ID: 1102444481

View in Genome Browser
Species Human (GRCh38)
Location 12:112991279-112991301
Sequence CAGACAGCACAAATTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102444481_1102444484 23 Left 1102444481 12:112991279-112991301 CCAGTAGCAATTTGTGCTGTCTG 0: 1
1: 0
2: 1
3: 5
4: 131
Right 1102444484 12:112991325-112991347 AAACCCCAACTATCTGAGACAGG 0: 1
1: 9
2: 76
3: 267
4: 742

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102444481 Original CRISPR CAGACAGCACAAATTGCTAC TGG (reversed) Intronic
905035430 1:34915143-34915165 CAGATAACACAAATTGCTCATGG - Intronic
917180646 1:172293533-172293555 CAGTCAGTACAAATTGCTGTGGG + Intronic
917499361 1:175572054-175572076 CAGACAGCACAGACTGCTGAGGG - Intronic
918217046 1:182400852-182400874 CTGAGAGCACAAATTCCCACAGG - Intergenic
918335408 1:183506021-183506043 CAGACAGAACAAATTGTGAGAGG - Intronic
919518451 1:198556623-198556645 TAGATAGCAGAAATTGCTAGAGG + Intergenic
919722038 1:200848447-200848469 CAGCCAGACCAAATTGCTAATGG + Exonic
921949280 1:220912300-220912322 TACACAGCAAATATTGCTACAGG - Intergenic
923816857 1:237389783-237389805 CAGACATCCCAATTTCCTACTGG - Intronic
1064246822 10:13674868-13674890 CAGACAACACCAATTTCAACGGG + Intronic
1064618432 10:17188812-17188834 CGGAAATCACAAATAGCTACTGG - Intronic
1065964485 10:30760071-30760093 CAGACAGCATCACCTGCTACAGG - Intergenic
1070935113 10:80288008-80288030 CAGACAGTACAAAATGCTCTTGG + Intronic
1078475881 11:11629491-11629513 TAGAAAGCACAAATTGCAAGTGG + Intergenic
1079033269 11:17001404-17001426 CAGACAGCTCAATTTGCAAGTGG + Intronic
1079092162 11:17488731-17488753 CAGAGAGGAGAAGTTGCTACAGG + Intergenic
1079242100 11:18728580-18728602 CAGACAGAACACATTGCAGCAGG + Exonic
1080831437 11:35896789-35896811 CAGACAGCAATAAGTCCTACAGG + Intergenic
1081240086 11:40694781-40694803 CACACTGCACAAATTGATATAGG + Intronic
1081824123 11:46030873-46030895 CAAAAAGTAGAAATTGCTACTGG - Intronic
1084027061 11:66457388-66457410 GAGACAGCACCAATTGACACTGG - Intronic
1084744739 11:71162034-71162056 CAAAAAGCAGAAAATGCTACAGG - Intronic
1085325471 11:75603141-75603163 CAGACAGGACAGATTGCTGAGGG + Intronic
1086007479 11:82054862-82054884 CAATCAGCACTAACTGCTACAGG - Intergenic
1086539323 11:87888902-87888924 CAGACAGCACCAATTGCTAGTGG - Intergenic
1087647679 11:100827449-100827471 AAGACAGCACAACTTGCAGCAGG + Intronic
1087937442 11:104051077-104051099 CAGGCAGCACAAGGTGATACAGG + Intronic
1090862721 11:130668829-130668851 CAGGCACCCCAAATTGCTTCAGG + Intergenic
1093222669 12:16441963-16441985 CTGACAGCACCAAATGCTGCTGG - Intronic
1094015035 12:25853704-25853726 CAGACAGCACAGAATGCTCTGGG + Intergenic
1098051584 12:66459587-66459609 CAGACTGTGCCAATTGCTACAGG + Intronic
1100712654 12:97274684-97274706 CTGACAGCAGAAAGTGCTAAAGG + Intergenic
1101643827 12:106609291-106609313 CAGAAAGCAGAAATTTCTTCCGG + Intronic
1102444481 12:112991279-112991301 CAGACAGCACAAATTGCTACTGG - Intronic
1102583152 12:113904743-113904765 CATACAGCACAAATAACCACTGG - Intronic
1106394456 13:29366911-29366933 CTCACATCACAAACTGCTACAGG - Intronic
1107101640 13:36599784-36599806 GAGACAGCACACCATGCTACAGG + Intergenic
1111456891 13:88496152-88496174 CAGACAGGGCAAATTAATACAGG - Intergenic
1114927939 14:27428010-27428032 GAGACAGCAAAAATTGGCACTGG - Intergenic
1115109066 14:29799416-29799438 CAGACACCTGAAATTGCTCCGGG + Intronic
1122656555 14:103265354-103265376 CAGAGAGAACTAATTGCCACTGG - Intergenic
1123458135 15:20444321-20444343 CAGGCAGCACCAACTCCTACAGG - Intergenic
1123659933 15:22556088-22556110 CAGGCAGCACCAACTCCTACAGG + Intergenic
1124264438 15:28220546-28220568 CAGGCAGCACCAACTCCTACAGG - Exonic
1124313794 15:28650583-28650605 CAGGCAGCACCAACTCCTACAGG + Intergenic
1128968915 15:72088738-72088760 CAGTCAGAACAAAATACTACTGG - Intronic
1130691904 15:86088809-86088831 CTGACAGCCCAATTAGCTACCGG + Intergenic
1131087837 15:89591887-89591909 CCGGCACCACAAACTGCTACAGG - Intronic
1131767382 15:95693524-95693546 CAGACAGCATCACATGCTACAGG - Intergenic
1134216935 16:12323312-12323334 CAGACAGCACAACTCACGACTGG - Intronic
1137448401 16:48547593-48547615 CAGTCAGCACACATTGCTTTCGG + Intronic
1139706542 16:68744813-68744835 CAGACAGCACCAAGTCCTCCTGG - Intronic
1139830995 16:69798082-69798104 CAGACATCACAGAGTGCTAAGGG - Intronic
1140919549 16:79524424-79524446 CAGACAGGAATAATTGCAACAGG - Intergenic
1143345125 17:6243585-6243607 CAGACAGCACAAATGCCCATGGG - Intergenic
1146015289 17:29228241-29228263 AATACAGCCCCAATTGCTACTGG + Intergenic
1146553062 17:33798812-33798834 CAAACAGCAGAAATTGCTGGTGG - Intronic
1146976878 17:37120898-37120920 AACATAGCACAAATTGCCACTGG + Intronic
1149326303 17:55533561-55533583 CAGACAAATCAAATAGCTACTGG - Intergenic
1153366910 18:4266650-4266672 CAGACAGCACAAGTTTCTCCAGG + Intronic
1154344659 18:13531943-13531965 CACACAGCACAAACAGCCACTGG - Intronic
1157831948 18:50864145-50864167 CTGACAAAAGAAATTGCTACAGG + Intergenic
1163814118 19:19453380-19453402 CAGACAAGACAGCTTGCTACAGG - Intronic
930303677 2:49650211-49650233 AAGACAGCAATAATTGCTAGAGG - Intergenic
932648856 2:73533156-73533178 TAGACAGCACAGCTTGCTCCAGG - Intronic
933476476 2:82798288-82798310 CTGACAGAAAAATTTGCTACTGG - Intergenic
936155771 2:110046666-110046688 CAGAGAGCACAAAATGCAGCTGG + Intergenic
936188917 2:110324762-110324784 CAGAGAGCACAAAATGCAGCTGG - Intergenic
936440859 2:112551585-112551607 CAGACAGCACAATTGCCTCCAGG - Intronic
939627211 2:144492517-144492539 TAGACTGAACAACTTGCTACAGG + Intronic
944792309 2:203143613-203143635 CATACAGCCCTAATTGCTATTGG - Intronic
945809660 2:214533390-214533412 TAAACAGCACAAATTGCAGCTGG + Intronic
945818930 2:214639148-214639170 CAGAGAGCACAAATAGCCACAGG + Intergenic
1169387307 20:5161927-5161949 CAAACAGCAAAAATAGCTAATGG - Intronic
1169985368 20:11437431-11437453 CAGACACCTCAAATATCTACTGG + Intergenic
1171303420 20:24084139-24084161 CAGACAGAACAATATGCTGCAGG - Intergenic
1176373668 21:6076975-6076997 CAGACGGCACAGAGTGCTTCCGG - Intergenic
1177587188 21:23112238-23112260 CTGACAGCATCATTTGCTACAGG + Intergenic
1177877346 21:26649722-26649744 CAGACCTCACAAAGGGCTACAGG + Intergenic
1179749809 21:43461268-43461290 CAGACGGCACAGAGTGCTTCCGG + Intergenic
1180567709 22:16689264-16689286 CAGGCAGCGCAAATTGGAACTGG + Intergenic
1181623623 22:24107335-24107357 CAGAGAGCAGAGATTGGTACTGG - Intronic
1184361243 22:44020122-44020144 CAGACAGCACAAGATCCCACAGG + Intronic
951931295 3:27970094-27970116 CAGACATAACAAATTGCCTCAGG + Intergenic
952437854 3:33290023-33290045 CAGAAAGCAGAAGGTGCTACTGG + Intronic
954683782 3:52359697-52359719 CAGACAGCACGACATGCTGCAGG + Intronic
956376806 3:68621738-68621760 CAAACAGCAATAATTGCTCCTGG + Intergenic
956860711 3:73321074-73321096 CAGACATCTCTAATTGATACTGG - Intergenic
957833709 3:85556634-85556656 GAGAGAGCACAGATTGCTCCAGG + Intronic
962011448 3:131395418-131395440 CAGCCCCCACAAATAGCTACAGG + Intergenic
965696311 3:171411927-171411949 CAGACAGAACCAGTTCCTACAGG - Intronic
966438962 3:179922309-179922331 GAGAAAGCACAAGATGCTACGGG + Intronic
970988856 4:22190205-22190227 GAGACATCACAAATTTCTAATGG - Intergenic
973176632 4:47214001-47214023 CAAACAGCATAAATTACTCCTGG + Intronic
975411395 4:74055200-74055222 AAGACAGCACATATTGTTACAGG - Intergenic
975775002 4:77776920-77776942 AATACAGCCCAAATTGCTGCTGG + Intronic
976269281 4:83214628-83214650 CAGATAGAAAAAAGTGCTACAGG - Intergenic
982249040 4:153385870-153385892 CAAACAGCCCAAATTACTGCTGG - Intronic
982933828 4:161444283-161444305 CAGACAGCAAAAATTACTGTAGG + Intronic
983746546 4:171207364-171207386 CTGACACCACAAAATGTTACAGG - Intergenic
984203171 4:176752853-176752875 CAGACTTCACAAATAGCAACTGG - Intronic
984260250 4:177436312-177436334 AAGACAGGACATATTGCTGCTGG - Exonic
985348573 4:189034082-189034104 CAGACAGCACAGACTGCCAGAGG - Intergenic
985811049 5:2085924-2085946 CAGACAGTAGAAAGTGATACTGG + Intergenic
987419542 5:17702633-17702655 CAGACAGGACAAATTTTCACTGG - Intergenic
993049126 5:82905504-82905526 AAAACAGAACAAATTGCTAATGG - Intergenic
993885390 5:93409882-93409904 CAGACAGCACACAGTGCTATTGG + Intergenic
994979308 5:106852957-106852979 CAGACAGAACAAATTACGAAGGG + Intergenic
995365798 5:111358744-111358766 CAAACAACACATATTGCCACTGG - Intronic
995488909 5:112669229-112669251 CAGACAGCTCTACTTGCAACTGG + Intergenic
996465009 5:123790357-123790379 CAAACAGCACCACATGCTACAGG + Intergenic
1001195433 5:169669307-169669329 CATAAAGCACAAAATGTTACAGG + Exonic
1004005657 6:11635100-11635122 GAGTCAGCACAGATGGCTACAGG - Intergenic
1004562738 6:16766093-16766115 CAGCCATAACAAATTGCTCCAGG - Intergenic
1012263535 6:97114316-97114338 CACCCAGCACAAAATGCTCCCGG - Exonic
1012670646 6:102042507-102042529 CAGACAGACCAAATTGCAAAAGG + Intronic
1013265220 6:108489761-108489783 CAGACAAACCAAAATGCTACAGG + Intronic
1015236498 6:130977430-130977452 CAGGCAGGACAGTTTGCTACAGG - Intronic
1015426261 6:133071526-133071548 AAAACATCACAAATTGCAACTGG - Intergenic
1017045845 6:150346477-150346499 CAGGCAGCACAAGTTACTTCAGG - Intergenic
1019705955 7:2497530-2497552 CGGGCAGCACAGATTGCTTCTGG - Intergenic
1025255842 7:57383453-57383475 CAGACAGCACCAAATGTTCCCGG - Intergenic
1028379573 7:90184149-90184171 TAGTCAGCACAAATTACTTCTGG + Intronic
1032755975 7:134891296-134891318 CAGAGAGCACTGATTGCTTCGGG - Intronic
1037160537 8:15766641-15766663 CAGTAAGCACAAAATGCTACTGG - Intronic
1039250627 8:35660482-35660504 CAGAGAGCACAGAATGCTCCAGG - Intronic
1046471676 8:114683086-114683108 CTGACAGAAGAAATTGCTAAGGG - Intergenic
1051148443 9:14055452-14055474 CTGCCATCACAAATTGCTATAGG + Intergenic
1056277177 9:85004760-85004782 AAGACAGCTCAAATTGTTTCAGG + Intronic
1056348801 9:85726638-85726660 CAGACAACACAAAATGGTATAGG - Intronic
1189312824 X:40032206-40032228 CAGACAATACAAATTCCTCCAGG + Intergenic
1189942517 X:46139420-46139442 GAGACATCACAAATTGATCCAGG + Intergenic
1190803110 X:53811035-53811057 CTGACAACACCAATTGCTGCTGG + Intergenic
1191053110 X:56215459-56215481 CATAGAGCACCAATTGCTTCTGG - Intergenic
1195080116 X:101362590-101362612 CAGACAGCCAAAAATGCTATGGG - Exonic
1198394167 X:136206371-136206393 CAGACAGGACAAATGACCACAGG - Intronic
1198439944 X:136653334-136653356 GTGACAGCACAAATTCCTTCTGG + Intronic
1199533972 X:148881119-148881141 CAGACAGCAGCACTTGATACTGG - Intronic