ID: 1102446613

View in Genome Browser
Species Human (GRCh38)
Location 12:113007926-113007948
Sequence GGCACCTGGTTTTCTGCAAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102446613 Original CRISPR GGCACCTGGTTTTCTGCAAC TGG (reversed) Exonic
900195669 1:1374442-1374464 GGCGTCTGGTTTTCTGCAGGCGG - Exonic
900329769 1:2128203-2128225 GGCACCTGGCTATCTGCATGTGG + Intronic
901427777 1:9193627-9193649 GGGACCTGGGATTTTGCAACAGG + Intergenic
903620937 1:24697863-24697885 GGCAGCTGGGTTTCTGGATCAGG - Intergenic
904448874 1:30598329-30598351 ACCACCTGGTTCTCTGCCACAGG + Intergenic
906211198 1:44013190-44013212 GGAACCTGGATCTCTGCAAAGGG - Intronic
907441283 1:54480206-54480228 GGCACCAAGTTTTCTGAAGCTGG - Intergenic
908833593 1:68206406-68206428 GGCAGCTCATTTTCTTCAACTGG - Intronic
911574670 1:99561300-99561322 GGCACCTCATTTTATGCAATTGG - Intergenic
919982732 1:202652411-202652433 GGCACCTGCCTTTCTGCAGGAGG + Intronic
920834616 1:209498181-209498203 GACACCATGTTTTCTGCAAATGG + Intergenic
923032466 1:230260585-230260607 GGCACCTGGATTTCCCCAACAGG - Intronic
1064159132 10:12928911-12928933 GGCACCTGGTTGACTTCACCTGG + Intronic
1064224598 10:13471760-13471782 AGCACCTGGTTTTCTGAAGGTGG - Intronic
1064285961 10:13991406-13991428 TGCACCTGCTTTCCTCCAACGGG + Intronic
1066055523 10:31677251-31677273 GACACCTGGTTCACTGCAAATGG - Intergenic
1070307677 10:75249202-75249224 GGCACATGGAATTCTGCCACTGG + Intergenic
1073340333 10:102739444-102739466 GCCACCTGTTTTTGTGCAATTGG + Exonic
1074470087 10:113719179-113719201 GGAAGTTGGTTTTCTGCAAAGGG + Intronic
1075952885 10:126497243-126497265 GGCACCTGCTCTTCTGGGACAGG + Intronic
1075952911 10:126497505-126497527 GGCCTATGGTTTTCTGCAACAGG - Intronic
1076277233 10:129211950-129211972 TGCTCCTGGCTTTCTGCAGCCGG - Intergenic
1079156237 11:17950516-17950538 GGCAACTGGTTGTGGGCAACTGG + Intronic
1079743975 11:24101591-24101613 TGCACCTGGATTTCTGCACAGGG - Intergenic
1085538518 11:77243782-77243804 GGCTCCTGGTTTTCAGCATGTGG - Exonic
1085752477 11:79173697-79173719 TGCACCAGGCTTTATGCAACTGG - Intronic
1088181347 11:107115975-107115997 AGCACCTGGATTTAAGCAACGGG + Intergenic
1088587500 11:111372328-111372350 GAGACCTTGTTTTCTTCAACAGG + Intronic
1090632720 11:128664354-128664376 GGCATCTTGTTTTCTCAAACTGG - Intergenic
1091169166 11:133505320-133505342 AGCTCCTGGTTTTCTTCAAAAGG + Intronic
1093165164 12:15796876-15796898 GTCACCTGTTTTTCTACAGCTGG - Intronic
1094426312 12:30320680-30320702 AGCACCTGCTTTTCTGAGACTGG + Intergenic
1094714491 12:32998859-32998881 GGCACTTTGTTGCCTGCAACTGG - Intergenic
1099132913 12:78858862-78858884 GACACCAGGTTTTCTGCCTCTGG - Intergenic
1101204136 12:102468346-102468368 GGCATATTGCTTTCTGCAACTGG - Intronic
1102292739 12:111714335-111714357 GGCACCTGGTTTTCTGAGGGGGG - Intronic
1102446613 12:113007926-113007948 GGCACCTGGTTTTCTGCAACTGG - Exonic
1104171075 12:126281264-126281286 GGCAACTCTTTTTCTGCAAATGG - Intergenic
1104211886 12:126696907-126696929 GGCTTCTGCTTTTCTGCCACTGG - Intergenic
1105417417 13:20225277-20225299 GGCACTTGTCTTTCTGGAACTGG + Intronic
1113562529 13:111293675-111293697 GGCATCTTGTTTTCTGAAGCTGG - Exonic
1114365296 14:22020090-22020112 TACACATGGTTTTCTGTAACAGG + Intergenic
1114399391 14:22395566-22395588 GGTACCTGGCATTCTGCCACTGG - Intergenic
1119313436 14:73670540-73670562 TGCACCTGGTTTTATTCAAATGG + Intronic
1119549432 14:75497587-75497609 TGCTCCTTCTTTTCTGCAACGGG + Intergenic
1119592418 14:75902232-75902254 GGCACCAGCTCTTCTGCAACTGG + Intronic
1119667391 14:76494798-76494820 TGCACCTGGCTTTGTGCACCTGG - Intronic
1119786330 14:77317047-77317069 GCCACCTGGATTCATGCAACCGG + Intronic
1122375368 14:101253495-101253517 GGCACCTGGTTTTATGAACCTGG + Intergenic
1125515919 15:40321076-40321098 GCCATTTAGTTTTCTGCAACAGG + Intergenic
1126803902 15:52326077-52326099 GGCAACTGGTTTTTTGCCATCGG - Intronic
1127275263 15:57438195-57438217 GGCACATCGTTTTCTGAAAATGG + Exonic
1129285014 15:74517466-74517488 GGCAACTGTTTTTCTGTAAAGGG + Intergenic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1141667930 16:85475424-85475446 GGCACCTGGTGTCCTGAAGCAGG + Intergenic
1143645225 17:8225641-8225663 GGCACCAGGTTTCGTGCAGCAGG - Intergenic
1143921990 17:10337338-10337360 GGCTCCAGGTTTGCTGCAAGAGG + Intronic
1145728636 17:27156025-27156047 GGCACCTAGTGTTCTGAGACTGG + Intergenic
1150188619 17:63214159-63214181 GGCTACTGGTTTTGTGCAATAGG - Intronic
1152415153 17:80155119-80155141 GGTCCCTGGCTTCCTGCAACAGG - Intergenic
1157378583 18:47190168-47190190 GGTACTTGGTTTTCTGCACTTGG - Intergenic
1158317340 18:56226355-56226377 TGGACCTAGATTTCTGCAACAGG + Intergenic
1164985119 19:32642870-32642892 GGCACGGGGTTTTGTGCAGCTGG - Intronic
927512014 2:23649800-23649822 GGCAGCTGGCTTCCTGCCACGGG - Intronic
930027114 2:47035771-47035793 GGCACATGGTTCTCTGTAGCAGG + Intronic
930551801 2:52844757-52844779 GGCAACTGGTTTTCTGAGAGAGG - Intergenic
934561097 2:95313656-95313678 GGGACTTGGGTTTCTTCAACTGG + Intronic
935157383 2:100495346-100495368 GGCACCAGCTTGACTGCAACAGG + Intergenic
937332229 2:121038707-121038729 GGCACTTGATTCTCTGCACCTGG + Intergenic
937833370 2:126446636-126446658 CTCAGCTGGTTTTCTGCATCGGG - Intergenic
940581429 2:155584893-155584915 GGTACCTCCTTTTCTGCCACTGG + Intergenic
940754161 2:157662429-157662451 GGAACCTACATTTCTGCAACGGG + Intergenic
942699165 2:178684707-178684729 GGAACCTTTTTTTCTGGAACTGG + Exonic
948078621 2:235187404-235187426 AGCACGTGGTTTTCTGCATATGG - Intergenic
948613404 2:239183893-239183915 GGAACCTAGTTTTCTGGCACTGG - Intronic
1172675788 20:36670821-36670843 GGAACCTGGTCTTCTTCAAAGGG - Intronic
1175520738 20:59601216-59601238 GGCACGTGGCCTTCTGCCACTGG + Intronic
1177214865 21:18115196-18115218 GGCTCCTGATTTACAGCAACTGG - Intronic
1180723001 22:17923323-17923345 GGCAGTTGGTTTTTGGCAACTGG - Intronic
1184549025 22:45194463-45194485 GACACCTAGTTTTCCTCAACAGG - Intronic
1184736193 22:46399041-46399063 GGCACCTGCCTTTCTGGGACTGG - Intronic
1184967867 22:47994728-47994750 GCCACCTTGTTCTCTGCAAGGGG - Intergenic
951179714 3:19644843-19644865 TGCACCTGGATTTCTGCCTCAGG + Intergenic
951797794 3:26560576-26560598 CTCACCTGGTTTTCTGCCCCTGG + Intergenic
953694791 3:45149025-45149047 AGCACAAGGTATTCTGCAACTGG + Intergenic
954325513 3:49861274-49861296 AGAACCTGGTTTACTACAACCGG - Exonic
954991930 3:54848889-54848911 GGGGCCTGCTTTTCTGCACCAGG - Intronic
956127349 3:66023441-66023463 GGCACCAGGTTTGCTGCACTAGG - Intronic
956450986 3:69374756-69374778 GGCACATGGTTTTATGGCACAGG - Intronic
964026660 3:152082092-152082114 GGTATCTAGTATTCTGCAACAGG - Intergenic
967094481 3:186165556-186165578 GGCACCTGGTGTCCTGAAAGAGG - Intronic
969000300 4:3975425-3975447 TGCACTTGTTTTCCTGCAACTGG + Intergenic
969813606 4:9669421-9669443 TGCACTTGTTTTCCTGCAACTGG - Intergenic
969899353 4:10334564-10334586 TGCATCTGTTTTTGTGCAACTGG + Intergenic
970073584 4:12191846-12191868 GGAAGATGGTTTCCTGCAACCGG + Intergenic
970842882 4:20496505-20496527 GGCTGGTGGTTTTCTCCAACAGG + Intronic
971448836 4:26780648-26780670 GGCTTCTGGTCTCCTGCAACTGG + Intergenic
974089339 4:57295098-57295120 GGCCCCTGGGTTTCTGGAACAGG - Intergenic
977918964 4:102623284-102623306 GTAACCTGGTTGTCTGCTACTGG - Intergenic
980488923 4:133499405-133499427 GGCAACTGGTATCCTCCAACAGG - Intergenic
980800098 4:137735883-137735905 GGGACTTGGTTTTCTCCCACTGG + Intergenic
981484111 4:145267150-145267172 GGAACCTGGTTTTCTGCATGTGG + Intergenic
981793201 4:148563477-148563499 GGGAGCGGGTTTTCTGCAAAGGG - Intergenic
982713704 4:158784556-158784578 TGAGCCTGTTTTTCTGCAACTGG + Intronic
985721324 5:1490741-1490763 GGCACCTGTCTTTATGCAAGAGG + Intronic
987412995 5:17632926-17632948 GGCACCTTGATTCCTCCAACTGG - Intergenic
993573812 5:89576730-89576752 GGCATCTGTTTTTCTACATCAGG + Intergenic
1001090516 5:168736803-168736825 GGGACCTGGGTTTCTGCCACAGG + Intronic
1001438753 5:171721530-171721552 GCCACCTGCTTTTCTGTACCAGG - Intergenic
1003626699 6:7747613-7747635 GACACCTGGTTTTCAGCACAGGG + Intronic
1003917723 6:10803175-10803197 AGCACCTGTTTTTCTTCAGCTGG + Intronic
1006155292 6:32010212-32010234 GGCACCTGGTTCTGTCCACCAGG + Intergenic
1006161598 6:32042946-32042968 GGCACCTGGTTCTGTCCACCAGG + Exonic
1007491624 6:42227640-42227662 AGGACCTGGTTTTCTAGAACAGG - Exonic
1014551153 6:122790370-122790392 GGCACCTTGATTTTTGGAACTGG - Intronic
1014941706 6:127448038-127448060 GTCTCCTGGGTTTCTGCTACTGG + Intronic
1015629066 6:135213075-135213097 GGCAGCTCCTTTTCTGCACCAGG - Intronic
1016976592 6:149815107-149815129 GTCAGCTGGTTTTCTTCAAGTGG - Intergenic
1018268053 6:162046584-162046606 GGCACCTGGTTTTCTTCCTCTGG + Intronic
1018447397 6:163870160-163870182 GACACCTGGTTTCCTGCCCCAGG - Intergenic
1022245561 7:28555961-28555983 GGTCCCTGGTCTTCGGCAACTGG - Intronic
1023042082 7:36180867-36180889 TGCACCTGGACTTCTGCATCAGG + Intronic
1024397969 7:48890514-48890536 GGCAAATGGTTTTCTCCAACAGG - Intergenic
1026600973 7:71776960-71776982 AGCTCCTGGTTCTCTGCACCTGG - Intergenic
1030335803 7:108324564-108324586 GACACCTGCTTTTCTTCAACAGG + Intronic
1033883875 7:145920533-145920555 GGCACCAGGATTTCCCCAACTGG - Intergenic
1035833308 8:2722138-2722160 GGCACCTGTTTTTGTGCTGCTGG - Intergenic
1045958907 8:107943871-107943893 GGCATGTGGTTTTCTTCCACAGG + Intronic
1046224329 8:111258640-111258662 GACACCTGGTCTTGTGCAAATGG + Intergenic
1046597788 8:116281737-116281759 GGCATTTGGTTTTCTAAAACAGG - Intergenic
1047371572 8:124260352-124260374 GGCCCCTGGTTGTGTGCAAATGG - Intergenic
1048361782 8:133703649-133703671 GGCCACTGGTTTCCTGCAGCAGG + Intergenic
1049015566 8:139917693-139917715 GCGACCTTATTTTCTGCAACAGG - Intronic
1049093187 8:140532337-140532359 GGCAGCTGCTTTTCTGGAAGGGG - Intronic
1049690959 8:143958689-143958711 GGCACCTGCTCTGCTGCAGCAGG + Intronic
1049724871 8:144141099-144141121 TGCACCTGCTTCTCTGCAAGGGG + Intergenic
1052050507 9:23842422-23842444 GGAGGCTGGTTTTCTGCAACAGG - Intergenic
1056782561 9:89562172-89562194 GACATCTGGTTTTGTGCTACGGG + Intergenic
1057029906 9:91767716-91767738 TGCCCCTGGTTTTCTGCAGCTGG - Intronic
1060906726 9:127313712-127313734 AGCACCTTATTTTCTGCACCAGG + Intronic
1061322607 9:129840448-129840470 GGGAGCGGGTTTTCTGGAACAGG - Intronic
1193086042 X:77448342-77448364 GGCAGCTGATTTCCTGGAACAGG + Intronic
1196806086 X:119587537-119587559 TACACCTGGATTTCTGTAACTGG - Intergenic
1198443168 X:136684471-136684493 GGCACCTGGTTTGATGTATCGGG - Intronic