ID: 1102444360

View in Genome Browser
Species Human (GRCh38)
Location 12:112990399-112990421
Sequence CCTGATTAGCAGTTAGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102444358_1102444360 4 Left 1102444358 12:112990372-112990394 CCAGGTCATAGATGGTTATAAAG 0: 1
1: 0
2: 2
3: 36
4: 296
Right 1102444360 12:112990399-112990421 CCTGATTAGCAGTTAGTTGAAGG 0: 1
1: 0
2: 0
3: 17
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102444360 Original CRISPR CCTGATTAGCAGTTAGTTGA AGG Intronic
901142579 1:7044548-7044570 CGTGATTAGCAGATGGGTGATGG + Intronic
904304922 1:29582410-29582432 TATTATTATCAGTTAGTTGAAGG - Intergenic
907381039 1:54089205-54089227 GCTGATTAGAAGTTATTTAATGG + Intronic
908147999 1:61267825-61267847 CCTGATTAGGAGCTTTTTGAGGG + Intronic
909147579 1:71956829-71956851 CTGGAATAGCAGTTAGTTGGTGG - Intronic
917245180 1:172993173-172993195 CCTGCTTAGCAGTTATTGGGAGG + Intergenic
917770322 1:178269950-178269972 CCTGATTAGCAGTTCGTGGTAGG + Intronic
917873572 1:179264842-179264864 CCTAGTTAGAAGTTAATTGATGG + Intergenic
920455510 1:206098152-206098174 CCTGCTGAGCAGGTAGTTGATGG - Exonic
921776470 1:219106010-219106032 TCTGATTGGCAATTGGTTGATGG + Intergenic
922358394 1:224798145-224798167 CCTGGTAAGCAGATAGTTGGAGG + Intergenic
1063936408 10:11083122-11083144 CCTGATTGGCAGTGAGGTGGGGG + Intronic
1068972043 10:62969205-62969227 CCAGATTACCAGTTATCTGAAGG - Intergenic
1070612595 10:77943831-77943853 TCAGATTAGAAGTTAGATGAGGG - Intergenic
1071198912 10:83194846-83194868 CTTGATTGGCAGTTGGTTGAAGG - Intergenic
1073705395 10:105977763-105977785 CATAAGTATCAGTTAGTTGATGG - Intergenic
1077980574 11:7295833-7295855 CTTGATTAGTAGTTCCTTGAGGG + Intronic
1087256143 11:95956438-95956460 CATGCTTAGCAGTAATTTGATGG + Intergenic
1090525786 11:127533958-127533980 TCTGATTTGCAGTTATGTGATGG + Intergenic
1096223866 12:49851750-49851772 CCTGGATAGTAGTTATTTGATGG - Intergenic
1097931172 12:65188492-65188514 CCTAGTTAGAAGTTAGTTGGTGG + Intronic
1099173708 12:79396461-79396483 CAAGAGAAGCAGTTAGTTGAAGG + Intronic
1099914405 12:88874273-88874295 CCTTATGAAAAGTTAGTTGAAGG + Intergenic
1102444360 12:112990399-112990421 CCTGATTAGCAGTTAGTTGAAGG + Intronic
1103066012 12:117898078-117898100 ACTGGTTGGCAGGTAGTTGATGG - Intronic
1108463948 13:50695595-50695617 TCTGATTGGCAATTGGTTGAAGG + Intronic
1109997498 13:70147985-70148007 TCTGATTGGCAGTTGGTTGAAGG + Intergenic
1110679022 13:78285666-78285688 CCTGATTCCCAGTTCGTTCAAGG + Intergenic
1112261369 13:97881067-97881089 TCTGATTGGCAATTGGTTGAAGG - Intergenic
1117554304 14:56868926-56868948 CCTGATTAGGAGGTAGGGGAAGG - Intergenic
1119064633 14:71512926-71512948 TCTGATTGGCAATTGGTTGAAGG - Intronic
1119554793 14:75545038-75545060 TCTGATTAGCATGTATTTGATGG + Intronic
1119709319 14:76810025-76810047 TCTGATTAACAGTCAGTTGCTGG - Intronic
1125154616 15:36571724-36571746 TCTGAATTGCAGTTTGTTGATGG + Intergenic
1125326075 15:38537194-38537216 CCTCCTTGGCAGTTAGTTGGTGG + Intronic
1127647592 15:60973894-60973916 CCCTATTAGCAATTAGCTGATGG + Intronic
1131322322 15:91406355-91406377 CATGATTTGAAGTGAGTTGATGG + Intergenic
1135045292 16:19150261-19150283 CCTGATAGGCAGTTAGGTGGGGG + Intronic
1138899488 16:61251778-61251800 TCTACTTAGCAGTTAGTTCATGG + Intergenic
1140900747 16:79365037-79365059 CCTAGTTAGAACTTAGTTGATGG + Intergenic
1145392221 17:22464404-22464426 TCTGATTTGCAGTTGGTTAAAGG + Intergenic
1147801416 17:43092061-43092083 CCTGATGACCTGTTAGATGATGG - Exonic
1148996167 17:51711860-51711882 CCTGTTGAGCAGTTAGCAGAGGG + Intronic
1150804279 17:68306965-68306987 ACTGAGTAGCAGATGGTTGAGGG - Exonic
1152387858 17:79985838-79985860 CTTGATTGGCAGTTTGTTGTGGG - Intronic
1155943553 18:31823709-31823731 TCTGATTGGCATTTGGTTGAAGG + Intergenic
1156100906 18:33593606-33593628 GCTGAATATCAGTAAGTTGAAGG - Intronic
1157215801 18:45782500-45782522 CCTGATTGGTAGTTATTTGCTGG + Intergenic
1160187934 18:76689920-76689942 CCTGCTTAGCAGCTAGTTTTTGG - Intergenic
1163060896 19:14760951-14760973 TCTGATTGGCAGTTGGTTGAAGG - Intronic
1168012811 19:53547052-53547074 TATGATTATCAGTGAGTTGAGGG - Intronic
1168519976 19:57042208-57042230 TCTGATTGGCAATTGGTTGAAGG - Intergenic
925231524 2:2237268-2237290 GCTGGTTATCAGTTAGTTGTGGG - Intronic
926762049 2:16286740-16286762 CCTGATTATGAGTTATTGGAGGG - Intergenic
927925161 2:27007234-27007256 CCAGATTGGCAGGTTGTTGAAGG + Intronic
931983513 2:67719721-67719743 CCTGATTTACAGTAATTTGAAGG + Intergenic
932379016 2:71265014-71265036 CTTGATTTGCATTTACTTGATGG + Intergenic
939090964 2:137779982-137780004 CCTGATTTGTAGCTACTTGATGG - Intergenic
941426233 2:165348790-165348812 CCTTTTTGGCAGTTAGTTGAAGG + Intronic
942150701 2:173073935-173073957 ACTAATTAGAAGTTAGTTGCAGG - Intergenic
942533799 2:176941647-176941669 CCTAGTTAGAAGTTAGTTGGTGG + Intergenic
944301474 2:198129414-198129436 TCTGATTGGCAATTGGTTGAAGG - Intronic
945648502 2:212531588-212531610 CCTCATCACCAGTTAGTTGATGG - Intronic
945835195 2:214831335-214831357 CCATATTAGCATTTACTTGAAGG + Intergenic
947558981 2:231129225-231129247 AATGAATAGCAGTAAGTTGATGG + Intronic
948329656 2:237155096-237155118 CATGATTGGCAGCTAGTGGAGGG - Intergenic
1170137698 20:13093299-13093321 CATGTATAGCAGTTAGCTGATGG - Intronic
1173942193 20:46920969-46920991 TATGATTAGCAGTTAGATGAGGG - Intronic
1174913917 20:54635525-54635547 TCTGATTGGCAATTGGTTGAAGG - Intronic
1177283500 21:19017189-19017211 CCAGGTTAGCAGGTAGATGAGGG - Intergenic
1181710625 22:24685026-24685048 GCTGATGGGCATTTAGTTGATGG + Intergenic
1181976621 22:26735447-26735469 CCTGATGGGCTGTTTGTTGAGGG + Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1183164065 22:36134244-36134266 AGTGATCAGCATTTAGTTGAGGG - Intergenic
1184933309 22:47697966-47697988 TCTGATTGGCAATTGGTTGAAGG + Intergenic
1185214755 22:49592187-49592209 TCTGATTGGCAGTTGGTTGAAGG - Intronic
949393550 3:3590077-3590099 CCTCATTAGAGGTTAGTTGGTGG - Intergenic
949891097 3:8734215-8734237 CCTGATTAGCACTTAGGTCATGG - Intronic
950272710 3:11631486-11631508 GCTGATTTGTTGTTAGTTGATGG - Intronic
951773854 3:26286955-26286977 TCTGATTGGCAATTGGTTGAAGG - Intergenic
954720881 3:52561872-52561894 CCTGTTCAGCAGTGAGATGAGGG - Exonic
954842275 3:53522318-53522340 CCTGAGCAGCAGGTAGATGAGGG - Intronic
957176936 3:76823880-76823902 CCTGATTAGCAGTTGTTTTATGG + Intronic
959372574 3:105546717-105546739 CCTGATTATTGGTTAGTTAATGG + Intronic
959894458 3:111590769-111590791 CATCATTAGCTGTGAGTTGAGGG - Intronic
962182794 3:133226098-133226120 TCTGGTTGGCAGTTTGTTGAAGG + Intronic
962626871 3:137234383-137234405 CCTGATTAGAAGGTAGTTTCAGG + Intergenic
967347489 3:188474259-188474281 CCTGATTAACAGCTCCTTGAGGG - Intronic
974117573 4:57598855-57598877 CCTGATGAGCACTTAGCTGCTGG + Intergenic
975862443 4:78691870-78691892 CCTATTTAGCAGTTTATTGAGGG - Intergenic
976538669 4:86247076-86247098 CATGGTTGGCAGTTGGTTGACGG - Intronic
982936598 4:161485835-161485857 CCTCATTAGCATTTAATTAATGG - Intronic
984925938 4:184807008-184807030 CCTTAATAGCAGTTAATAGAAGG - Intronic
988035273 5:25820017-25820039 CCTGATGAGCAGATATTTGTGGG + Intergenic
990765921 5:59182679-59182701 CCTGAGTACCAGTTAATTGTAGG - Intronic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
991503580 5:67301757-67301779 CCTGATGTGCAATTAGTTGGGGG + Intergenic
992476384 5:77105910-77105932 CCTCATTAGCCATTAGGTGAAGG - Intergenic
995083424 5:108080731-108080753 TCTGATTGGCAATTGGTTGAAGG + Intronic
996115590 5:119614761-119614783 TCTGGTTAGCAGGTAGATGACGG - Intronic
997011373 5:129882625-129882647 CCTAATCAGCAGCTAGATGAAGG + Intergenic
997103389 5:130993115-130993137 TTTGATTAGCAGTTTGATGATGG - Intergenic
999119289 5:149196652-149196674 CCTGATTAGCAATCAGAGGAAGG - Intronic
1003843986 6:10153708-10153730 CCTGTGTAGGAGTTACTTGATGG - Intronic
1006625614 6:35395662-35395684 CAGGAATGGCAGTTAGTTGAAGG + Intronic
1006909049 6:37552186-37552208 CCTGTTTGGAAGATAGTTGAAGG - Intergenic
1009912639 6:69951433-69951455 CCAGATTAGAACTTATTTGAAGG + Intronic
1012435870 6:99214914-99214936 TCTCATAAGCAGTTGGTTGATGG - Intergenic
1012538558 6:100330225-100330247 CCTGATTAGAACTTAATTTAAGG + Intergenic
1014341695 6:120216231-120216253 CCTGATTAGAAATCATTTGATGG - Intergenic
1014878451 6:126690754-126690776 CCTCAATAGCAGATAGTTGCGGG - Intergenic
1020402510 7:7794999-7795021 TCTGATTGGCAGTTGGTTGAAGG - Intronic
1022211125 7:28210492-28210514 CCTGTTTACCAGTGAGTTGAAGG + Intergenic
1027148953 7:75718925-75718947 CCTGATTAGGCCTGAGTTGAGGG - Intronic
1029019887 7:97353549-97353571 CCTGACTTGCAGTTATTTAATGG + Intergenic
1029378659 7:100198280-100198302 CCTGAGTTGCAGTATGTTGAGGG + Intronic
1034385866 7:150740628-150740650 CCTGATTTTCTGTAAGTTGAGGG + Intronic
1038389633 8:27183380-27183402 CCTAATTAGAGGTTAGTTGGAGG - Intergenic
1038465658 8:27760369-27760391 CCTGTTAGGCAGTTAGCTGATGG - Intronic
1039628878 8:39086813-39086835 CCTGAATAGCATTTAGTCTAGGG + Intronic
1041257311 8:55990266-55990288 CCTGATTGGCCATTGGTTGAAGG + Intronic
1042617992 8:70670862-70670884 CCTGAATAGCCATTAATTGATGG - Intronic
1044629625 8:94265869-94265891 ACTGAGTAGCATTTACTTGATGG - Intergenic
1046797724 8:118390742-118390764 GATGATTAGCAGTTAATTGAAGG + Intronic
1047028276 8:120848538-120848560 CCTGATGAGCAGTTTGTTGCTGG - Intergenic
1048355777 8:133653138-133653160 CTTGACTAGCTGTTGGTTGAGGG - Intergenic
1049523799 8:143110163-143110185 ACTGATTGGCAATTGGTTGAAGG - Intergenic
1049977440 9:873140-873162 TCTGATTTGCAGTTTGCTGATGG + Intronic
1051369841 9:16348975-16348997 CCTGACTAACAGTTCTTTGAGGG + Intergenic
1055832752 9:80401531-80401553 CCTGAATGGCAGTTGGTTGAAGG - Intergenic
1056067072 9:82947550-82947572 CCTGAGTATCACTTAGTTTAAGG + Intergenic
1057590209 9:96366408-96366430 TCTGATTTGCAATTTGTTGAGGG - Intronic
1058937643 9:109783623-109783645 CCTGACTTTCAGTCAGTTGAAGG - Intronic
1059059157 9:111016666-111016688 ACTGAGTAGCAGTAAGTTCAAGG - Intronic
1188398246 X:29712581-29712603 TATTGTTAGCAGTTAGTTGATGG + Intronic
1189608733 X:42708432-42708454 CCTAGTTAGAAGTTAGATGATGG + Intergenic
1189758771 X:44299477-44299499 TCTGATTGGCAATTGGTTGAAGG - Intronic
1190635051 X:52425106-52425128 CAGGATAAGCTGTTAGTTGATGG - Intergenic
1190653681 X:52592296-52592318 CAAGATAAGCTGTTAGTTGATGG - Intergenic
1190699964 X:52980330-52980352 CATGATAAGCTGTTAGTTGATGG + Intronic
1190999720 X:55647154-55647176 CAGGATGAGCTGTTAGTTGATGG + Intergenic
1192632210 X:72786284-72786306 CCAGATTAGCAAATAGTTAAAGG - Intronic
1192649499 X:72934517-72934539 CCAGATTAGCAAATAGTTAAAGG + Intronic
1194716474 X:97291873-97291895 CCTGACAACCAGATAGTTGAAGG - Intronic
1194784604 X:98066500-98066522 CCTGATTAAGAGTTTGTTGTTGG + Intergenic
1195202082 X:102561779-102561801 CCTGGTTTTCAGTGAGTTGAGGG + Intergenic
1196729516 X:118926895-118926917 CATGATTTGGAGTTAGGTGAAGG - Intergenic
1198439413 X:136647724-136647746 TCTGAGAAGCAATTAGTTGATGG + Intergenic
1200444923 Y:3248864-3248886 TCTGATTGGCAATTGGTTGAAGG - Intergenic