ID: 1102445857

View in Genome Browser
Species Human (GRCh38)
Location 12:113002332-113002354
Sequence AGCACAGCTGTGCCAAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 199}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102445856_1102445857 -4 Left 1102445856 12:113002313-113002335 CCACGTGTGCTTCAGAGGGAGCA 0: 1
1: 0
2: 1
3: 11
4: 161
Right 1102445857 12:113002332-113002354 AGCACAGCTGTGCCAAAACCTGG 0: 1
1: 0
2: 0
3: 20
4: 199
1102445851_1102445857 18 Left 1102445851 12:113002291-113002313 CCTCCCATCTCTAGAGACTTAAC 0: 1
1: 0
2: 2
3: 38
4: 155
Right 1102445857 12:113002332-113002354 AGCACAGCTGTGCCAAAACCTGG 0: 1
1: 0
2: 0
3: 20
4: 199
1102445852_1102445857 15 Left 1102445852 12:113002294-113002316 CCCATCTCTAGAGACTTAACCAC 0: 1
1: 0
2: 0
3: 31
4: 213
Right 1102445857 12:113002332-113002354 AGCACAGCTGTGCCAAAACCTGG 0: 1
1: 0
2: 0
3: 20
4: 199
1102445853_1102445857 14 Left 1102445853 12:113002295-113002317 CCATCTCTAGAGACTTAACCACG 0: 1
1: 0
2: 1
3: 4
4: 68
Right 1102445857 12:113002332-113002354 AGCACAGCTGTGCCAAAACCTGG 0: 1
1: 0
2: 0
3: 20
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102445857 Original CRISPR AGCACAGCTGTGCCAAAACC TGG Intronic
900799820 1:4730364-4730386 GGCACAGCTGTTCCAGAGCCAGG + Intronic
902077422 1:13798932-13798954 AACAAAGCTGTTCCAAAAACCGG + Intronic
902302448 1:15511744-15511766 AGCAGACCTGAGCCCAAACCTGG - Intronic
905396957 1:37672873-37672895 AGCACAGGTGTGTCAATTCCTGG - Intergenic
905533551 1:38701042-38701064 AGCACAGCTGTGGGCAAACAAGG - Intergenic
905581031 1:39082517-39082539 GGCAAAGCTGTGCCAGGACCTGG + Intronic
908735989 1:67277643-67277665 AGCGCAGCAGTGCCAGAGCCAGG + Intergenic
910278705 1:85474913-85474935 CACACAGCTGTGACAAAGCCAGG - Intronic
911935229 1:103961058-103961080 AGCAAAGCTGTGGAAAAGCCTGG - Intergenic
912262579 1:108123649-108123671 AGCACAGCTGTTTGAAAACTTGG - Intergenic
914396607 1:147275579-147275601 AGCACAGATGAGCTAAAACCTGG - Intronic
916426127 1:164682325-164682347 GGAAGAGCTGTACCAAAACCAGG - Intronic
918058193 1:181040723-181040745 AGAACAACTGTTTCAAAACCAGG + Intronic
918983275 1:191591260-191591282 ATCACAGCTGTGCCAACATATGG - Intergenic
919771910 1:201166857-201166879 AGCAGAGCTGCGGCAGAACCAGG - Intronic
920056476 1:203196638-203196660 AACACAGCTGTCCCACATCCAGG - Intergenic
920110578 1:203584286-203584308 GGCACAGCTGTGTCCAAAACAGG + Intergenic
920677033 1:208045300-208045322 AGGGCAGCAGTGCAAAAACCAGG + Intronic
920977435 1:210799291-210799313 ACCCCAGCTGTGCCATATCCTGG - Intronic
924757152 1:246951760-246951782 GGCCCAGCTGTGCCAGCACCTGG - Intronic
924932575 1:248743828-248743850 AGCACAGAGCTGCCAAGACCCGG + Intronic
1062802814 10:392595-392617 AGCACAGCTCTGCCCAGCCCTGG + Intronic
1063250464 10:4268384-4268406 ATCACAGCTGTACCTAGACCCGG + Intergenic
1064911236 10:20404257-20404279 ACCACAGCAGTGACCAAACCTGG - Intergenic
1067353496 10:45500466-45500488 TGTACAGCAGTGGCAAAACCAGG + Intronic
1070096292 10:73340760-73340782 AGCAAAGCTGTGGCCAAGCCTGG - Intronic
1070398228 10:76031474-76031496 AGCACTGTTCAGCCAAAACCTGG - Intronic
1070452891 10:76579663-76579685 AGGACAGCTGGGCCACCACCAGG + Intergenic
1070785971 10:79162411-79162433 AGGGCTGCTGTGCCAAGACCAGG - Intronic
1071650559 10:87390555-87390577 AGCACAATTGGGACAAAACCTGG - Intergenic
1071725477 10:88194136-88194158 AGAACAGCTGGGCCTAAAGCAGG + Intergenic
1073472130 10:103729334-103729356 AACACAGCTGAGGCAAATCCAGG + Intronic
1074685772 10:115961161-115961183 AGCACAAATGTGCCAACGCCAGG - Intergenic
1075762276 10:124865855-124865877 AGCTCAGCTGTCCACAAACCTGG + Intergenic
1076258344 10:129046094-129046116 TGCACAGCTGCACCAAACCCTGG + Intergenic
1076342032 10:129755856-129755878 AGCACAGCGGTGGCAGAGCCAGG + Intronic
1079673962 11:23202314-23202336 AGCAAAGCTGTGGCCAAGCCTGG + Intergenic
1079839385 11:25376726-25376748 AGCACAGCAGTGGCAAAGCATGG + Intergenic
1080794530 11:35551237-35551259 AGCACAGTTGTGGCAGAACTGGG - Intergenic
1081346545 11:41994462-41994484 AGCAGAACTGTGTAAAAACCAGG + Intergenic
1081961022 11:47137539-47137561 AGAACAGCTCTACCAAGACCAGG + Intronic
1083994185 11:66264093-66264115 GGCCCTGCTGTGCCAGAACCAGG + Exonic
1085410170 11:76286119-76286141 AGCACCCCTGTGCCTAAGCCTGG - Intergenic
1085810027 11:79671507-79671529 AGCACAGATGGGCCAAATTCTGG - Intergenic
1086018886 11:82201272-82201294 AGCTCAGCTGAGACAAAACTTGG - Intergenic
1088520387 11:110691829-110691851 AGCACAGCTGAGACAACAGCTGG + Intronic
1090091765 11:123704233-123704255 AGGGCAGCCGTGCCAACACCTGG + Intergenic
1094454886 12:30621063-30621085 ATCACAGCAGAGCCAAAAGCTGG + Intergenic
1095408533 12:41894997-41895019 AGCACAGCCTTGCCATAAGCGGG - Intergenic
1096248102 12:50007400-50007422 AGAACAGCTTTGCCAATAGCAGG - Intronic
1096486638 12:51986608-51986630 AGCACAGATTTGGCAATACCAGG - Intronic
1096781890 12:53996503-53996525 AGCACCGCTGGGGCAAACCCAGG - Intronic
1098059773 12:66549208-66549230 AGCACATCAGTCCCAAAACAGGG + Intronic
1101438696 12:104686350-104686372 AGCACAGCTGTCCCACATTCTGG - Intronic
1102445857 12:113002332-113002354 AGCACAGCTGTGCCAAAACCTGG + Intronic
1105306557 13:19173098-19173120 AGTTCAGCTGTGGCACAACCAGG - Intergenic
1106188030 13:27425746-27425768 AGCCTAGCTCTGCCAAAAACTGG - Intronic
1106409103 13:29498779-29498801 AGCACAACTGTGGGAAAACCAGG - Intronic
1113561443 13:111284811-111284833 AGCACACCTGAGCCAGAGCCAGG - Intronic
1114515888 14:23300257-23300279 GGAACATCTGTGCCAAAAACTGG + Intronic
1116869699 14:50059673-50059695 AGTACAGCTGTCCCCAAACCAGG - Intergenic
1118367309 14:65106915-65106937 AGAACATGTGTGCCAAAAGCAGG + Intergenic
1119427335 14:74544236-74544258 AGCACAGCTGTTCCCCAAGCTGG + Intronic
1124221814 15:27856003-27856025 AGCACAGCCAGGCCAACACCTGG - Intronic
1124466836 15:29947891-29947913 AGCACAGCTGTGCCAACCCTGGG + Intronic
1125988611 15:44081849-44081871 AGGTCAGCTGTGCCACAATCTGG + Intronic
1126911826 15:53425634-53425656 AGCACAGCTATTCCCAACCCTGG + Intergenic
1128231088 15:66035953-66035975 ACCACAGCTGTGCTGAAAGCAGG - Intronic
1128615891 15:69109366-69109388 TTCAAAGCTGTGCCAAAAGCAGG - Intergenic
1132199954 15:99944487-99944509 AGCACAGCTGTGTGAACTCCAGG + Intergenic
1135986731 16:27189630-27189652 AGCAAAGCTGTGGCCAAGCCTGG + Intergenic
1136025898 16:27469048-27469070 AGCACAGCTGTGACTAAAAGAGG + Intronic
1139624638 16:68176542-68176564 GGTACAGCAGTGCCAAAAACTGG - Intronic
1141537385 16:84691877-84691899 AGCATGGCCGTGCCAACACCTGG + Intergenic
1142237296 16:88928244-88928266 AGGACAGCTGTGCCACACGCCGG - Intronic
1143376101 17:6468569-6468591 TGCCCCGCTGTGCCCAAACCTGG + Intronic
1144117716 17:12115791-12115813 AGCAGAGCTGTCCCAGAAGCAGG - Intronic
1146526626 17:33572433-33572455 ATCACAGCTCTGCCATAACCCGG - Intronic
1147558971 17:41497346-41497368 GGCACAGCTGTGCCAATTCATGG + Intergenic
1149525832 17:57355094-57355116 GGACCAGCTGTGACAAAACCAGG - Intronic
1151669817 17:75565826-75565848 AGGACAGCTGGGTCACAACCCGG - Intronic
1151883860 17:76911901-76911923 AGCCCTGCCCTGCCAAAACCTGG - Intronic
1152926103 17:83088484-83088506 AGCACAGATGTGGCCAAGCCAGG - Intronic
1153908809 18:9688253-9688275 AGAACAGAAGTGCCAACACCTGG - Intergenic
1154332588 18:13442015-13442037 AGAAAAGATGTGACAAAACCTGG - Intronic
1156280906 18:35637289-35637311 AGCAGAGATGGGCCAAAAGCTGG + Intronic
1157560378 18:48641279-48641301 TGCACAGGTGTGCCAAGAACAGG + Intronic
1157573638 18:48730023-48730045 AGCACAGCTGTGGACAAAGCCGG - Intronic
1158984132 18:62796394-62796416 AGCACAGTAGTTCCAAAACATGG - Intronic
1159746531 18:72242989-72243011 AGGGCAGCTTTGACAAAACCTGG + Intergenic
1160090832 18:75825270-75825292 AGCACCACTGTGCAAAAACAAGG + Intergenic
1163263609 19:16205583-16205605 AGCACAGATGTGCCATGAACAGG + Intronic
1165459240 19:35934770-35934792 ACAACAGCTATGCTAAAACCTGG - Intergenic
1165620927 19:37246851-37246873 AGCACAGCTGTCAAAAAAGCAGG + Exonic
1166782412 19:45349476-45349498 GGCCCTGCTGTGCCAGAACCAGG + Exonic
1167490463 19:49790060-49790082 AGCACAGCGGTGTCAAACACCGG + Intronic
925315517 2:2919830-2919852 AGCACTCCTGTACTAAAACCCGG + Intergenic
926354812 2:12032036-12032058 AGCACACAGGTGCCAAGACCTGG + Intergenic
928420583 2:31135322-31135344 AGCACAGTGGTACCGAAACCTGG - Intronic
930512557 2:52364167-52364189 AGCACAGCTTTGATAAAAGCAGG + Intergenic
933949984 2:87320729-87320751 AGCACAGCTGTGATACAGCCAGG - Intergenic
935756898 2:106283424-106283446 GGCCCAGCTGTGAGAAAACCTGG + Intergenic
936330206 2:111540868-111540890 AGCACAGCTGTGATACAGCCAGG + Intergenic
937035873 2:118781409-118781431 AGCACAGATGTGTTAAAATCAGG - Intergenic
937690652 2:124751084-124751106 AGCACAGATGTGCCTGAACCTGG + Intronic
938071135 2:128309060-128309082 AGACCAGCTGGGCCAAATCCTGG - Intronic
938295355 2:130174943-130174965 TGCACAGCAGTGCCAAGACTTGG - Exonic
940032038 2:149273875-149273897 TGCAGAGCTAGGCCAAAACCAGG - Intergenic
940192195 2:151053794-151053816 AGCAGAAATGTGCCAACACCTGG + Intergenic
940704411 2:157085918-157085940 ATCATAGCTGTGCCAGAAACTGG + Intergenic
940718794 2:157258809-157258831 AGCACAGCAGTGCCGAAGTCTGG + Exonic
945374228 2:209060669-209060691 AGCACAGCTTTGTCCCAACCAGG - Intergenic
946726687 2:222668404-222668426 ACCACAGCTGTGGCAAGTCCTGG - Intergenic
947291774 2:228583728-228583750 AGCACAGCTGCAGCAAAACCTGG + Intergenic
947472930 2:230414726-230414748 AGGACAGCTGTGCCCAAAAGAGG + Intergenic
948363246 2:237437400-237437422 AGCACAGCCCTGCCCACACCTGG + Intergenic
948858935 2:240743578-240743600 GGCCCAGCTGTGCCACACCCTGG - Intronic
1168954942 20:1828190-1828212 AGCACTGCTGGGCCAAGACAAGG - Intergenic
1169914311 20:10671981-10672003 AACACAGCTGTTCCAGAGCCCGG + Intronic
1171481290 20:25457773-25457795 AGCACAGCTGTGCCCTATGCAGG - Intronic
1172321187 20:33996004-33996026 AGTACACCTGTGCTTAAACCTGG - Intronic
1172745385 20:37203708-37203730 AGGACAGATGTGACAAAACCTGG - Intronic
1175774424 20:61644177-61644199 AGCTGAGCTTTGCCAAAACCAGG + Intronic
1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG + Intronic
1177037487 21:16061213-16061235 AGCAAAGTTGTGGCCAAACCTGG - Intergenic
1178422168 21:32451631-32451653 AGCACAGCCCTGCCAACACCTGG - Intronic
1179463710 21:41556565-41556587 CACAGAGCTGTGCCTAAACCAGG + Intergenic
1179958409 21:44754099-44754121 AGCAAAGCGGTTCCAAACCCTGG - Intergenic
1180693462 22:17737271-17737293 AGCACATCTGTCCCATAACCAGG - Intronic
1181181374 22:21070867-21070889 AGTTCAGCTGTGGCACAACCAGG + Intergenic
1181486106 22:23232624-23232646 ATCCCAGCTGGGCCAGAACCTGG - Intronic
1182487958 22:30650554-30650576 AGCTCAGATGTACCAAAGCCAGG - Intronic
1182806084 22:33071802-33071824 AGCACAGCAGTTCCCAAACGTGG - Intergenic
1183189223 22:36311004-36311026 GGCACAGGTGTGCTAGAACCGGG + Intronic
1183472300 22:38016197-38016219 GGCACAGCTGGGCCAAAGCCTGG + Intronic
1184549035 22:45194561-45194583 AGTACAAATGTGCCAACACCAGG + Intronic
1184639449 22:45861539-45861561 AGCACAGCTGTGAGAAAGCCAGG - Intergenic
1184689747 22:46112150-46112172 TGCACAGCAGGGCCAGAACCAGG + Intronic
1185151682 22:49167429-49167451 AGCACAGCTGGGCCTAGCCCAGG + Intergenic
949485002 3:4529607-4529629 AGCAATCCTGTGCCAAAACTAGG + Intronic
950691166 3:14659263-14659285 ATTACAGCTGTGCTAAAACAGGG + Intronic
950700450 3:14741937-14741959 ACCACTGCTGTGGCAACACCTGG - Intronic
953233376 3:41084673-41084695 AACACAGGTTTGCCAACACCCGG + Intergenic
956702491 3:71970768-71970790 AGTGCAGCTCTGCCAACACCTGG + Intergenic
958457186 3:94346761-94346783 AGACCAGCTGTGCCAAAATTAGG - Intergenic
959389800 3:105759653-105759675 AGCAAAGCTGTGGCCAAGCCTGG - Intronic
959573601 3:107910819-107910841 AGCACGGCCCTGCCAACACCTGG + Intergenic
961046861 3:123714618-123714640 AGCACAGCTGTGGGGAAACCCGG - Intronic
961804586 3:129480126-129480148 AGCTCAACTCTGCCAAAACGTGG - Intronic
962658425 3:137573848-137573870 AGCTCACCTGTGCCAGAACATGG + Intergenic
968008574 3:195259107-195259129 AGCACAGCTGTGCTATCCCCAGG + Intronic
968992927 4:3926870-3926892 AGCACAGCCCTGCCAACACCTGG + Intergenic
969310959 4:6353067-6353089 AGCACGGCCCTGCCAACACCTGG + Intronic
969822547 4:9731491-9731513 AGCACAGCCCTGCCAACACCTGG - Intergenic
969907618 4:10411553-10411575 AGTAGAGCTGTCCCAAAAGCAGG - Intergenic
970245249 4:14054743-14054765 ATCACAGATGTGCCAAACTCTGG + Intergenic
971791231 4:31172511-31172533 AGAACAGCTGTGACATCACCAGG - Intergenic
974894970 4:67927430-67927452 AGCACACCTGTGCCAGTGCCTGG + Intronic
976922722 4:90458027-90458049 AGCACAGTTGTGACAAAGCCTGG - Intronic
979159290 4:117438461-117438483 AGTACAGCTCTCCCAACACCTGG + Intergenic
979766165 4:124466743-124466765 ATCACAGCTGTGACACAATCAGG + Intergenic
983692016 4:170482063-170482085 AGCACAGCTGGGGCAAAGCAAGG + Intergenic
984188955 4:176581920-176581942 AGGAGAGCTGTGATAAAACCTGG + Intergenic
984526817 4:180867209-180867231 AGCAAAGTTGTGGCCAAACCTGG - Intergenic
984589496 4:181601227-181601249 AGTACAGCCCTGCCAATACCTGG - Intergenic
987231608 5:15899585-15899607 AGCACTGCTGGGGCAAAACTAGG - Intronic
990833845 5:59992008-59992030 AGCACAGCTGGGTTAAAAGCAGG + Intronic
992936784 5:81715390-81715412 ATAACAACTATGCCAAAACCAGG + Intronic
1000031576 5:157406531-157406553 TGCACAGCTCTACCAAAACATGG + Intronic
1001289153 5:170444207-170444229 AACGCAGCTCTGCCAACACCCGG - Intronic
1001309434 5:170600344-170600366 GGAACAGCTGTGCTAAAGCCTGG - Intronic
1003635616 6:7828948-7828970 AGCACCACTGTGCCAAGCCCTGG - Intronic
1003779188 6:9404096-9404118 ATCACAGCAGTGCCAAAATTGGG + Intergenic
1005278885 6:24249451-24249473 AGCACAGCTGTGAGCAAAGCTGG - Intronic
1007946246 6:45829617-45829639 AGTATTGCTGTGCCAAATCCAGG - Intergenic
1008683987 6:53903875-53903897 AGCAGAGCTCTACCAGAACCAGG - Intronic
1012522604 6:100138679-100138701 TGCACAGTTGTGCGACAACCTGG + Intergenic
1014160094 6:118157745-118157767 AGCACAGCTGGGATAAAAGCAGG - Intronic
1016187014 6:141209575-141209597 ACCAAATCTGTGCCAAAATCAGG - Intergenic
1016254644 6:142089124-142089146 AGCAAAGCTGTGGGAAAAGCAGG - Intergenic
1018778150 6:167037788-167037810 AGAACAAGTGTGCCAACACCTGG - Intronic
1018833308 6:167462983-167463005 CGCACGGCTCTGCTAAAACCTGG - Intergenic
1018998062 6:168725142-168725164 GGCACAGCTGTGGGAAAGCCTGG + Intergenic
1019068355 6:169321611-169321633 TGCACAGCTGTGGCAACAGCCGG - Intergenic
1019665164 7:2248376-2248398 AGCACCGCTGTGCCCAACACGGG + Intronic
1022415505 7:30173529-30173551 AGCTGAGCTCTGCCAAACCCAGG + Intergenic
1022499235 7:30872196-30872218 AGCACAGCTCTGCCTGACCCAGG - Intronic
1022866627 7:34428395-34428417 AGCACAGCTATGATAAAACCAGG + Intergenic
1024090025 7:45929170-45929192 AGCACAGCCCTGCCATCACCTGG + Intergenic
1024975994 7:55114013-55114035 TCCACAGAGGTGCCAAAACCAGG + Intronic
1027822327 7:83062540-83062562 AAAACAGCTCTGCCAATACCTGG + Intronic
1027852659 7:83468381-83468403 AGCTCAGCTGAGCCAAAATGTGG - Intronic
1029186238 7:98740914-98740936 AGGACAGCTGTTCCCAATCCAGG - Intergenic
1033143006 7:138844451-138844473 AGCAAACCGGGGCCAAAACCTGG + Exonic
1035604699 8:922028-922050 TGCCCAGCTGTGCCACACCCGGG - Intergenic
1038117528 8:24574183-24574205 AGCACAGAGCTGCCAATACCTGG + Intergenic
1039766374 8:40632682-40632704 AGCACAGCCCTGCCAACACCTGG + Intronic
1039900998 8:41752535-41752557 AGCAGAGCTGTTCCAGATCCTGG - Intronic
1040630894 8:49209002-49209024 AGAACAGCTGTATAAAAACCAGG + Intergenic
1041548075 8:59069068-59069090 AGCACTGCTGTCCCAACTCCTGG - Intronic
1043183810 8:77119639-77119661 AGCTAAGCTGAGCCAAAAGCAGG + Intergenic
1045873301 8:106950056-106950078 AGCAAAGCTGTGACCAAGCCTGG + Intergenic
1047777703 8:128087200-128087222 AGCTCAGATGTGACAAAACTGGG + Intergenic
1049022503 8:139967294-139967316 ACCGCAGCAGAGCCAAAACCAGG + Intronic
1050337688 9:4605346-4605368 AGCACAGCTGCACCAAAACAAGG - Exonic
1050722423 9:8605899-8605921 AGCACAGGTGTGCCACAGCATGG + Intronic
1051908163 9:22120556-22120578 ATCAAAGCTGTGGCAGAACCAGG + Intergenic
1057866381 9:98685098-98685120 AGCACAGCTGGGATAAAAGCAGG + Intronic
1058158053 9:101537141-101537163 ACCACAGCTGTGCTGAAATCTGG + Intronic
1058800797 9:108542947-108542969 AGAACACCTGAGCCAAAATCAGG + Intergenic
1059376440 9:113885208-113885230 AGCAAACCTGTCCCAAACCCAGG - Intronic
1059923688 9:119185783-119185805 AGTACAGCTGTGCAAACTCCAGG - Intronic
1062519521 9:136951881-136951903 GGCCCAGCTGTGGCCAAACCCGG - Intronic
1186258380 X:7747587-7747609 AGCACACCTGAGCCAGCACCTGG + Intergenic
1186411276 X:9346555-9346577 AGCAAATCTGTGACAAATCCTGG + Intergenic
1192487740 X:71544788-71544810 AGAACAGATATGCCAAAGCCTGG - Intronic
1193162173 X:78240555-78240577 AGCACTGCTGGGCTAAAAGCTGG - Intergenic
1195738016 X:108033444-108033466 AGCCCAGCTGTGCTTACACCTGG - Intergenic
1196368486 X:114948858-114948880 TGCACAGCCTTGCCAAAACTCGG - Intergenic
1197699235 X:129585289-129585311 AGCACAGCTGTCTCAAACCTTGG - Intronic