ID: 1102447004

View in Genome Browser
Species Human (GRCh38)
Location 12:113010905-113010927
Sequence CTGTGTCAGCAGGGGCAGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 399}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102447004 Original CRISPR CTGTGTCAGCAGGGGCAGAA AGG (reversed) Exonic
900415263 1:2531783-2531805 CTGGGACAGCAGGGGAAGACAGG + Intergenic
900502984 1:3015744-3015766 CTGTGTCCTCAGTGGCAGAGAGG - Intergenic
901082501 1:6591579-6591601 CCTTGTCAGCAGGGGCGTAAGGG - Exonic
901851013 1:12015594-12015616 CTGTGTAATCAGAGGCATAAGGG - Intergenic
902382116 1:16057669-16057691 CTGTGTGAGCATTGGCAGTAGGG + Intergenic
902612922 1:17607790-17607812 CTTGGCCAGCAGGGGCAGAGAGG + Exonic
902697283 1:18148895-18148917 TTGTGTGTGCAGGGGCAGGAGGG - Intronic
903259293 1:22122658-22122680 CTGTGTCCGCAGGAGCGGAGGGG + Intronic
903541445 1:24098630-24098652 CTGAGTGACCAGGGGCAAAAAGG - Intronic
903931375 1:26864241-26864263 CAGAGGCAGCAGGGGCAGGAGGG - Exonic
904021514 1:27470102-27470124 CAGTGTCAGCAGAAGCACAAAGG + Intronic
904484390 1:30815127-30815149 GTGTGTCCTCAGAGGCAGAAGGG - Intergenic
904647393 1:31978063-31978085 GTGGGTCTGCAGGGGCAGATGGG + Intergenic
905245927 1:36613264-36613286 CTGTGGCCACAGAGGCAGAAAGG - Intergenic
906590381 1:47019520-47019542 CTGTTTCAGCATTGGCTGAATGG - Intergenic
906907070 1:49907039-49907061 CATGGTCAGCATGGGCAGAAAGG - Intronic
906948616 1:50316593-50316615 CTTTCTGAGGAGGGGCAGAAAGG + Intergenic
907550178 1:55298536-55298558 CAGAGTAAGCAGGGGCAGATGGG + Intergenic
910467337 1:87514489-87514511 CTGTGCCAGCCAGGACAGAAGGG + Intergenic
914503149 1:148264989-148265011 CTGAGACAGCGGGAGCAGAAGGG + Intergenic
915737631 1:158094853-158094875 CAGTGCCAGCTGGGGCAGCAGGG - Exonic
916231870 1:162548832-162548854 CTGACCCAGCAGGGGCACAAAGG - Intergenic
916989732 1:170229417-170229439 CTTAGTGAACAGGGGCAGAATGG + Intergenic
918047576 1:180950811-180950833 CTTTGTTGGCAGGGGGAGAAGGG + Exonic
918051266 1:180974494-180974516 GTGTGTCAGCAGGGGCCGTTTGG - Exonic
918326875 1:183418323-183418345 TTGTGTCTGCAGAGGGAGAAAGG + Exonic
920240959 1:204550077-204550099 CTGTCTGAAGAGGGGCAGAAGGG - Exonic
921132130 1:212228935-212228957 GTTTGTCAGCAGGGGCGGACCGG + Intergenic
922869697 1:228891990-228892012 CTGTCTCAGCAGGCCCAGGAAGG - Intergenic
923348804 1:233083366-233083388 CTGTGTCAGCAGGGGTATCCAGG + Intronic
924272121 1:242344809-242344831 CTTTGTCAGCAGTGTCAAAACGG - Intronic
924823593 1:247518044-247518066 CTGTGGCAGGAGGTGGAGAAGGG - Intronic
1063095625 10:2906224-2906246 CTGTGGCAGCAGGGGGAGAAAGG - Intergenic
1064963769 10:20994902-20994924 CTGTCTCAGGAGTGGCAGAGAGG + Intronic
1065159341 10:22903020-22903042 CAGTCTCAGCAGCAGCAGAATGG + Intergenic
1065678627 10:28205983-28206005 CTGTGTCATCCATGGCAGAAAGG - Intronic
1066712546 10:38251329-38251351 CTTTGTCAGCAGTGTCAAAACGG + Intergenic
1067095818 10:43298838-43298860 CTGTGTCTGCAGTGCCAGAGAGG - Intergenic
1067342661 10:45418066-45418088 CTGGGCCAGGAGGGGCAGAAGGG - Intronic
1067819963 10:49519888-49519910 CTGAGGCAGCAGGTGCAGAGTGG - Intronic
1069551001 10:69364126-69364148 TAGTGACTGCAGGGGCAGAAGGG + Intronic
1069594743 10:69663284-69663306 CTGTGTCAGCAGGAGCCCACAGG - Intergenic
1069684517 10:70309134-70309156 CTGGGTGATCAGGGGCAGAGGGG - Intronic
1070492841 10:76993663-76993685 CTGTGGCTGCAGGGGAGGAAGGG - Intronic
1070711902 10:78689122-78689144 CTGTGTGGGGAGGGGCAGGAGGG - Intergenic
1070818792 10:79342731-79342753 CTGTGTCTCCAGGGGCAGGTGGG - Intergenic
1071564437 10:86664548-86664570 GTGTGACAGGAGGGGCAGATGGG - Intronic
1072424707 10:95320291-95320313 ATGTGTGAGCAGGGGCAGGAAGG - Intronic
1073218007 10:101847358-101847380 CTTGGGCAGCAGGGGCAGGAGGG - Exonic
1074232980 10:111556032-111556054 CTGGGCAAGCAGGGGCACAAAGG + Intergenic
1074833016 10:117263160-117263182 CTGTGTCAGCACCAGCAGGAGGG + Intronic
1075087182 10:119421566-119421588 CTGTGTCTCCTGGGGCAGAGTGG + Intronic
1075120108 10:119658658-119658680 CTGTGACAGGAGTAGCAGAAAGG + Intronic
1075725366 10:124608164-124608186 CTGGATCAGGAGGGTCAGAAAGG - Intronic
1075928098 10:126269719-126269741 CTGAGTCTGCAGTGTCAGAAGGG + Intronic
1076342680 10:129760249-129760271 CTGTGTGTGTGGGGGCAGAAAGG + Intronic
1076501020 10:130936159-130936181 CAGTGTCAGCAGAGGCATATGGG - Intergenic
1076858310 10:133128035-133128057 CTGGGTGGGCAGGGGCAGGAAGG - Intronic
1076858384 10:133128288-133128310 CAGTGTCAGCGGGGCCAGCACGG - Intronic
1077193162 11:1264245-1264267 CTGTGTCTGTAGGGGAAGACAGG - Intergenic
1079143826 11:17833211-17833233 CTTTGTCAGCACTGGCTGAAAGG + Intronic
1079870073 11:25786348-25786370 CTGTTTCTGCAGGGCCAGCAAGG + Intergenic
1081156089 11:39692888-39692910 CTGTCTCAGGAGTAGCAGAAGGG - Intergenic
1083726834 11:64632958-64632980 ATGTGTCACCAGGGGAGGAAGGG + Intronic
1083904055 11:65658717-65658739 CTGTGTGACAAGGTGCAGAAAGG - Exonic
1083944236 11:65915312-65915334 CTGGGTGAGCATGGGCAGAAAGG + Intergenic
1085024645 11:73229440-73229462 CAGGGTCAGGAGAGGCAGAAGGG + Intronic
1085057343 11:73413163-73413185 CTGAGTCATCAGGGGCAGGGGGG - Intronic
1085261188 11:75205562-75205584 CTGTGTCACCTGGGGCAGTGTGG + Exonic
1086103928 11:83129175-83129197 CTGTGTCCACAGGGGCTGACAGG - Intergenic
1087951480 11:104225709-104225731 CTGTATTAGCAGGAGCAAAAAGG - Intergenic
1088119496 11:106351429-106351451 CTGTGTCCTCAGAGGTAGAAAGG + Intergenic
1088674633 11:112180632-112180654 GTGTGTCCCCAAGGGCAGAAAGG + Intronic
1089683296 11:120131450-120131472 CTGTGAGGGCAGGGCCAGAAGGG + Intronic
1089930623 11:122307265-122307287 GTGTCACAGCAGGAGCAGAAAGG - Intergenic
1090621552 11:128565251-128565273 CTGTGTCCTCAGTGGCGGAAGGG - Intronic
1090901247 11:131033565-131033587 CTGAGTCAGCAGGGGAAGGATGG + Intergenic
1091194193 11:133717938-133717960 CTGTGTCCTCAGAGGTAGAAGGG + Intergenic
1091301505 11:134510783-134510805 CTGGGTGAGCAGGGGCAGGCAGG - Intergenic
1091340189 11:134806155-134806177 CTGGGTCAGCATGGAGAGAAGGG - Intergenic
1091794999 12:3293184-3293206 CAGTGTCAGCAAGGCCAGATGGG - Intergenic
1091824108 12:3497130-3497152 CTCTGCCAGCAGGGGGAAAATGG + Intronic
1091912355 12:4242742-4242764 CTGTGCCTGCAGGAGCAGACTGG + Intergenic
1093570691 12:20663030-20663052 CTGTTTCAGCCATGGCAGAAAGG + Intronic
1093873809 12:24325620-24325642 CTGTGTCTACAGAGGAAGAAGGG + Intergenic
1096188318 12:49598632-49598654 CTGCGGGACCAGGGGCAGAAGGG - Intronic
1096448979 12:51721529-51721551 CAGTGACTGCAGGGGCAGACAGG - Exonic
1099263807 12:80418274-80418296 CTGTGTCAAGAGGGGAAAAAAGG - Intronic
1100036784 12:90261372-90261394 CTGTAACAGCAGGGACAGTAAGG - Intergenic
1100607829 12:96166198-96166220 CTATGTAACCAGAGGCAGAAAGG - Intergenic
1102424054 12:112826568-112826590 TTGATTCAGAAGGGGCAGAAGGG - Intronic
1102447004 12:113010905-113010927 CTGTGTCAGCAGGGGCAGAAAGG - Exonic
1102959603 12:117084302-117084324 CAGTGTCTCCAGGGTCAGAAAGG + Intronic
1103376698 12:120462014-120462036 CTGTCTCAGTAGGGCCTGAAAGG + Exonic
1106759471 13:32853907-32853929 CTATATCAGCAGTTGCAGAATGG - Intergenic
1106844966 13:33728613-33728635 CTGACACAGCAGGGGCAGGAAGG - Intergenic
1109780637 13:67106738-67106760 CTGAGCCTGCAGGGGCAGAAGGG - Intronic
1111243650 13:85507924-85507946 CTGGGCCTGCAGGGGCAGAGGGG - Intergenic
1111880542 13:93950912-93950934 CAGTGTCTGCCAGGGCAGAAGGG - Intronic
1114605037 14:23989259-23989281 CAGAGGCAGCAGGGACAGAAGGG - Intronic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1116325296 14:43526081-43526103 AAGTGTAAGCAAGGGCAGAATGG - Intergenic
1117479492 14:56128924-56128946 CTATGTCAGCAGAGGTAGAAAGG + Intronic
1117740380 14:58812681-58812703 CTCTGTCAGCAGGGACAGATGGG - Intergenic
1117779898 14:59221730-59221752 CTGAGTCAGCAGGACAAGAAAGG - Intronic
1118309729 14:64683456-64683478 CTGTCTCCGCTGGGGCAGAAAGG + Intergenic
1118843190 14:69527760-69527782 CTGTGGCGGCAGGGCCAGGAAGG - Intronic
1118914776 14:70093767-70093789 CTCTCTGAGCAGTGGCAGAATGG - Intronic
1119749362 14:77066618-77066640 CTGGTTCAGCAGAGGCTGAAGGG - Intergenic
1119750524 14:77074359-77074381 CATTGTCAGCAGGGTCAGAACGG + Intergenic
1120559169 14:85969934-85969956 CTTTGTCAGATGGGGCAGATGGG + Intergenic
1121455852 14:94038551-94038573 ATGTGTGAGCAGGGGCGGGAGGG - Intronic
1123017503 14:105382372-105382394 CTGTGGCTGCAGGGGGAGCAGGG + Intronic
1123490483 15:20775957-20775979 CTGCGCCAGCAGGGCCAGCATGG + Intergenic
1123546984 15:21345044-21345066 CTGCGCCAGCAGGGCCAGCATGG + Intergenic
1124114385 15:26827646-26827668 CAGTGTGAGCTGGGGCAGGAGGG - Intronic
1125130070 15:36274068-36274090 GTCTGTCAGCAAGGGGAGAATGG + Intergenic
1125418189 15:39474978-39475000 CTGTGTCTGCTGGGGCAAAGAGG + Intergenic
1127247314 15:57191351-57191373 CTGTTTCAGCAGGCTAAGAAAGG + Intronic
1129172319 15:73815792-73815814 CTGGAGGAGCAGGGGCAGAAAGG - Intergenic
1129189389 15:73928323-73928345 CTGAGTCTTCAGGGCCAGAAAGG + Intronic
1129350869 15:74955394-74955416 CTGGGCCAGCAGGGGGAAAAGGG + Exonic
1129426863 15:75469747-75469769 TGGTGTCTGCAGGGGCAGTAGGG - Intronic
1130302630 15:82691718-82691740 CTGTCTCAGTAGGGCCTGAAAGG + Intronic
1131431458 15:92392535-92392557 GTGTGTAAGGAGGGGCAGGAGGG - Intergenic
1132074444 15:98808474-98808496 CTGTGTCACCAGTGGCATATAGG + Intronic
1132405494 15:101539807-101539829 CTGTGTCTGCAGAGGTGGAAGGG + Intergenic
1202955315 15_KI270727v1_random:72260-72282 CTGCGCCAGCAGGGCCAGCATGG + Intergenic
1132500545 16:282905-282927 CAGGGGCAGCAGGGGCAGCAGGG - Exonic
1132500548 16:282914-282936 CAGGGGCAGCAGGGGCAGCAGGG - Exonic
1132623610 16:879732-879754 CTGGGTCTGCAGGGACAGGAGGG + Exonic
1132862918 16:2080321-2080343 CTGGGTCAGCAGGGGCACATAGG - Exonic
1133831855 16:9330619-9330641 CTGTGTCAGGATGGGTACAAGGG + Intergenic
1133983104 16:10648155-10648177 CTGTGTAAGCAGAGGAACAAGGG + Intronic
1135790900 16:25394674-25394696 CTTTGTGAGCAGTGACAGAAAGG + Intergenic
1136997426 16:35200431-35200453 CTGTGAGGGCAGGGCCAGAAGGG - Intergenic
1137025983 16:35475075-35475097 CTGTGTCTTCAATGGCAGAAGGG - Intergenic
1138064176 16:53923540-53923562 CTGTGCCAGTAGGGGCAGTGGGG + Intronic
1138719648 16:59064555-59064577 GCATGTCAGCAGGGGAAGAAGGG - Intergenic
1138957703 16:61991218-61991240 TTGGGTAAGCAGGGGCGGAAGGG + Intronic
1139700776 16:68706873-68706895 CTCTATGAGGAGGGGCAGAAGGG + Intronic
1140474106 16:75230015-75230037 CTGCTTCAGCTGGGGCAGGAGGG + Exonic
1140783039 16:78313933-78313955 CTGTGTCAGCACGGATATAAGGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141424215 16:83934931-83934953 TTGTGTCTCCAGGGACAGAAAGG + Intronic
1141466906 16:84212271-84212293 CTGTGTCAACAGGGCGAGGAAGG - Intergenic
1141949526 16:87331653-87331675 CTGTCTCTGCAGGGGCAGCTGGG + Intronic
1142270477 16:89086538-89086560 CTGTGTCAGCTGTGGCAGGCTGG - Intergenic
1142381975 16:89738122-89738144 CTGTGTCAGCGGGTGCACCATGG - Exonic
1143173398 17:4943140-4943162 CAGTCTCAGCAGGGCGAGAAAGG - Intronic
1143631988 17:8144848-8144870 CTGTGTGTGCAGGGACAGCACGG + Exonic
1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG + Intergenic
1145239630 17:21232905-21232927 CTGGGTCTGCCTGGGCAGAAGGG - Intergenic
1146678763 17:34792150-34792172 CTGGCTCAGCAGGTACAGAAGGG - Intergenic
1146892099 17:36512814-36512836 CTCTGTCAGCAAAGACAGAAGGG + Intronic
1147043124 17:37733008-37733030 TTGAGTCAGCGGGGGCAGAGTGG + Intronic
1147646612 17:42038123-42038145 CTGCCTCAGTAGGGGCAGGAGGG - Intronic
1150333641 17:64314205-64314227 GTGTGGCAGCAGGGACAGGAAGG + Intergenic
1151161217 17:72167355-72167377 CTGTGGAAGCAGTGGCAGGAGGG - Intergenic
1151425700 17:74029786-74029808 CTGTGTGATCAGGAGAAGAAAGG + Intergenic
1151732100 17:75917690-75917712 CCGTGGCAGGAGGGGCAGGAGGG + Intronic
1152922607 17:83073435-83073457 CTATCTCAGCGTGGGCAGAAAGG + Intergenic
1153216008 18:2821617-2821639 CTGAGTCAACAGGTCCAGAAAGG - Intergenic
1153521799 18:5961011-5961033 CTGTCGCAGCAGGGGATGAAAGG + Intronic
1153834402 18:8951134-8951156 CTGTCCCTGAAGGGGCAGAAGGG - Intergenic
1153979389 18:10296420-10296442 CGGTGTCAGCAGCAGGAGAAAGG - Intergenic
1155779223 18:29810313-29810335 CTGTGGCATAAGGGGCAAAACGG - Intergenic
1156197947 18:34797132-34797154 CTGTGTCTTCAGGGACAGAATGG - Intronic
1156832960 18:41516872-41516894 CTGTATAAGCAGGAGAAGAATGG - Intergenic
1157632254 18:49109926-49109948 GTGTGTCAGCAGTAGCACAAAGG - Intronic
1158146677 18:54322455-54322477 GGATGTCAGCAGGGCCAGAAGGG - Intergenic
1158433523 18:57415610-57415632 CAGTGTGAGCAGGGACAGAATGG - Intergenic
1159150677 18:64519312-64519334 CTATTTCAGCAAGGGCAAAATGG + Intergenic
1160116723 18:76085380-76085402 CTGAGTCTGCAGGGGCAGGGGGG + Intergenic
1163111814 19:15165891-15165913 CTGCATCAGCACGGGCATAACGG + Exonic
1164809682 19:31146445-31146467 CTGTCTCAGCAGGGGCAGCTTGG - Intergenic
1166410482 19:42553086-42553108 CTGTGTGAGCTGGGAGAGAATGG + Intronic
1202669528 1_KI270709v1_random:39085-39107 CTGCGACAGCAGGGGGAAAAAGG - Intergenic
925436544 2:3843106-3843128 CTGTGATAGCAGGGGGAGAAGGG + Intronic
925675895 2:6360679-6360701 CTGTGTCTGCAGGAGGAGATCGG + Intergenic
925701411 2:6642198-6642220 CAGTGACAGCAGGGCCAGCAAGG + Intergenic
925993080 2:9269451-9269473 CTGTGTCACCACAGGCTGAATGG - Intronic
926001515 2:9337123-9337145 CTGTGCAATCAGGGGCAGATGGG - Intronic
927041434 2:19234533-19234555 CTGAGTCAGCAAGGGCCAAAGGG - Intergenic
929230060 2:39550056-39550078 CTATGGCATCAGGGGAAGAAGGG - Intergenic
929300248 2:40295904-40295926 CTTTGTGAGCAGGAGGAGAAGGG + Intronic
929384155 2:41384414-41384436 CTGTGTAAGCACAGGAAGAAAGG - Intergenic
929804321 2:45131484-45131506 CTGTGTTAGCCGGGGCAGATAGG + Intergenic
929885271 2:45872503-45872525 CTGTGTAAGAATGGGCAGCAAGG + Intronic
930308623 2:49709278-49709300 CTGTGTCAAATGGTGCAGAAAGG - Intergenic
931249143 2:60514990-60515012 CTGTCTCACCAGAGGGAGAACGG - Intronic
932186833 2:69704550-69704572 CTGTGTCAGCTGGAGCAACAGGG + Intronic
932598389 2:73108160-73108182 CAGTCTAAGCAGGGGCTGAACGG + Intronic
933688944 2:85164310-85164332 CAGTGGCAGCAGTGGCTGAAGGG + Intronic
933718004 2:85376343-85376365 CTGTGCCAGCAGGGGAAGGAGGG + Intronic
935673685 2:105576288-105576310 CTCTGTGAGCAGGGGGAGGAGGG + Intergenic
936040362 2:109145178-109145200 CTGTCTCAGAAGCAGCAGAAAGG - Intronic
936448698 2:112617218-112617240 GTTTGTCAGCAGGGTCAGGAGGG + Intergenic
936948716 2:117955047-117955069 CTTTATCAGCAGGGTGAGAATGG + Intronic
937763301 2:125631271-125631293 TTGTTTCAGCAGGGGCTCAAGGG + Intergenic
938069226 2:128299790-128299812 CTGTGTTAGCAGGGCCGGGATGG - Intronic
939539862 2:143480730-143480752 CTATGTCAGAGTGGGCAGAAAGG - Intronic
939587088 2:144019124-144019146 TTGTGTCATTAAGGGCAGAAAGG - Intronic
939875353 2:147571426-147571448 CTCAGGCAGCAGGGGCTGAAGGG + Intergenic
940333735 2:152503055-152503077 CTGTATCAGGAGGGACAAAATGG + Intronic
940408769 2:153335936-153335958 CTGTGCCAGCTGTGGCTGAAAGG + Intergenic
941145685 2:161841363-161841385 CTGTGTCAGCAGGGGCATGGTGG - Intronic
941426438 2:165351263-165351285 CTGTGTCACCACGGGTAGATTGG + Intronic
942094212 2:172522609-172522631 CTGTGGAAGCATGGGCAGATAGG - Intergenic
944098433 2:195995569-195995591 CTGGCTCAGCAGGGGAAGATGGG + Intronic
944192582 2:197019488-197019510 CTGTGTCATCCTGGGCAAAATGG - Intronic
944251729 2:197585662-197585684 CTGTGTAAGCACAGGAAGAAAGG - Intronic
944271065 2:197785774-197785796 CTGTGTCATGGGGGTCAGAAAGG - Intronic
944650889 2:201829242-201829264 CTGTGTGAGTAGGGGGAGAGAGG - Intronic
945102554 2:206275107-206275129 CTCACGCAGCAGGGGCAGAAAGG - Intronic
946192347 2:218014127-218014149 TTTTGTCTGCAGGGGCACAAAGG + Intergenic
947885834 2:233570277-233570299 CTGTTTCAGGAGTGGCAGAGGGG - Intergenic
948059568 2:235033011-235033033 CAGTGTAAGGAGGGGCAGAGTGG - Intronic
948394195 2:237632433-237632455 CTGTCCCAGCAGGGGCATGAGGG - Intronic
948467067 2:238157786-238157808 ATGTGGCAGCAGGGACTGAAAGG - Intergenic
949012268 2:241687386-241687408 GTTTGACAGCAGGGGCAGGATGG + Intergenic
1169279571 20:4255490-4255512 CTATGTCAGCAGAGGCTGGAGGG + Intergenic
1169934248 20:10865880-10865902 CAGGGTCAGAAGGGGCAGACAGG + Intergenic
1170121451 20:12916854-12916876 CTGTGGCTGCAAGGGCAAAAGGG + Intergenic
1171492636 20:25532137-25532159 CTGGGACTGCAGGGGCAGCAAGG + Intronic
1172441923 20:34971918-34971940 CTGGGCCACCAGGGGCATAAAGG - Intergenic
1173396532 20:42685470-42685492 ATCTGTAAGAAGGGGCAGAATGG + Intronic
1173849831 20:46210663-46210685 TTGTCTCAGCAGGGGCGGCAGGG + Intronic
1174184307 20:48694866-48694888 CTGTGTCTGCCGGTGGAGAAGGG + Intronic
1175321424 20:58090854-58090876 CTGAGACAGGAGGGGCAGGAGGG - Intergenic
1175503569 20:59466903-59466925 CTGGGGCTGCAGGGGCAGGAGGG + Intergenic
1175524413 20:59623753-59623775 CCGTGTGAGCATGGGCTGAACGG + Intronic
1175624365 20:60478167-60478189 CTGTGTCAGGAGAGAGAGAAAGG - Intergenic
1175744311 20:61443527-61443549 CTGTGTGATCAGGAGAAGAAAGG - Intronic
1176299322 21:5091095-5091117 CTGAGGCAGCGGGGGCAGCAGGG + Intergenic
1178623150 21:34193901-34193923 CTGTGTCAGCAGTGTGAAAATGG + Intergenic
1178809432 21:35867800-35867822 CTTTATCAGCAGGGTGAGAAGGG - Intronic
1179857704 21:44170852-44170874 CTGAGGCAGCGGGGGCAGCAGGG - Intergenic
1180140993 21:45893281-45893303 CTGTCACAGCAGGGGCTGGAGGG + Intronic
1180144299 21:45910720-45910742 CCGTGGTAGCAGGGGCAGCATGG + Intronic
1180206045 21:46261157-46261179 GTGGGTCAGCAGGGGTGGAATGG + Intronic
1180842936 22:18967690-18967712 CTGGGTCAGCAGGGCCACACGGG - Intergenic
1181058532 22:20271038-20271060 CTGGGTCAGCAGGGCCACACGGG + Intronic
1181438996 22:22926281-22926303 GGGGGTCAGCAGGGGGAGAAGGG - Intergenic
1181444200 22:22956303-22956325 CTGTGGCAGCTGGGGTAGAGTGG + Intergenic
1181497326 22:23294918-23294940 CTGGGCCAGCAAGGGCAGCAGGG + Intronic
1181630508 22:24148741-24148763 CTGTTCCAGCAGAGGCAGGAAGG + Intronic
1181634302 22:24167227-24167249 GTGTGGCAGCAGGGCCAGAAGGG + Exonic
1182419938 22:30244055-30244077 CTGTGTACTGAGGGGCAGAAGGG + Exonic
1182486309 22:30641153-30641175 CTTTCTCAGCAGGGGCAGCATGG - Intronic
1182497303 22:30718646-30718668 CTGTGGCCCCAGGGGCAGGAAGG - Intronic
1182509181 22:30806813-30806835 CTGTGCCAGCAGGGGCCAGATGG - Intronic
1182908384 22:33958260-33958282 CTGTCACAGCAGGGGAAGCAGGG - Intergenic
1183043272 22:35199535-35199557 CTGTGGCAACAGGGAGAGAAAGG - Intergenic
1183359933 22:37378203-37378225 TTGTGTGTGCAGGGGCAGGAAGG + Intronic
1183554306 22:38513253-38513275 CAGTGACAGCAGGGGGAGCAGGG - Intergenic
1184102402 22:42347719-42347741 CAGCGCCAGCAGGGGCAGAGGGG + Intergenic
1184380580 22:44142855-44142877 CTGCGTCAGCAGAAGCAGCAAGG - Intronic
1184381414 22:44147098-44147120 CAGTGTCAGCAGGAGCAGCTGGG + Intronic
1185133661 22:49056086-49056108 TTGTGTCCTCAGTGGCAGAAGGG - Intergenic
950428047 3:12935210-12935232 CAGGCTGAGCAGGGGCAGAATGG - Intronic
950580081 3:13856171-13856193 CTGTGTTAGCAGGGACACCATGG - Intronic
951195891 3:19823077-19823099 CTGTGGCAGTTGGGGCACAAGGG + Intergenic
952236827 3:31488552-31488574 CTGTGGCAGAAGGGGCACACAGG - Intergenic
952793248 3:37217240-37217262 CTGAGTCTGCAGGGGCAGGGGGG - Intergenic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
953996092 3:47521180-47521202 CGGTCTCAGCAGAGGCAGCAGGG + Intergenic
954713552 3:52516376-52516398 CTGTGCCAGGAGGGGCTGCAAGG + Exonic
955098986 3:55828463-55828485 CAGGGGCAGCAGGGGCAGCAGGG + Intronic
955098989 3:55828472-55828494 CAGGGGCAGCAGGGGCAGCAGGG + Intronic
955343482 3:58143619-58143641 CTGAGTCAGCAGGCCCAGCAGGG + Intronic
955418411 3:58714190-58714212 CTGAGTCAACAGGCGGAGAAGGG - Intergenic
955992857 3:64646812-64646834 CTTTGTCTGAAGGGGCAGCAGGG - Intronic
956931224 3:74045648-74045670 CTGTATGAGTAGGGGCAGTATGG + Intergenic
958662477 3:97088561-97088583 CTGTGTCTTCAGGTGCAGGAAGG - Intronic
959437474 3:106334401-106334423 CTCTGCCAGGAGGGGCAAAAGGG + Intergenic
961077820 3:123998105-123998127 CTGTGTGAGGAGAGGCAGAGGGG - Intergenic
961306750 3:125963230-125963252 CTGTGTGAGGAGAGGCAGAGGGG + Intergenic
962754455 3:138457354-138457376 CTGTGTGAGTAGGGGCAGGAAGG + Intronic
963346193 3:144098984-144099006 CTGAGTCTGCAGGGACAGGAGGG - Intergenic
963575586 3:147058164-147058186 CTGTGTAGGGAGGGGCAGACAGG - Intergenic
963618669 3:147576341-147576363 CTGCATCTGCAGGGGTAGAAGGG + Intergenic
964517684 3:157530624-157530646 CTGGGTCAGCCTTGGCAGAAAGG + Intronic
964791093 3:160453520-160453542 CTGGGTCTGGAGGGGCAGAGGGG - Intronic
967516346 3:190373224-190373246 CTGTTTCAGCAGGGGTTGCAGGG + Intronic
968073435 3:195802355-195802377 CCGAGTCAGCAGGGGCAGTGAGG - Intronic
968514421 4:1010289-1010311 CTGCGCCAGCGGGGGCAGGATGG + Intronic
968592961 4:1468755-1468777 CTGTGGCAGGAGGGCCATAAAGG + Intergenic
968662551 4:1804797-1804819 TTGGGTCAGCAGGGGCAGGTTGG - Intronic
968961953 4:3750171-3750193 CTGCAGCAGCAGGGACAGAAGGG + Intergenic
969122958 4:4923305-4923327 CTGTGTCCCCATAGGCAGAATGG + Intergenic
969272597 4:6113016-6113038 CTGAGTTAGCAGAGACAGAAGGG + Intronic
969497611 4:7535027-7535049 GTGTGTCAGCAGGAGGAGGAGGG - Intronic
969617694 4:8263013-8263035 CTGGGTCAGCAGGGGCTGGTGGG - Intergenic
972850011 4:43036579-43036601 CTTTATCAGCAGGGGGAAAATGG + Intergenic
973861880 4:55073613-55073635 CCGTGTTAGCAGGGACTGAATGG - Intergenic
974689823 4:65282960-65282982 CTGTGTCAGCAGGTCTAGAGTGG + Intergenic
975533890 4:75428557-75428579 CTGTGTCCTCAGGGGCAGGAAGG - Intergenic
977764877 4:100785327-100785349 CTGGGTGAACAGGGGCAGGAGGG + Intronic
978466657 4:109016114-109016136 CTAAGTCTGCAGGGGCAGGAGGG - Intronic
978940437 4:114429498-114429520 CAGTGCCAGCAGGGGAAAAATGG + Intergenic
979649054 4:123107940-123107962 CTGAGCCTGCAGGGGCAGGAGGG + Intronic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
981915349 4:150026987-150027009 CTGCATCAGCAGTGGCAAAAGGG + Intergenic
983131359 4:164023262-164023284 CTGTGTCACCAGTGACTGAAGGG + Intronic
984605265 4:181778635-181778657 ATGTCTGAGCAGGGGAAGAAAGG - Intergenic
984651148 4:182271887-182271909 CTGTGAGAGCAGGTGCAGCAGGG + Intronic
985420120 4:189776888-189776910 CTGTGACTGCAGGTGCAGCAGGG - Intergenic
986093149 5:4531221-4531243 CTGTGTCAGCAAGGGAAGCCCGG - Intergenic
986285946 5:6359089-6359111 CTTTGTCAGCAGGGGCAGGCTGG - Intergenic
987588660 5:19893129-19893151 CTGTGTCCTCAGAGGCAGAGGGG - Intronic
987870866 5:23614996-23615018 CTGCCTCAACAGGGGCAGACAGG + Intergenic
989110312 5:37900928-37900950 CTGTGCCAGCAGGGTCAGCTGGG - Intergenic
989800067 5:45526539-45526561 CTGGGTCAGTAGGCACAGAAGGG - Intronic
990174050 5:53087380-53087402 TTGTGTAAGCAGGAGGAGAAAGG - Intronic
990288912 5:54329009-54329031 ATGTGACAGCAGAGGCAGAGTGG - Intergenic
990471976 5:56123901-56123923 CTGTGACAGCTGAGGCAGATTGG - Intronic
991318634 5:65342191-65342213 CTGTGTCAGCAGTGTGAAAATGG - Intronic
992387112 5:76295278-76295300 CTGTGTCCTCAGTGGTAGAAGGG + Intronic
998153500 5:139770717-139770739 ATGTGTGAGGAGGGGCTGAAAGG - Intergenic
998175395 5:139898753-139898775 CTGAGTCAGCAGGGAATGAAGGG - Intronic
1000550888 5:162662757-162662779 CTGTTTTAGCAGGTGTAGAATGG + Intergenic
1001287556 5:170435046-170435068 CTGTCTGGGCTGGGGCAGAAGGG + Intronic
1001671521 5:173478001-173478023 CTACGTCAGCAGGGGAAAAAAGG + Intergenic
1001735423 5:173994555-173994577 CAGTGGCAGCGGAGGCAGAATGG + Intronic
1002104976 5:176875537-176875559 CCGTGTCAGGAGAGGCAGCAAGG - Intronic
1002678100 5:180935578-180935600 CTGAGCCTGCAGGGGCAGAGAGG + Intronic
1003055035 6:2810350-2810372 CTGTCTCAGCAGAGACTGAAGGG - Intergenic
1003507475 6:6751654-6751676 GTGTTTCAGGAGGGGCAGATGGG + Intergenic
1003750742 6:9052416-9052438 CTGTGTGAGCAGGGCTAAAAGGG + Intergenic
1005042726 6:21613872-21613894 CTGTCTCATCAGAGGCAAAAAGG + Intergenic
1006077076 6:31540535-31540557 CTGGGCCGGCAGGGGAAGAAGGG + Exonic
1006456679 6:34135912-34135934 ATTTGTCAGCAGGGGCAGTATGG - Intronic
1007836320 6:44676691-44676713 CTGAGTCTGCAGAGGCAGGAGGG + Intergenic
1008559883 6:52713448-52713470 CTGTGTCAGCTGGGGAAGAAAGG + Intergenic
1010133643 6:72524300-72524322 CTGTGCCAGCAGGAGCAGGTGGG - Intergenic
1010519619 6:76817601-76817623 CTGTGTCTGCAGGGGCAGGGAGG - Intergenic
1013179936 6:107709026-107709048 CTGGGGCAGCAGGGGTGGAAGGG - Intronic
1013428850 6:110038242-110038264 CTGGGTGGGCAGGGCCAGAAGGG + Intergenic
1014483532 6:121969761-121969783 ATGTATCATTAGGGGCAGAATGG + Intergenic
1014586299 6:123202092-123202114 CTGGGCCAGCAGCTGCAGAAGGG + Intergenic
1014771774 6:125465568-125465590 CTGTGCCAGCTGTGGCTGAAAGG + Intergenic
1015001594 6:128222976-128222998 CCCTGTCAGCAGGAGTAGAAAGG - Intronic
1017070662 6:150573184-150573206 CAGTGTCAGCAGGGCCAGCGGGG - Intergenic
1017531257 6:155294814-155294836 CTGTGTCAGTTGGGGCACATGGG - Intronic
1017817568 6:158026819-158026841 CTGTGTCAGAAGAGGCAGGTGGG + Intronic
1017872525 6:158499205-158499227 CTATCTCAGCAGGGACTGAAAGG - Intronic
1019144953 6:169970559-169970581 CTGTGCCTGCAGAGGCAGGAGGG + Intergenic
1019695062 7:2441085-2441107 CTGGGTCAGCAGGGGCGGCTGGG + Intergenic
1020041363 7:5005125-5005147 CTGTGTCAGCTGGAGCAACAGGG + Intronic
1020398404 7:7745239-7745261 CTGTCTCAGGAGTGGCAGAGGGG + Intronic
1021629042 7:22625476-22625498 CCCTGTCAGCAGAGGCAGAGAGG + Intronic
1022473732 7:30697331-30697353 CTTAGTCAGCAGGGGCTGAGAGG + Intronic
1023867147 7:44243730-44243752 CTCTGTCCCCAGGGGCAGAGGGG - Intronic
1023879318 7:44309391-44309413 CTGAGCCAGCAGGAGCAGGAGGG + Intronic
1024101303 7:46035527-46035549 CTGTGGCAGGAGGGGCAGCAGGG + Intergenic
1025230594 7:57201327-57201349 CTGTGTCTGCAGTGGGTGAATGG - Intergenic
1025730399 7:64102429-64102451 CTGTGTCTGCAGTGGGTGAATGG + Intronic
1025928901 7:65979901-65979923 CTGTGTCTGCAGTGGGTGAATGG - Exonic
1026234791 7:68517703-68517725 CTCTGGCAGGAGGGGCTGAAAGG - Intergenic
1027672414 7:81118299-81118321 CTGTGTCAGCAGGGAAGGCAAGG + Intergenic
1027969895 7:85066192-85066214 CTGTTTCACCAGAGACAGAAAGG + Intronic
1029021074 7:97364963-97364985 CAGTGTTAGCAGGTCCAGAAGGG - Intergenic
1030896448 7:115066345-115066367 CTGTGTGTGAAGGGGCAGCATGG + Intergenic
1031076936 7:117222004-117222026 ATGTGTCAGGAGGGCCAGCATGG - Exonic
1031801635 7:126253801-126253823 CTGTGGTAGCAGTGGCAGACTGG - Intergenic
1032076102 7:128836925-128836947 CTGCGTCAGCCAGGGCAGAAAGG + Intronic
1033060058 7:138097526-138097548 CTGTCCCAGCAGGGGGAGCAGGG + Intronic
1033919197 7:146367687-146367709 CTGTGTTAGCAAAGGCAAAAAGG - Intronic
1034260652 7:149753255-149753277 CAGGGGCAGCAGGGGCAGCAGGG + Intergenic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1035329718 7:158088375-158088397 CTCTTTCATCAGGGGAAGAAGGG - Intronic
1035478334 7:159159484-159159506 CTGGGTCTCCAGGGGCAAAAGGG - Intergenic
1035716020 8:1755498-1755520 CTGTCTCTGAAGGGGTAGAACGG - Intergenic
1035819049 8:2571928-2571950 CTGAGTCCGCAGATGCAGAAGGG - Intergenic
1036190552 8:6665949-6665971 TTGTGGCTGCAGAGGCAGAAAGG - Intergenic
1036710292 8:11074200-11074222 CTGCTCCAGCAGGAGCAGAAAGG + Intronic
1037453807 8:19043739-19043761 CTGTGTCATCTGTGGCAAAAGGG - Intronic
1039263765 8:35802414-35802436 CTGTGTCAGCAGGATCACACTGG + Intergenic
1041021650 8:53644085-53644107 CTGTCTCAGCAGGTGAAGGAAGG - Intergenic
1042131051 8:65587041-65587063 CTGTGTCAGCAGAGCTTGAAAGG - Intergenic
1042169484 8:65978011-65978033 CTGGGTCAGCAGCTGCAGAGGGG - Intergenic
1045675850 8:104607487-104607509 CTGCATCAGCTGTGGCAGAAGGG + Intronic
1045785435 8:105915839-105915861 CTGTGTAAGGAGGGTGAGAAGGG - Intergenic
1047171798 8:122500895-122500917 ATGTGTGAGCAGGGGCAACAGGG - Intergenic
1048080545 8:131121875-131121897 CTCTCTCAGCAGAGGCAGAAGGG + Intergenic
1049495101 8:142926366-142926388 CAGACTCAGCAGGGGCAGGAAGG - Intergenic
1049661325 8:143820915-143820937 CTGGGCCGGCTGGGGCAGAAAGG + Intronic
1049691281 8:143960909-143960931 GTGGGAAAGCAGGGGCAGAATGG - Intronic
1051551001 9:18329161-18329183 CTGTGTCCTCACGGGTAGAAGGG - Intergenic
1054778062 9:69140463-69140485 GTGTGTCAGCAGGTGCAGCGTGG + Intronic
1056340601 9:85627657-85627679 CTGTCTCAGCAGGGGCAAAGGGG - Intronic
1056458648 9:86788080-86788102 ATGTGTCAGCAGTGGCGGGAGGG + Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1057231407 9:93323785-93323807 CTGTGTGGGCCGGGGCAGGAGGG + Intronic
1057236688 9:93366838-93366860 CTGTGTGGGCTGGGGCAGGAGGG - Intergenic
1057932625 9:99208935-99208957 CTGATTCAACAGGGTCAGAAAGG + Intergenic
1057988661 9:99744460-99744482 TTGTGGCAGCAGGGACAGAGAGG - Intergenic
1058401428 9:104624410-104624432 CTTTATCAGCAGGGGGAAAACGG + Intergenic
1059359853 9:113733802-113733824 ATGTGCCTGCAGGGGCAGATGGG + Intergenic
1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG + Exonic
1059722592 9:116975668-116975690 CTATGTCAGCAGGGACAGTCTGG + Intronic
1059786752 9:117594439-117594461 CTGTATCAGCAGGAGAAGAAAGG + Intergenic
1060260560 9:122070485-122070507 CTTTGTCTGCAGGGGCCGAGGGG - Intronic
1060428146 9:123523971-123523993 CTGTTTCAGCAGGCACAAAAGGG - Intronic
1060827720 9:126696126-126696148 TCCTGTCAGCAGGGGCAGGAGGG - Intronic
1060972287 9:127745058-127745080 CTGTGGCAGAAGGGGCTGCAGGG + Exonic
1061228927 9:129300960-129300982 CGGTGTCAGCAGAGACTGAATGG - Intergenic
1061311798 9:129768380-129768402 CTGGGTCAACAGGGAAAGAAGGG - Intergenic
1062090099 9:134671567-134671589 CTGAGTCAGCAGAGCCAGAGAGG + Intronic
1062580194 9:137225985-137226007 CAGTGGCAGCAGTGGCAGCAGGG - Exonic
1186626469 X:11298846-11298868 CTGTGGCGGCAGGGGCTGCATGG - Exonic
1187038772 X:15570711-15570733 CTGTCCAAGCAGGGGCACAAGGG - Intronic
1187764900 X:22630671-22630693 CCCTGTCAGCAGAGGGAGAAGGG - Intergenic
1189295198 X:39912964-39912986 CGGTGTCAGCTGGGGCAGCTGGG + Intergenic
1190521389 X:51281490-51281512 CTGTGTTAACAGGGCCAAAAAGG + Intergenic
1192789572 X:74368195-74368217 CTGGGGCAGCAGGGGCCAAATGG - Intergenic
1192964930 X:76167182-76167204 CTGTGTCAGGTTGGCCAGAATGG + Intergenic
1192982962 X:76366848-76366870 CAGTGGCAGCAGTGGCAGCATGG + Intergenic
1193421954 X:81293311-81293333 CTTTGTCAGCAGGGTGAAAATGG + Intronic
1193584713 X:83306787-83306809 CTATGTCACCAGAAGCAGAATGG + Intergenic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1195862214 X:109394557-109394579 CTGTGTCAGCTCTGGCAGAGAGG - Intronic
1196109388 X:111929995-111930017 ATGTTTGAGCAGAGGCAGAATGG - Intronic
1196132275 X:112169894-112169916 ATGTGTCTGTAGGGGCAGGAGGG - Intergenic
1196588147 X:117454335-117454357 CTCTGTCAGCAAGTGCAGAGTGG - Intergenic
1196815112 X:119659225-119659247 GTAAGTCAGCAGGGGAAGAATGG - Intronic
1197146840 X:123181418-123181440 CTGAGCCAGCAGGGGCACAGTGG - Intergenic
1198477010 X:137004899-137004921 CTGTATCAGCAGCGTGAGAATGG - Intergenic
1200134394 X:153867855-153867877 CTGCGTCAGCAGGTGCAGGTCGG + Exonic
1200153928 X:153965270-153965292 GTGTGGCAGCAGGGGCAGGGAGG - Intronic
1200742368 Y:6868142-6868164 CTGTGGCAGCAGGGGCTGCATGG + Exonic
1201165449 Y:11204664-11204686 GTGGCTCAGCAGTGGCAGAAAGG + Intergenic