAGGGG + Intergenic
1176044560 20:63085611-63085633 CCATGAGGGAACCAGGACACAGG - Intergenic
1182451619 22:30425246-30425268 CCTTTAGCGAACATGTAGACTGG + Exonic
949165824 3:939588-939610 TCTTTAGGGATCCTGAATACAGG - Intergenic
949181480 3:1136454-1136476 ACATTACAGAACTTGAAGACAGG - Intronic
950701633 3:14754323-14754345 CCCTCAGGGAACCTCTAGACAGG + Intronic
951261246 3:20512165-20512187 CCATCAGGGAACCTGTAGGCAGG - Intergenic
951436814 3:22675150-22675172 GAATTAGTGAACTTGAAGACAGG - Intergenic
952441465 3:33334451-33334473 GGATTAGTGAACTTGAAGACAGG + Intronic
955274196 3:57532061-57532083 GAATTAGTGAACCTGAAGACAGG - Intronic
957810290 3:85213801-85213823 TAATTAGTGAACATGAAGACAGG - Intronic
958494929 3:94832585-94832607 CCATAAAGGAATATGAAGACAGG - Intergenic
959038032 3:101387671-101387693 CCATCAGGGAGCATGAGGACAGG + Intronic
959219412 3:103497187-103497209 CCACTATGGAACTTCAAGACAGG - Intergenic
960784846 3:121361522-121361544 GAATTAGTGAGCCTGAAGACAGG - Intronic
961661914 3:128473480-128473502 TCACTAGGGAAACTGAGGACTGG - Intergenic
963305154 3:143643445-143643467 CCATGAGTGAACCTTTAGACAGG + Intronic
963672952 3:148275008-148275030 CAATTAGTGAACTTGAAGACAGG + Intergenic
965016595 3:163166757-163166779 GAATTGGGGAGCCTGAAGACAGG - Intergenic
966468277 3:180257068-180257090 GAATTAGTGAACCTGAAGACAGG + Intergenic
968827625 4:2911199-2911221 CCATCTGAGAACCTGAAGAATGG + Intronic
969597282 4:8156636-8156658 CCATTTGGGCAGCTGGAGACTGG + Intronic
970798330 4:19942105-19942127 CATTTAGGGTACTTGAAGACTGG - Intergenic
972253990 4:37333979-37334001 GAATTAGTGAACTTGAAGACAGG + Intronic
972579432 4:40381579-40381601 GAATTAGTGAGCCTGAAGACAGG + Intergenic
972843383 4:42957660-42957682 GAATTAGTGAACTTGAAGACAGG - Intronic
975371216 4:73590604-73590626 CCATTAGCGAACCAGAAACCAGG + Intronic
976254028 4:83082219-83082241 GAATTAGTGAGCCTGAAGACAGG - Intergenic
977013565 4:91663606-91663628 CCTTTTGGGGGCCTGAAGACTGG - Intergenic
977044555 4:92052457-92052479 GAATTAGTGAGCCTGAAGACAGG + Intergenic
978348060 4:107792626-107792648 CAGAAAGGGAACCTGAAGACAGG - Intergenic
978922276 4:114199475-114199497 GCATTAGTGAACTTAAAGACAGG - Intergenic
979215559 4:118159824-118159846 GAATCAGGGAACTTGAAGACAGG + Intronic
979847878 4:125539508-125539530 CAATCAGGGAACTTGAAGACAGG + Intergenic
980032453 4:127846038-127846060 CCATTGGAGAACCTGTAGGCAGG + Intergenic
980228717 4:130020277-130020299 AAATTATGGAACCTGAAGAAGGG - Intergenic
980623810 4:135345212-135345234 CCTTTTGGGAGCCTGAAGATGGG + Intergenic
981140396 4:141260728-141260750 CAATTAGTGAGCTTGAAGACAGG + Intergenic
983493288 4:168413638-168413660 GCATTAGTGAGCCTGAAGAAAGG + Intronic
984863747 4:184263097-184263119 CCACTGGGGAGCCTGAGGACTGG + Intergenic
985858140 5:2447136-2447158 CAAATAAAGAACCTGAAGACAGG + Intergenic
986537011 5:8798779-8798801 TAATTAGCGAACTTGAAGACAGG + Intergenic
987664213 5:20915881-20915903 CCATTAAGGAACCAGAAAGCAGG - Intergenic
987945976 5:24609179-24609201 CCATTACGGATTCTGAAGAATGG + Intronic
988758470 5:34286318-34286340 CCATTAAGGAACCAGAAAGCAGG + Intergenic
992789934 5:80204201-80204223 CCATTATTGAACCTAAAGAGGGG + Intronic
993138457 5:83999551-83999573 AAATTAGTGAACTTGAAGACAGG + Intronic
993991198 5:94660616-94660638 CCATCTGGAAGCCTGAAGACAGG - Intronic
994134285 5:96267080-96267102 TAATTAGTGAGCCTGAAGACAGG + Intergenic
995388645 5:111615423-111615445 CCATTTGGGGACCTGTAGGCAGG - Intergenic
995777818 5:115744678-115744700 GAATTAGTGAACTTGAAGACAGG - Intergenic
996161791 5:120175083-120175105 GAATTAGTGAGCCTGAAGACAGG + Intergenic
996653491 5:125912215-125912237 GAATTAGGGAGCTTGAAGACAGG - Intergenic
996683736 5:126257249-126257271 CCACCAGGGAACCTAAGGACAGG + Intergenic
996684994 5:126270056-126270078 CCCTTAGGGAAGCTCAACACAGG - Intergenic
996813512 5:127546171-127546193 GGATTAGTGAACCTGAAGACAGG - Intronic
996927699 5:128847387-128847409 GAATTAGCGAACTTGAAGACAGG + Intronic
997186418 5:131886072-131886094 GCATTAGTGAGCTTGAAGACAGG + Intronic
997428108 5:133818122-133818144 CCTTTAGGGAACGTGAGCACGGG + Intergenic
998543398 5:143004690-143004712 CCCTTTGAGAATCTGAAGACTGG + Intronic
998689233 5:144569285-144569307 GAATTAGTGAACTTGAAGACAGG - Intergenic
1002741256 5:181437111-181437133 CCACTAGGGAACCTCAGGAGAGG + Intergenic
1003156725 6:3603287-3603309 CCACCAGGGATCCTGAGGACAGG - Intergenic
1003262044 6:4526396-4526418 GAATTAGGAAACTTGAAGACAGG + Intergenic
1005156912 6:22818101-22818123 GAATTAGTGAACTTGAAGACTGG - Intergenic
1005575777 6:27188024-27188046 CCCTTAGGGTACCTAAAGTCCGG - Intergenic
1005829421 6:29658661-29658683 CCAAGAGGGAACCTAAAGGCTGG + Intronic
1006018333 6:31101255-31101277 GAATTAGTGAGCCTGAAGACAGG - Intergenic
1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1008018033 6:46542950-46542972 AAATTAGTGAACTTGAAGACAGG + Intergenic
1011321859 6:86104454-86104476 CCATTAGGGAACCTGTGGGCAGG - Intergenic
1012512386 6:100018038-100018060 GAATTAGTGAACTTGAAGACAGG + Intergenic
1012696840 6:102394819-102394841 CAATTAGTGAGCCTGAAGGCAGG - Intergenic
1012940644 6:105411038-105411060 GAATTAGTGAACTTGAAGACAGG + Intergenic
1013322917 6:109012741-109012763 CCATTAGGGAAGCAGAATACAGG + Intronic
1019246371 6:170712808-170712830 CCACTAGGGAACCTCAGGAGAGG + Intergenic
1019582828 7:1775957-1775979 GCTTTGGGAAACCTGAAGACAGG - Intergenic
1020607247 7:10355122-10355144 CAAGTAGTGAGCCTGAAGACAGG - Intergenic
1020613109 7:10425958-10425980 CACTTAGTGAACCTGAAGATAGG - Intergenic
1022773506 7:33500391-33500413 CCAGTAGGAAATCAGAAGACAGG + Intronic
1026081200 7:67222914-67222936 GGATTAGTGAACCTGAAAACAGG - Intronic
1026695885 7:72591097-72591119 GGATTAGTGAACCTGAAAACAGG + Intronic
1028308098 7:89291539-89291561 GAATTAGTGAACTTGAAGACAGG + Intronic
1030091584 7:105863100-105863122 CCATGAGGGAAACTGAACAGCGG + Intronic
1030754275 7:113269211-113269233 CCATTAGGGAAACTGTAGGCAGG + Intergenic
1031232352 7:119123960-119123982 CCACTGGGGAACATGATGACGGG - Intergenic
1032062583 7:128737374-128737396 CCATTAGGGAACCTCAGGGTTGG + Intergenic
1033216811 7:139499430-139499452 CCATTATAGACCCTGAAGACAGG - Intergenic
1033867625 7:145712370-145712392 GCATTAGTGAGCTTGAAGACAGG - Intergenic
1033887405 7:145965175-145965197 CCACTAGTGAGCTTGAAGACAGG + Intergenic
1034381839 7:150702953-150702975 GCATCAGTGAACTTGAAGACAGG + Intergenic
1034581620 7:152048856-152048878 GAATTAGTGAACTTGAAGACAGG - Intronic
1034974167 7:155438350-155438372 CCAATAGGGAAACTGAGGCCTGG - Intergenic
1035216194 7:157369124-157369146 CGATTAGGGGACCGGGAGACTGG + Intronic
1035403555 7:158584543-158584565 CCATTATCGAAGCTGAACACAGG - Intronic
1035501701 8:94881-94903 CCACTAGGGAACCTCAGGAGAGG - Intergenic
1037282714 8:17261204-17261226 CAATCAGTAAACCTGAAGACAGG - Intronic
1038475555 8:27864115-27864137 GCTTAAGGGAACTTGAAGACCGG - Intergenic
1038683097 8:29688202-29688224 ACAATAGGAAAACTGAAGACAGG + Intergenic
1040349663 8:46551509-46551531 CCACCTGGGAACCTGGAGACTGG + Intergenic
1040368721 8:46747021-46747043 CCACCTGGGAACCTGGAGACTGG - Intergenic
1041332769 8:56745881-56745903 TCATAAGGGAAGCTGAAGGCAGG + Intergenic
1041982647 8:63880987-63881009 CTATTTGGGAAGCTGAAGACAGG - Intergenic
1045800838 8:106098464-106098486 GAATTAGTGAACTTGAAGACAGG + Intergenic
1045806925 8:106173336-106173358 GGATTAGTGAACTTGAAGACAGG + Intergenic
1046121099 8:109848434-109848456 CCATTGAGGAACCTGAGGACAGG - Intergenic
1046579275 8:116071702-116071724 CCAATCTAGAACCTGAAGACTGG + Intergenic
1050238673 9:3611695-3611717 GAATTAGTGAACTTGAAGACAGG - Intergenic
1050243001 9:3658304-3658326 CCCTTCAGGAACCTGAAGATGGG - Intergenic
1050392353 9:5158105-5158127 CAATTAGTGAAACTGAAGACAGG + Intronic
1050500551 9:6293736-6293758 AAATTATGGAACCTGAAGAGGGG - Intergenic
1052993976 9:34539846-34539868 CCCGTAGGGTACCTGAAGTCTGG + Intergenic
1056007472 9:82287405-82287427 AAATTAGTGAACTTGAAGACAGG + Intergenic
1056338999 9:85604893-85604915 GAATTAGTGAGCCTGAAGACAGG + Intronic
1056471720 9:86911148-86911170 AGATTAGAGAACTTGAAGACAGG + Intergenic
1056556520 9:87694420-87694442 CCACCAGGGGACCTGACGACAGG - Intronic
1057079845 9:92165206-92165228 GAATCAGTGAACCTGAAGACAGG + Intergenic
1059839254 9:118193282-118193304 GAATTAGTGAGCCTGAAGACAGG + Intergenic
1061808354 9:133148796-133148818 ACAGTAGGGAAACTGAGGACAGG - Intronic
1062068204 9:134540200-134540222 CAGTTAGGGAAACTGAGGACTGG + Intergenic
1203607135 Un_KI270748v1:68191-68213 CCACTAGGGAACCTCAGGAGAGG + Intergenic
1188040974 X:25369577-25369599 CCACTGGGGGACCTGAGGACAGG - Intergenic
1188049246 X:25464599-25464621 GCATCAGTGAACCTGAAGACAGG - Intergenic
1188071601 X:25725260-25725282 GCATTAGTGAGCTTGAAGACAGG - Intergenic
1188854100 X:35171052-35171074 GAATTAGTGAGCCTGAAGACAGG - Intergenic
1189875505 X:45432475-45432497 GAATTAGCGAACCTGAAGACAGG - Intergenic
1190515653 X:51221330-51221352 CCATTAGGGAATCAACAGACTGG - Intergenic
1192079509 X:68033235-68033257 CCATTTGGGAACCTGGGGAATGG + Intergenic
1192826564 X:74703470-74703492 GAATTAGTGAGCCTGAAGACAGG - Intergenic
1192855814 X:75010769-75010791 TAATTAGGGAACTTGAAGACAGG - Intergenic
1192968412 X:76205083-76205105 GAATTAGGGAGCTTGAAGACAGG - Intergenic
1193509537 X:82382702-82382724 CCATCAGGGATCCTGAGGAAAGG - Intergenic
1193683593 X:84551699-84551721 GAATTAGTGAACTTGAAGACAGG - Intergenic
1194352663 X:92839965-92839987 CCATTCGGGAACCTGGAGGATGG + Intergenic
1194447031 X:94001195-94001217 CAATTAGTGAGCCTGAAGACAGG - Intergenic
1194553375 X:95329265-95329287 GAATTAGTGAACCTGAAGACAGG - Intergenic
1194787460 X:98105015-98105037 GAATTAGTGAGCCTGAAGACAGG - Intergenic
1194925465 X:99818486-99818508 GAATTAGTGAGCCTGAAGACAGG + Intergenic
1195396306 X:104413696-104413718 GAATTAGTGAACTTGAAGACAGG + Intergenic
1196538803 X:116881378-116881400 GAATTAGGGAGCTTGAAGACAGG - Intergenic
1196808873 X:119612828-119612850 CCCTTGGGGAACTTGCAGACTGG - Intergenic
1197113076 X:122799012-122799034 GAATTAGTGAACTTGAAGACAGG + Intergenic
1198293836 X:135264798-135264820 TAATTAGTGAATCTGAAGACAGG + Intronic
1199138752 X:144285864-144285886 GAATTAGTGAACTTGAAGACTGG - Intergenic
1199174707 X:144773368-144773390 GAATTAGTGAACTTGAAGACAGG - Intergenic
1199317092 X:146393813-146393835 GAATTAGTGAGCCTGAAGACAGG - Intergenic
1199568600 X:149245183-149245205 GAATTAGGGAACTTGGAGACAGG - Intergenic
1199680350 X:150220133-150220155 CCAGGAGGGAATCTGAAGACAGG - Intergenic
1200660968 Y:5956707-5956729 CCATTCGGGAACCTGGAGGATGG + Intergenic