ID: 1102453036

View in Genome Browser
Species Human (GRCh38)
Location 12:113055808-113055830
Sequence TCCGGGAACTCCAGCCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 633}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102453036_1102453046 21 Left 1102453036 12:113055808-113055830 CCACCCAGGCTGGAGTTCCCGGA 0: 1
1: 0
2: 5
3: 31
4: 633
Right 1102453046 12:113055852-113055874 TCTAAACACCCCCAGGCCCCAGG 0: 1
1: 0
2: 1
3: 19
4: 237
1102453036_1102453047 24 Left 1102453036 12:113055808-113055830 CCACCCAGGCTGGAGTTCCCGGA 0: 1
1: 0
2: 5
3: 31
4: 633
Right 1102453047 12:113055855-113055877 AAACACCCCCAGGCCCCAGGTGG 0: 1
1: 1
2: 4
3: 41
4: 331
1102453036_1102453042 14 Left 1102453036 12:113055808-113055830 CCACCCAGGCTGGAGTTCCCGGA 0: 1
1: 0
2: 5
3: 31
4: 633
Right 1102453042 12:113055845-113055867 TCCCCAATCTAAACACCCCCAGG 0: 1
1: 0
2: 1
3: 9
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102453036 Original CRISPR TCCGGGAACTCCAGCCTGGG TGG (reversed) Intergenic
900155954 1:1203358-1203380 TCTGGGAACTCCTGGCTGGGTGG - Intergenic
900277659 1:1842388-1842410 CCCCTGCACTCCAGCCTGGGCGG + Intronic
900532933 1:3163545-3163567 ACCGGGTACCCCAGCCTGAGTGG + Intronic
901453682 1:9351585-9351607 CCCTGGAACTGCAGCCTGGAGGG - Intronic
901469407 1:9445501-9445523 TCACTGCACTCCAGCCTGGGTGG + Intergenic
901605248 1:10454209-10454231 TCACTGCACTCCAGCCTGGGTGG - Intergenic
901722411 1:11210200-11210222 CCAGTGCACTCCAGCCTGGGTGG - Intronic
901885080 1:12217073-12217095 TCACTGTACTCCAGCCTGGGTGG + Intergenic
902165115 1:14563912-14563934 TTGTGCAACTCCAGCCTGGGTGG - Intergenic
902216777 1:14939307-14939329 CCATGGCACTCCAGCCTGGGAGG - Intronic
902291139 1:15435985-15436007 TCTGGGGACTTCAGCCTGCGGGG - Intergenic
902419076 1:16263401-16263423 TCACTGCACTCCAGCCTGGGTGG + Intronic
902519993 1:17010870-17010892 GCCGGGAACCACAGCCAGGGAGG - Intronic
902539263 1:17141114-17141136 TCATTGCACTCCAGCCTGGGGGG + Intergenic
902781629 1:18708746-18708768 TCAGGGATCTCCAGTCTGGTGGG + Intronic
903179289 1:21597354-21597376 TCAGAGAACCCCACCCTGGGAGG + Intronic
903398737 1:23022696-23022718 TCACTGCACTCCAGCCTGGGTGG - Intronic
903542767 1:24106178-24106200 ACCGGGAACTCCAGCCCATGTGG - Intronic
904064497 1:27738435-27738457 CCCCTGCACTCCAGCCTGGGTGG + Intronic
904484230 1:30814285-30814307 TCCAGGAGCACCAGCCTTGGAGG - Intergenic
905037927 1:34929640-34929662 CCCGGGAAATCCAGCCTCCGTGG - Intergenic
905129893 1:35746432-35746454 CCAGTGCACTCCAGCCTGGGTGG - Intronic
905197641 1:36293066-36293088 TCACTGCACTCCAGCCTGGGTGG - Intronic
905517263 1:38571035-38571057 TCATTGCACTCCAGCCTGGGTGG - Intergenic
905973631 1:42159154-42159176 TCACTGCACTCCAGCCTGGGTGG + Intergenic
906088834 1:43159886-43159908 TCATTGCACTCCAGCCTGGGCGG + Intergenic
906157344 1:43621466-43621488 CCACGGCACTCCAGCCTGGGTGG + Intronic
906500773 1:46340648-46340670 TCAGGGGACTCCTGGCTGGGCGG + Exonic
907029073 1:51153008-51153030 TCACTGCACTCCAGCCTGGGTGG - Intergenic
907891376 1:58639729-58639751 CCACGGCACTCCAGCCTGGGTGG - Intergenic
909203938 1:72728494-72728516 CCACTGAACTCCAGCCTGGGTGG + Intergenic
910248174 1:85165192-85165214 CCCCTGCACTCCAGCCTGGGTGG + Intronic
910373478 1:86543503-86543525 TCCCTGAACTCCAGCTTTGGTGG - Intergenic
911006481 1:93230450-93230472 TCACTGCACTCCAGCCTGGGTGG + Intronic
911148056 1:94570828-94570850 TCACTGCACTCCAGCCTGGGCGG - Intergenic
911521382 1:98934197-98934219 TCTGGGAACTGGAGCTTGGGTGG + Intronic
912659340 1:111514462-111514484 TCAGGGAGGTCAAGCCTGGGAGG + Intronic
912746084 1:112246712-112246734 TCAGGCAACTCCTGCCTTGGAGG - Intergenic
914243568 1:145869513-145869535 TCACTGCACTCCAGCCTGGGTGG - Intronic
915230184 1:154439940-154439962 ACAGTGCACTCCAGCCTGGGTGG - Intronic
917717608 1:177754006-177754028 TCAGGGAACTCCAGTTTGGAGGG + Intergenic
917811038 1:178658713-178658735 CCCTTGCACTCCAGCCTGGGTGG - Intergenic
919340831 1:196304391-196304413 GCAGTGCACTCCAGCCTGGGTGG - Intronic
920140430 1:203807564-203807586 TCACTGCACTCCAGCCTGGGAGG - Intronic
920242004 1:204559523-204559545 TCACTGCACTCCAGCCTGGGGGG - Intergenic
921039165 1:211413315-211413337 TCACTGCACTCCAGCCTGGGCGG + Intergenic
921269182 1:213451897-213451919 GCCTGGTGCTCCAGCCTGGGTGG + Intergenic
921271071 1:213470657-213470679 TCACTGCACTCCAGCCTGGGTGG - Intergenic
921746959 1:218750776-218750798 TCAGGGAACTTCAGCCTAGAAGG - Intergenic
924141358 1:241027161-241027183 TCATTGTACTCCAGCCTGGGTGG + Intronic
924629842 1:245726327-245726349 CCACTGAACTCCAGCCTGGGTGG + Intergenic
1063938766 10:11106623-11106645 TCAGGGAATTCCACCCTGGAGGG - Intronic
1064715713 10:18174441-18174463 TCATTGCACTCCAGCCTGGGCGG - Intronic
1065372057 10:24997424-24997446 TCACTGCACTCCAGCCTGGGTGG - Intronic
1065495643 10:26325062-26325084 CCACTGAACTCCAGCCTGGGTGG - Intergenic
1065806489 10:29398000-29398022 TCGCTGCACTCCAGCCTGGGTGG + Intergenic
1066100883 10:32117407-32117429 TCATTGCACTCCAGCCTGGGCGG + Intergenic
1066339215 10:34513317-34513339 CCCTTGCACTCCAGCCTGGGCGG - Intronic
1067173827 10:43928621-43928643 TCCTGGAGTCCCAGCCTGGGAGG + Intergenic
1067472605 10:46547665-46547687 TCCAGGAACCCCAGCCTGTTAGG - Intergenic
1067534231 10:47096318-47096340 CCAGTGCACTCCAGCCTGGGTGG - Intergenic
1069314446 10:67079806-67079828 CCACTGAACTCCAGCCTGGGTGG + Intronic
1070237513 10:74644571-74644593 TCCCTGAACTCCAGCCTGGGTGG - Intronic
1072087493 10:92094560-92094582 TCACTGCACTCCAGCCTGGGCGG + Intronic
1072562163 10:96586647-96586669 GCCGGGCACTCCAGGCTGCGTGG + Intronic
1072970454 10:100012651-100012673 CCCCTGCACTCCAGCCTGGGCGG - Intergenic
1073324781 10:102636199-102636221 CCAGTGCACTCCAGCCTGGGAGG - Intergenic
1073474404 10:103743428-103743450 TCACTGCACTCCAGCCTGGGTGG - Intronic
1073886286 10:108043617-108043639 TCAGTGACCTCAAGCCTGGGTGG - Intergenic
1074267655 10:111920878-111920900 TCCGGGGACTACTGCCTGGTGGG - Intergenic
1074483540 10:113851763-113851785 CCAGGGCACTCCAGCCTGGGTGG - Intronic
1074842995 10:117374302-117374324 GCCGGGAACCCGGGCCTGGGCGG - Intronic
1075347950 10:121698042-121698064 TCCCTGCACTCCACCCTGGGAGG + Intergenic
1077002797 11:332992-333014 TCAGGGCCCTCCAGCTTGGGAGG + Intergenic
1077120865 11:907806-907828 TCCAGGAACCCCAGCCAGGCAGG + Intronic
1077851818 11:6080200-6080222 CCACTGAACTCCAGCCTGGGTGG + Intergenic
1078586681 11:12597601-12597623 TCACTGCACTCCAGCCTGGGTGG - Intergenic
1078792915 11:14562662-14562684 CCCCTGCACTCCAGCCTGGGTGG - Intronic
1080593778 11:33749397-33749419 CCAGTGCACTCCAGCCTGGGTGG - Intronic
1081496558 11:43616930-43616952 TCATTGCACTCCAGCCTGGGTGG + Intronic
1081796603 11:45824742-45824764 CCCCTGAACTCTAGCCTGGGTGG - Intergenic
1082086086 11:48051133-48051155 TCATTGCACTCCAGCCTGGGTGG - Intronic
1082918529 11:58466067-58466089 TCACTGCACTCCAGCCTGGGTGG + Intergenic
1083640152 11:64141093-64141115 CCAGTGTACTCCAGCCTGGGTGG + Intronic
1083786128 11:64948694-64948716 CCCCTGCACTCCAGCCTGGGCGG - Intronic
1083992469 11:66255223-66255245 CCACTGAACTCCAGCCTGGGCGG - Intergenic
1084097452 11:66920984-66921006 GCCGAGATCTCCAGGCTGGGTGG + Intronic
1084204779 11:67585030-67585052 TCTGTGAGCCCCAGCCTGGGAGG - Intronic
1084378238 11:68793006-68793028 TCACTGCACTCCAGCCTGGGTGG + Intronic
1084540548 11:69783624-69783646 GCCCTGCACTCCAGCCTGGGGGG - Intergenic
1085335218 11:75688182-75688204 TCCCGGAACTCCAGGGTGGCAGG - Intergenic
1085443133 11:76580879-76580901 TCACTGCACTCCAGCCTGGGTGG - Intergenic
1086046728 11:82541634-82541656 TCACCGCACTCCAGCCTGGGTGG + Intergenic
1086514808 11:87599574-87599596 CCACTGAACTCCAGCCTGGGTGG - Intergenic
1087199021 11:95327278-95327300 TCTGGCAACTCAAGCCTGGTGGG - Intergenic
1087332586 11:96799511-96799533 TCTGCAAACTACAGCCTGGGGGG - Intergenic
1087762005 11:102111271-102111293 TGCGGGAACTCTAGCTGGGGTGG + Intronic
1088472037 11:110196936-110196958 CCCCTGCACTCCAGCCTGGGTGG - Intronic
1088870002 11:113882605-113882627 TCACTGCACTCCAGCCTGGGTGG + Intergenic
1089867892 11:121648027-121648049 TCACTGTACTCCAGCCTGGGTGG - Intergenic
1089899439 11:121965472-121965494 TCCGGAAGTTCCAGGCTGGGAGG + Intergenic
1090008803 11:123027432-123027454 TCACTGCACTCCAGCCTGGGTGG + Intergenic
1090761616 11:129841634-129841656 TCACTGCACTCCAGCCTGGGCGG - Intronic
1091168455 11:133500734-133500756 TCTGGGAACTCCAGCCTGCTGGG - Intronic
1091397294 12:161822-161844 CCCGGGAGCTCCAGGCTGGATGG + Intronic
1091440404 12:508317-508339 TCACTGAACTCCAGCTTGGGTGG - Intronic
1092230782 12:6774229-6774251 TCTGGGCACTCCCGCGTGGGTGG - Intronic
1092386554 12:8039921-8039943 CCCGGGAGGCCCAGCCTGGGAGG - Exonic
1092791296 12:12072924-12072946 CCAGTGCACTCCAGCCTGGGTGG - Intronic
1093453502 12:19341235-19341257 TCGCTGCACTCCAGCCTGGGTGG + Intronic
1093718206 12:22408084-22408106 CACTGCAACTCCAGCCTGGGTGG + Intronic
1094081708 12:26543727-26543749 TCACTGCACTCCAGCCTGGGTGG + Intronic
1094222809 12:28012696-28012718 TCCAGAAACCCCAGACTGGGTGG - Intergenic
1094245955 12:28293766-28293788 TCATTGTACTCCAGCCTGGGTGG - Intronic
1095456920 12:42396996-42397018 TCACTGCACTCCAGCCTGGGTGG + Intronic
1096133300 12:49178458-49178480 CACTGCAACTCCAGCCTGGGCGG - Intergenic
1096567977 12:52496915-52496937 TCTGCCAACTCCACCCTGGGAGG - Intergenic
1097299887 12:58006654-58006676 CCCCTGTACTCCAGCCTGGGTGG + Intergenic
1097939369 12:65287153-65287175 CCATGGCACTCCAGCCTGGGCGG - Intronic
1099610159 12:84857724-84857746 TAGGGAAACACCAGCCTGGGTGG - Intergenic
1101171307 12:102098569-102098591 TCACTGCACTCCAGCCTGGGTGG - Intronic
1101343400 12:103863236-103863258 TCAGTGGACTGCAGCCTGGGTGG - Intergenic
1101614795 12:106325849-106325871 TCATTGCACTCCAGCCTGGGGGG + Intronic
1102018535 12:109664900-109664922 TCACTGCACTCCAGCCTGGGTGG - Intergenic
1102453036 12:113055808-113055830 TCCGGGAACTCCAGCCTGGGTGG - Intergenic
1102788841 12:115626808-115626830 TCAGTAAACTCCAGCCTGAGAGG + Intergenic
1102959579 12:117084052-117084074 CCACTGAACTCCAGCCTGGGTGG + Intronic
1103096463 12:118136469-118136491 CCCGGGACCTCTGGCCTGGGGGG - Intronic
1103291362 12:119848968-119848990 CCACTGAACTCCAGCCTGGGTGG + Intronic
1103416045 12:120741938-120741960 TCCAGGAAGTGCAGCCTCGGAGG + Intergenic
1103635368 12:122300228-122300250 TCACTGTACTCCAGCCTGGGTGG + Intronic
1103709422 12:122900488-122900510 CCACTGAACTCCAGCCTGGGCGG - Intergenic
1104064577 12:125296456-125296478 TCCGGGAAGGCCATCCTGGGAGG - Intronic
1104449224 12:128855524-128855546 CCACTGAACTCCAGCCTGGGTGG + Intronic
1105071202 12:133235530-133235552 GCCTGGGGCTCCAGCCTGGGAGG + Exonic
1105721783 13:23123937-23123959 CCACTGAACTCCAGCCTGGGTGG - Intergenic
1106124940 13:26893478-26893500 TCACTGCACTCCAGCCTGGGCGG - Intergenic
1107086532 13:36432317-36432339 TCGAGGGATTCCAGCCTGGGAGG - Intronic
1107478278 13:40762471-40762493 TCACTGTACTCCAGCCTGGGTGG - Intronic
1107533623 13:41307575-41307597 CCAGTGCACTCCAGCCTGGGTGG + Intergenic
1107594668 13:41950706-41950728 TCACTGCACTCCAGCCTGGGTGG - Intronic
1107926984 13:45272778-45272800 TTTGAGCACTCCAGCCTGGGTGG - Intronic
1107975457 13:45683939-45683961 CCAGGCAACTCCTGCCTGGGGGG + Intergenic
1109364925 13:61341958-61341980 TCACTGTACTCCAGCCTGGGCGG + Intergenic
1109617375 13:64853093-64853115 CCAGTGCACTCCAGCCTGGGTGG - Intergenic
1110170867 13:72498916-72498938 TCCAGGAACTCCAGATTAGGTGG + Intergenic
1110218844 13:73051736-73051758 CCAGTGCACTCCAGCCTGGGCGG - Intergenic
1110317028 13:74120438-74120460 TCACTGCACTCCAGCCTGGGTGG + Intronic
1110444809 13:75567585-75567607 TCACTGCACTCCAGCCTGGGCGG - Intronic
1112474725 13:99721081-99721103 TCACTGCACTCCAGCCTGGGCGG - Intronic
1112483722 13:99800832-99800854 CCACTGAACTCCAGCCTGGGCGG + Intronic
1112710379 13:102120741-102120763 TCACTGCACTCCAGCCTGGGCGG - Intronic
1112953611 13:105033245-105033267 TCGCTGCACTCCAGCCTGGGTGG - Intergenic
1113075590 13:106464757-106464779 TCACTGCACTCCAGCCTGGGCGG + Intergenic
1113101142 13:106721067-106721089 TCACTGTACTCCAGCCTGGGTGG - Intergenic
1113579385 13:111418343-111418365 CCCGGGACCCCCATCCTGGGAGG - Intergenic
1113858149 13:113460783-113460805 TCCAGGAACCCCAGCCTGAGAGG + Intronic
1114062982 14:19037484-19037506 GCCGTGAACTCCAGCATTGGAGG - Intergenic
1114099277 14:19362513-19362535 GCCGTGAACTCCAGCATTGGAGG + Intergenic
1114330495 14:21632368-21632390 CCACGGCACTCCAGCCTGGGCGG + Intergenic
1114439289 14:22733212-22733234 TCACTGGACTCCAGCCTGGGTGG - Intergenic
1114856565 14:26453245-26453267 TCACTGTACTCCAGCCTGGGTGG - Intronic
1115511295 14:34140019-34140041 TCCGGGAAGTTCAAACTGGGTGG + Intronic
1116868293 14:50048926-50048948 TCACTGCACTCCAGCCTGGGGGG + Intergenic
1117142142 14:52799807-52799829 CCACTGAACTCCAGCCTGGGTGG + Intergenic
1119425595 14:74532877-74532899 CCCCTGCACTCCAGCCTGGGTGG - Intronic
1119482838 14:74969848-74969870 TCACTGCACTCCAGCCTGGGTGG - Intergenic
1119560829 14:75588520-75588542 TCTGTGAACTCCAGCCTGGGTGG - Intronic
1121372378 14:93371345-93371367 CCATGGCACTCCAGCCTGGGTGG + Intronic
1121632023 14:95428219-95428241 TTGGGGAGCTCCAGCCTGTGTGG - Intronic
1121645270 14:95514213-95514235 CCAGGGGACTCCAGCCTGGGCGG - Intergenic
1121645612 14:95515817-95515839 CCAGGGGCCTCCAGCCTGGGCGG - Intergenic
1122253292 14:100456302-100456324 GCTGAGTACTCCAGCCTGGGTGG - Intronic
1122453208 14:101828715-101828737 TCACTGTACTCCAGCCTGGGAGG - Intronic
1122725867 14:103751644-103751666 TCCGTGAACTTCATCATGGGGGG - Intronic
1122734511 14:103829647-103829669 TCATTGAACTCCAGCCTAGGTGG - Intronic
1122810970 14:104287711-104287733 GCTGGGAACCCCAGCCTGTGGGG + Intergenic
1122903766 14:104792676-104792698 TCGGGGAGCGCCAGCCTGAGAGG - Exonic
1123497537 15:20843256-20843278 CCACTGAACTCCAGCCTGGGAGG + Intronic
1125154784 15:36573393-36573415 TGAAAGAACTCCAGCCTGGGTGG - Intergenic
1125582330 15:40795207-40795229 CCCCTGCACTCCAGCCTGGGCGG + Intronic
1125896573 15:43307749-43307771 TCCTTGACCTCAAGCCTGGGAGG + Intergenic
1127218662 15:56852502-56852524 CCCCTGCACTCCAGCCTGGGTGG + Intronic
1127265806 15:57360596-57360618 TCATTGCACTCCAGCCTGGGAGG + Intergenic
1127526958 15:59802687-59802709 TCACTGCACTCCAGCCTGGGTGG + Intergenic
1128039966 15:64563409-64563431 TCACTGCACTCCAGCCTGGGTGG + Intronic
1128205730 15:65850156-65850178 CACTGTAACTCCAGCCTGGGGGG + Intronic
1128583501 15:68826499-68826521 TCACTGCACTCCAGCCTGGGTGG - Intronic
1129028185 15:72598755-72598777 TCATGGCACTCAAGCCTGGGTGG - Exonic
1129281481 15:74488522-74488544 TCACTGCACTCCAGCCTGGGTGG + Intergenic
1129629834 15:77246473-77246495 GTCTGGACCTCCAGCCTGGGTGG + Intronic
1129878597 15:78992932-78992954 TCAGGGATCTCCAGCCTAAGTGG + Intronic
1130387323 15:83423224-83423246 TCCGGGAACATCAGACTGTGTGG + Intergenic
1130585517 15:85178031-85178053 TCACTGCACTCCAGCCTGGGTGG - Intergenic
1132027080 15:98412710-98412732 CCAGCGCACTCCAGCCTGGGAGG + Intergenic
1202963116 15_KI270727v1_random:144092-144114 CCACTGAACTCCAGCCTGGGAGG + Intergenic
1132714150 16:1282472-1282494 CCCGTGAACCCCAGCGTGGGTGG - Intergenic
1133049391 16:3108453-3108475 TCACTGCACTCCAGCCTGGGGGG - Intergenic
1133110307 16:3544116-3544138 TCACTGCACTCCAGCCTGGGTGG + Intronic
1133521754 16:6565089-6565111 TCACTGCACTCCAGCCTGGGTGG + Intronic
1133995856 16:10747593-10747615 CCAGTGTACTCCAGCCTGGGTGG + Intronic
1134014180 16:10877296-10877318 TCCGGGAGCTGCTGCCTGGCTGG + Exonic
1134645327 16:15860408-15860430 TCACTGTACTCCAGCCTGGGTGG + Intergenic
1135033647 16:19058915-19058937 TCACTGCACTCCAGCCTGGGCGG - Intronic
1135737026 16:24939946-24939968 GCCAAGCACTCCAGCCTGGGTGG - Intronic
1137646204 16:50076906-50076928 GCCACGCACTCCAGCCTGGGCGG - Intronic
1138161432 16:54758513-54758535 CCCCTGCACTCCAGCCTGGGTGG + Intergenic
1138510985 16:57508292-57508314 TCTGGGCACTCCAGCCTGTGAGG + Intergenic
1139168429 16:64600151-64600173 TCACTGCACTCCAGCCTGGGTGG - Intergenic
1139318545 16:66094179-66094201 TCACTGCACTCCAGCCTGGGTGG + Intergenic
1139915455 16:70425676-70425698 TCCATTCACTCCAGCCTGGGTGG + Intronic
1139949475 16:70662147-70662169 CCCAGGAGCTCAAGCCTGGGAGG + Exonic
1140310354 16:73842382-73842404 TCCAGGAACTTAAGGCTGGGGGG - Intergenic
1140470508 16:75211520-75211542 CCATGGCACTCCAGCCTGGGTGG + Intergenic
1140612642 16:76619449-76619471 TCACTGCACTCCAGCCTGGGCGG + Intronic
1141102066 16:81204811-81204833 ACTGAGAACTACAGCCTGGGAGG - Intergenic
1141776747 16:86128151-86128173 CCACTGAACTCCAGCCTGGGTGG - Intergenic
1141966306 16:87446727-87446749 TCACTGCACTCCAGCCTGGGTGG - Intronic
1142161370 16:88559315-88559337 TCCGGGGCCTGCAGGCTGGGGGG + Intergenic
1142233181 16:88909330-88909352 TCCGGGCCCTGCAACCTGGGTGG + Intronic
1142548947 17:725908-725930 ACCAGGCACTCCAGCCTGAGTGG - Intergenic
1142761900 17:2047424-2047446 CCACTGAACTCCAGCCTGGGTGG - Intergenic
1142959624 17:3544523-3544545 TCTGGCACCCCCAGCCTGGGTGG + Intronic
1143085658 17:4414012-4414034 TCATTGCACTCCAGCCTGGGTGG - Intergenic
1143726116 17:8847761-8847783 TCATTGCACTCCAGCCTGGGTGG + Intronic
1144339771 17:14301771-14301793 GCCCGGAACGGCAGCCTGGGGGG - Exonic
1144712550 17:17411491-17411513 CCACGGCACTCCAGCCTGGGTGG + Intergenic
1144747326 17:17624504-17624526 CCACGGCACTCCAGCCTGGGTGG + Intergenic
1146268794 17:31471100-31471122 CCCCTGCACTCCAGCCTGGGTGG - Intronic
1146720519 17:35120312-35120334 CCAGGGCACTCCAGCCTGGGCGG - Intronic
1146914447 17:36669484-36669506 TCACAGCACTCCAGCCTGGGTGG + Intergenic
1147282488 17:39373724-39373746 TCCGGAAACTACAGCCTAGTAGG - Intronic
1147593153 17:41698549-41698571 TCACTGCACTCCAGCCTGGGCGG + Intergenic
1147688056 17:42299105-42299127 TCAGGGAACCCCAGCCCCGGCGG - Intronic
1148168073 17:45497671-45497693 TCACTGCACTCCAGCCTGGGTGG + Intergenic
1148997056 17:51719843-51719865 TCCCACAACTGCAGCCTGGGTGG + Intronic
1150399258 17:64844087-64844109 TCACTGCACTCCAGCCTGGGTGG + Intergenic
1150418172 17:65004648-65004670 TCACTGCACTCCAGCCTGGGTGG + Intergenic
1150430633 17:65113228-65113250 TCACTGCACTCCAGCCTGGGCGG - Intergenic
1150877499 17:68985898-68985920 ACTGAGCACTCCAGCCTGGGCGG + Intronic
1150911804 17:69395445-69395467 TCACTGCACTCCAGCCTGGGCGG + Intergenic
1151314360 17:73312368-73312390 ACCAAGAACTCCAGCCCGGGTGG + Intergenic
1151447450 17:74176546-74176568 TCTGGGGAATCCAGCTTGGGAGG - Intergenic
1151860009 17:76753646-76753668 TCACAGCACTCCAGCCTGGGAGG + Intronic
1151939609 17:77284261-77284283 ACACGGCACTCCAGCCTGGGTGG + Intronic
1152007270 17:77690484-77690506 TCCTCGAGCTGCAGCCTGGGGGG - Intergenic
1152497535 17:80684481-80684503 CACTGCAACTCCAGCCTGGGCGG - Intronic
1152777346 17:82210952-82210974 CCACTGAACTCCAGCCTGGGCGG + Intronic
1152796938 17:82312745-82312767 TCACTGCACTCCAGCCTGGGTGG - Intergenic
1152798600 17:82320842-82320864 ACCGTGTACTCCAGCCTGGGCGG + Intergenic
1153132319 18:1869117-1869139 TCACTGCACTCCAGCCTGGGTGG + Intergenic
1153168103 18:2285181-2285203 CCAGTGCACTCCAGCCTGGGCGG - Intergenic
1153337792 18:3942405-3942427 TACAGGACCTCCAGCCTCGGAGG + Intronic
1153465146 18:5380208-5380230 TCACTGCACTCCAGCCTGGGTGG + Intergenic
1153808500 18:8731532-8731554 TCATCGCACTCCAGCCTGGGGGG + Intronic
1153886063 18:9467804-9467826 CCCCTGTACTCCAGCCTGGGTGG + Intergenic
1154142734 18:11839511-11839533 TCACTGCACTCCAGCCTGGGTGG + Intronic
1154451098 18:14475164-14475186 GCCGTGAACTCCAGCATTGGAGG + Intergenic
1154997623 18:21655788-21655810 TCTTTGCACTCCAGCCTGGGTGG + Intronic
1155541834 18:26876601-26876623 CCCCGGTACTCCAGCCTGGATGG - Intergenic
1155828465 18:30480690-30480712 CCCCTGCACTCCAGCCTGGGCGG - Intergenic
1156149081 18:34222730-34222752 TCCGGGAACCCGAGGCGGGGAGG + Intronic
1157340857 18:46777191-46777213 CCAGTGCACTCCAGCCTGGGTGG - Intergenic
1157693322 18:49701089-49701111 TCCAGGCCCTCCAGCCTGGCAGG - Intergenic
1158092873 18:53736297-53736319 CCACTGAACTCCAGCCTGGGTGG - Intergenic
1158344473 18:56501962-56501984 TCCGGGAACTCCACTCTGTTTGG - Intergenic
1158476402 18:57783793-57783815 CCACTGAACTCCAGCCTGGGTGG + Intronic
1158789518 18:60760929-60760951 CCACGGTACTCCAGCCTGGGTGG - Intergenic
1158970176 18:62658890-62658912 CCCCTGCACTCCAGCCTGGGTGG + Intergenic
1159034395 18:63263099-63263121 TCAGGGAACCTCAGCCTAGGGGG + Intronic
1159817947 18:73100522-73100544 TCACCGCACTCCAGCCTGGGCGG - Intergenic
1160718605 19:588008-588030 TCACTGCACTCCAGCCTGGGCGG + Intergenic
1160744206 19:703226-703248 TCACTGCACTCCAGCCTGGGTGG + Intergenic
1160817370 19:1042350-1042372 TCCGCGACATCCAGCATGGGTGG - Exonic
1160830154 19:1100682-1100704 TCACTGCACTCCAGCCTGGGGGG - Intergenic
1160904114 19:1444529-1444551 CCAGTGCACTCCAGCCTGGGCGG - Intergenic
1161053877 19:2180255-2180277 CCAGGGAGCTCCAGCCTGGCTGG - Intronic
1161333589 19:3699657-3699679 TCCTGGACCTCCAGCCGGGTAGG - Intronic
1161352483 19:3801672-3801694 TCCGGGAACCGCGGCCTGGTGGG + Exonic
1161499917 19:4608246-4608268 TCTCTGCACTCCAGCCTGGGTGG + Intergenic
1161688384 19:5715695-5715717 CCAGTGCACTCCAGCCTGGGTGG - Intronic
1161980032 19:7625516-7625538 CCACGGAAGTCCAGCCTGGGTGG - Intronic
1162272331 19:9626389-9626411 CCCCTGTACTCCAGCCTGGGTGG + Intronic
1162393427 19:10403250-10403272 TCCTGAAAATCCAGACTGGGGGG + Intronic
1162404372 19:10464755-10464777 CCCCTGCACTCCAGCCTGGGTGG - Intronic
1163196195 19:15722889-15722911 TCACTGCACTCCAGCCTGGGTGG - Intergenic
1163472679 19:17506478-17506500 GCAGTGCACTCCAGCCTGGGTGG + Intergenic
1163731379 19:18951491-18951513 TCCTGGAACCCCAGTCTGAGAGG + Intergenic
1163853226 19:19678573-19678595 TCACTGCACTCCAGCCTGGGTGG + Intronic
1163957647 19:20659277-20659299 CCAAGGCACTCCAGCCTGGGTGG - Intronic
1164023754 19:21331456-21331478 TCACTGCACTCCAGCCTGGGTGG + Intergenic
1164599827 19:29553213-29553235 TCTGGGATCTCCATCCTGGAAGG - Intronic
1165235194 19:34415158-34415180 TCACTGCACTCCAGCCTGGGTGG - Intronic
1165383307 19:35495796-35495818 TCAGGGAACTCAAACCTGGAGGG + Intergenic
1165765058 19:38345300-38345322 CCCCTGCACTCCAGCCTGGGTGG - Intronic
1166185325 19:41135616-41135638 TCCGGACGCTCCAGGCTGGGCGG + Intergenic
1166690564 19:44819594-44819616 GACGGCCACTCCAGCCTGGGAGG - Exonic
1166824649 19:45601379-45601401 TTCAGGAATTCCTGCCTGGGGGG - Intronic
1167129409 19:47574124-47574146 CCACTGAACTCCAGCCTGGGCGG - Intergenic
1167170631 19:47829153-47829175 CCAGTGCACTCCAGCCTGGGAGG - Intronic
1167327883 19:48836508-48836530 TCCTGGAAGTCCGGCCTCGGGGG + Exonic
1167566929 19:50262496-50262518 TCACTGCACTCCAGCCTGGGTGG + Intronic
1167757487 19:51421727-51421749 TCCGGGGTCTGGAGCCTGGGTGG - Intergenic
1168050320 19:53824937-53824959 CCAGTGAACTCTAGCCTGGGTGG - Intergenic
1168328587 19:55552201-55552223 CCAGGGCTCTCCAGCCTGGGTGG + Intergenic
1168516756 19:57015664-57015686 CCATGGCACTCCAGCCTGGGTGG - Intergenic
1168527395 19:57099931-57099953 GCCGAGATCTCCAGCCTGGGTGG + Intergenic
1168543010 19:57228588-57228610 TCACTGCACTCCAGCCTGGGTGG + Intergenic
1168618189 19:57855303-57855325 TTCCTGCACTCCAGCCTGGGTGG + Intronic
925313159 2:2902284-2902306 GCCTGGGATTCCAGCCTGGGCGG - Intergenic
925597800 2:5573301-5573323 CCACGGCACTCCAGCCTGGGTGG + Intergenic
926672562 2:15589796-15589818 TCACTGTACTCCAGCCTGGGTGG - Intergenic
926712296 2:15891224-15891246 TCTGGGAGCTGCAGCCTGGATGG - Intergenic
928084137 2:28335201-28335223 CCATGGCACTCCAGCCTGGGCGG - Intronic
928111248 2:28510661-28510683 TCATTGCACTCCAGCCTGGGTGG - Intronic
928444459 2:31320580-31320602 TCACTGCACTCCAGCCTGGGTGG + Intergenic
928526463 2:32146523-32146545 TCACTGCACTCCAGCCTGGGTGG + Intronic
928534899 2:32230509-32230531 CCACTGAACTCCAGCCTGGGTGG - Intronic
928860955 2:35856411-35856433 CCATGGCACTCCAGCCTGGGTGG + Intergenic
929534216 2:42770391-42770413 GCCAGGATCTCCACCCTGGGAGG + Intronic
929563977 2:42973457-42973479 TCACCGCACTCCAGCCTGGGTGG + Intergenic
930069594 2:47355419-47355441 TCACTGCACTCCAGCCTGGGCGG - Intronic
930110926 2:47677950-47677972 TCCGGGAGCTCCAGCAGGGAAGG - Intergenic
930124824 2:47787248-47787270 GCCATGCACTCCAGCCTGGGTGG + Intronic
930886882 2:56336192-56336214 TCATTGCACTCCAGCCTGGGGGG - Intronic
933482574 2:82875931-82875953 TCTGGGCAGTCCAGACTGGGAGG + Intergenic
933681584 2:85106435-85106457 ACACTGAACTCCAGCCTGGGTGG + Intergenic
934530680 2:95085952-95085974 TCATGCCACTCCAGCCTGGGTGG - Intergenic
936090914 2:109500908-109500930 CCACGGCACTCCAGCCTGGGTGG + Intronic
936956852 2:118031075-118031097 CCACGGCACTCCAGCCTGGGCGG - Intergenic
937205281 2:120232463-120232485 TCACGGATCTCCAGCCTCGGAGG - Intergenic
937337889 2:121072885-121072907 CCCAGGAACTCCAGGCTGGCAGG - Intergenic
937459131 2:122070271-122070293 TCTGGCAACTCCAACCTGTGAGG - Intergenic
938028335 2:127970186-127970208 TCACTGCACTCCAGCCTGGGTGG + Intronic
938039142 2:128061523-128061545 TCATTGCACTCCAGCCTGGGTGG - Intergenic
938289555 2:130142068-130142090 CACGGGGACCCCAGCCTGGGTGG - Intronic
938386653 2:130871494-130871516 TCATTGTACTCCAGCCTGGGCGG + Intronic
938466975 2:131530870-131530892 CACGGGGACCCCAGCCTGGGTGG + Intronic
938480342 2:131657644-131657666 GCCGTGAACTCCAGCATTGGAGG - Intergenic
938944079 2:136194906-136194928 TCACTGTACTCCAGCCTGGGCGG + Intergenic
939489700 2:142862305-142862327 GCCGGGCACTCCTGCCTGTGTGG + Intergenic
939851423 2:147310946-147310968 TCTGGGAGTTCCATCCTGGGGGG + Intergenic
940030541 2:149257410-149257432 TCCTGGAAATTCAGACTGGGTGG - Intergenic
940206487 2:151207940-151207962 CCACGGCACTCCAGCCTGGGCGG + Intergenic
941070718 2:160951655-160951677 TCCCTGTACTGCAGCCTGGGTGG - Intergenic
941866885 2:170344424-170344446 TCACTGCACTCCAGCCTGGGTGG + Intronic
941899332 2:170663337-170663359 CCAGGGCACTCCAGCCTGGGTGG - Intergenic
942220675 2:173765964-173765986 TCATTGCACTCCAGCCTGGGAGG + Intergenic
942288908 2:174450092-174450114 GCTGTGCACTCCAGCCTGGGTGG + Intronic
942494569 2:176526324-176526346 CCACTGAACTCCAGCCTGGGCGG - Intergenic
942863014 2:180638305-180638327 CCACTGAACTCCAGCCTGGGAGG - Intergenic
943172554 2:184421686-184421708 TCACTGAACTCCAGCCTGGGCGG + Intergenic
944195648 2:197050460-197050482 CCCCTGCACTCCAGCCTGGGTGG - Intronic
944935249 2:204561024-204561046 TCTCGGAACCCCAGCCTGGGTGG - Intronic
945961689 2:216142012-216142034 ACCCTGTACTCCAGCCTGGGCGG + Intronic
946342080 2:219076581-219076603 CCCATGTACTCCAGCCTGGGTGG - Intronic
946541372 2:220688108-220688130 TCACTGCACTCCAGCCTGGGTGG - Intergenic
947220989 2:227792191-227792213 TTAGGATACTCCAGCCTGGGTGG - Intergenic
947763084 2:232617907-232617929 CCACGGCACTCCAGCCTGGGTGG + Intronic
947811339 2:233005854-233005876 CCACTGAACTCCAGCCTGGGTGG - Intronic
948079968 2:235198046-235198068 TGCGGGAACTCCTCCCTGTGTGG - Intergenic
948441800 2:237996512-237996534 TCACTGCACTCCAGCCTGGGTGG - Intronic
948599318 2:239099471-239099493 GCCGGGTTCTCCAGCATGGGAGG - Intronic
948672942 2:239580101-239580123 TCTCTGCACTCCAGCCTGGGAGG + Intronic
948854405 2:240723472-240723494 TCCGGGGCCTCCAGCCTGCCAGG + Exonic
948991958 2:241559839-241559861 TCCGGGAGCACCCGCCTGGGTGG - Intronic
1170301968 20:14894268-14894290 TCACTGCACTCCAGCCTGGGCGG - Intronic
1170661361 20:18343555-18343577 CCCCTGCACTCCAGCCTGGGCGG + Intergenic
1171119094 20:22552795-22552817 TCCCTGCACTCCAGCCTAGGTGG - Intergenic
1171295329 20:24012209-24012231 TCCAAAAACTCCAGCCTGCGTGG - Intergenic
1171965010 20:31523300-31523322 CCACTGAACTCCAGCCTGGGTGG - Intronic
1172513843 20:35518991-35519013 TCACTGCACTCCAGCCTGGGTGG + Exonic
1172710675 20:36920718-36920740 GCCCTGCACTCCAGCCTGGGTGG + Intronic
1172829977 20:37825311-37825333 TCGCTGTACTCCAGCCTGGGCGG + Intronic
1173855640 20:46248769-46248791 TCACCGCACTCCAGCCTGGGTGG + Intronic
1173867516 20:46322110-46322132 TCCAGGAACTCCTGGCTTGGTGG - Intergenic
1174043978 20:47720294-47720316 TCACTGCACTCCAGCCTGGGTGG - Intronic
1174076554 20:47941583-47941605 TCAGGCAGCGCCAGCCTGGGTGG + Intergenic
1174087719 20:48020761-48020783 TCCGGGAAGGGCAGCCTTGGTGG + Intergenic
1174128330 20:48325076-48325098 TCCGGGAAGGGCAGCCTTGGTGG - Intergenic
1176445137 21:6815409-6815431 GCCGTGAACTCCAGCATTGGAGG - Intergenic
1176823304 21:13680442-13680464 GCCGTGAACTCCAGCATTGGAGG - Intergenic
1178670085 21:34582499-34582521 TCCGGGAATTCCAGGCTTTGAGG + Intronic
1179340800 21:40507235-40507257 TCACTGTACTCCAGCCTGGGTGG + Intronic
1179468870 21:41597388-41597410 TCTGGGAACTCCAGCAGGGTGGG + Intergenic
1179723270 21:43327540-43327562 CCCCTGCACTCCAGCCTGGGCGG + Intergenic
1179766924 21:43581344-43581366 CCTCTGAACTCCAGCCTGGGTGG + Intronic
1180094562 21:45549976-45549998 TCGGGGCTCTGCAGCCTGGGAGG - Intergenic
1180481475 22:15760111-15760133 GCCGTGAACTCCAGCATTGGAGG - Intergenic
1180923698 22:19537554-19537576 CCACGGCACTCCAGCCTGGGCGG - Intergenic
1181382681 22:22519391-22519413 CCGTGGCACTCCAGCCTGGGCGG + Intronic
1181484153 22:23219945-23219967 TCCAGGAACTGCAGACTTGGAGG - Intronic
1181553277 22:23653060-23653082 TCCTGGAAGTGCACCCTGGGAGG + Intergenic
1181995189 22:26872844-26872866 TCACTGCACTCCAGCCTGGGTGG + Intergenic
1182238707 22:28897358-28897380 TCACTGTACTCCAGCCTGGGTGG - Intronic
1182324924 22:29505254-29505276 TCCTCGAACTTCAGCCTGTGTGG - Intergenic
1182332877 22:29563224-29563246 CCAGTGTACTCCAGCCTGGGTGG + Intronic
1182383574 22:29915459-29915481 TCACTGCACTCCAGCCTGGGTGG - Intronic
1182467665 22:30527673-30527695 TCACTGTACTCCAGCCTGGGTGG + Intronic
1183049889 22:35252173-35252195 TCAGTGCACTCCAGCCTAGGCGG + Intergenic
1183401485 22:37607677-37607699 TCACTGCACTCCAGCCTGGGCGG - Intergenic
1183444168 22:37841998-37842020 CCATGGCACTCCAGCCTGGGTGG + Intronic
1183543146 22:38441414-38441436 TCCCCGCACTCCAGCATGGGTGG + Intronic
1184561706 22:45267797-45267819 CCCCTGAACTCCAGCCTGGGTGG - Intergenic
1184660612 22:45963949-45963971 TCCAGGAGCTGCAGCCTGGAGGG + Intronic
1185080031 22:48704566-48704588 CCTGGGAGCTGCAGCCTGGGTGG + Intronic
1185206330 22:49541265-49541287 ACCGGGAGGTCCAGCCTGCGAGG + Intronic
949765000 3:7516435-7516457 CCCCTGCACTCCAGCCTGGGCGG + Intronic
950301330 3:11881971-11881993 CCCCTGCACTCCAGCCTGGGTGG - Intergenic
951164311 3:19466701-19466723 TCATTGCACTCCAGCCTGGGCGG - Intronic
951210291 3:19967182-19967204 CCATGGCACTCCAGCCTGGGCGG - Intronic
952722084 3:36544207-36544229 TCAGGGCACTCCAGCCTGGGTGG - Intronic
953377715 3:42442840-42442862 ACATGGAGCTCCAGCCTGGGAGG + Intergenic
955599245 3:60627543-60627565 TCACTGCACTCCAGCCTGGGTGG - Intronic
955647097 3:61151611-61151633 TCACTGCACTCCAGCCTGGGTGG - Intronic
956247170 3:67197052-67197074 TCACTGCACTCCAGCCTGGGCGG - Intergenic
956464595 3:69506573-69506595 CCAGTGCACTCCAGCCTGGGTGG - Intronic
957108928 3:75928022-75928044 CCCCTGCACTCCAGCCTGGGGGG - Intronic
957630826 3:82714655-82714677 TCCCTGCACTCCAGCCTGGGTGG + Intergenic
958581046 3:96023878-96023900 TGCGCTCACTCCAGCCTGGGCGG - Intergenic
960432298 3:117584016-117584038 TCACTGCACTCCAGCCTGGGTGG - Intergenic
960638065 3:119803286-119803308 CCACTGAACTCCAGCCTGGGTGG + Intronic
960959931 3:123063243-123063265 TCACTGCACTCCAGCCTGGGTGG + Intergenic
961248166 3:125475402-125475424 CCAGTGCACTCCAGCCTGGGCGG - Intronic
961384795 3:126517452-126517474 TCCAGGGGCTCCAGCCTGTGCGG - Intronic
961391340 3:126554053-126554075 CCACGGCACTCCAGCCTGGGCGG - Intronic
962508425 3:136072551-136072573 CCCCTGCACTCCAGCCTGGGAGG + Intronic
962595029 3:136933742-136933764 CCAGTGCACTCCAGCCTGGGTGG - Intronic
962722397 3:138187802-138187824 TCCGGGAGCTCCCGCCGGTGCGG + Intronic
962773102 3:138631373-138631395 CCCCTGTACTCCAGCCTGGGTGG + Intronic
964329161 3:155582119-155582141 CCCCTGCACTCCAGCCTGGGCGG - Intronic
965029015 3:163339406-163339428 CCACTGAACTCCAGCCTGGGTGG + Intergenic
965174095 3:165308154-165308176 TCACTGCACTCCAGCCTGGGTGG + Intergenic
965279312 3:166727606-166727628 CCACGGCACTCCAGCCTGGGTGG - Intergenic
966813473 3:183869244-183869266 TCATTGTACTCCAGCCTGGGTGG - Intronic
966858529 3:184214047-184214069 TCACTGCACTCCAGCCTGGGTGG - Intronic
967721366 3:192819814-192819836 TCCAGGTACTCCAGCTTGGGAGG + Intronic
967804874 3:193707027-193707049 CCCCTGCACTCCAGCCTGGGTGG - Intergenic
967984220 3:195083347-195083369 CCTGAGGACTCCAGCCTGGGAGG - Intronic
968163649 3:196447219-196447241 TCACCGCACTCCAGCCTGGGTGG + Intergenic
968380867 4:94826-94848 TCTGGGATCTCCATCCTAGGGGG + Intergenic
968913520 4:3487288-3487310 TCCAGTAAGTCCAGCCTGCGGGG - Intronic
969379561 4:6784977-6784999 ATCGCGGACTCCAGCCTGGGCGG - Intronic
970064939 4:12082662-12082684 TCACTGCACTCCAGCCTGGGTGG - Intergenic
970151771 4:13097731-13097753 CCAGTGCACTCCAGCCTGGGTGG - Intergenic
970304733 4:14719321-14719343 TCCAGGAAGTTCAGACTGGGTGG + Intergenic
970894562 4:21087214-21087236 CCACTGAACTCCAGCCTGGGTGG - Intronic
972903220 4:43711205-43711227 TCAGGGCACTCCAGCCTGGGTGG - Intergenic
974056443 4:56987840-56987862 TCACTGCACTCCAGCCTGGGTGG + Intronic
975819775 4:78258299-78258321 TCACTGCACTCCAGCCTGGGTGG + Intronic
977002327 4:91519335-91519357 TCTGGAAACTCCAGTCCGGGAGG + Intronic
977294708 4:95198025-95198047 CCACGGCACTCCAGCCTGGGTGG - Intronic
977657190 4:99536096-99536118 TCTGGGATCTCCATCCTAGGGGG + Intronic
978264785 4:106810577-106810599 TCACTGCACTCCAGCCTGGGTGG - Intergenic
978434675 4:108671092-108671114 CCACTGAACTCCAGCCTGGGAGG - Intergenic
979286225 4:118927982-118928004 TTCTTGAACTCCATCCTGGGAGG + Intronic
979540133 4:121871087-121871109 TCTGGGAACTCCAGGTAGGGAGG - Intergenic
979576090 4:122293892-122293914 TCCGGGCAGTCCAGACTGGGAGG + Intronic
979790897 4:124779925-124779947 TCATTGCACTCCAGCCTGGGTGG + Intergenic
980025474 4:127760920-127760942 TCCCAGCACTCCAGCCTGGGCGG + Intronic
980129624 4:128806213-128806235 CCACTGAACTCCAGCCTGGGTGG + Intergenic
980766632 4:137314882-137314904 CCAGTGCACTCCAGCCTGGGTGG - Intergenic
980911549 4:138998938-138998960 TCACTGCACTCCAGCCTGGGTGG - Intergenic
980931843 4:139189516-139189538 CCACTGAACTCCAGCCTGGGTGG - Intergenic
981168815 4:141596882-141596904 CCAGTGTACTCCAGCCTGGGTGG + Intergenic
981502569 4:145468080-145468102 CCAGGGCACTCCAGCCTAGGTGG - Intergenic
982342116 4:154311270-154311292 TCTGCACACTCCAGCCTGGGTGG - Intronic
982773194 4:159416782-159416804 TCACTGCACTCCAGCCTGGGTGG + Intergenic
983182631 4:164666878-164666900 CCATTGAACTCCAGCCTGGGTGG + Intergenic
983903193 4:173158611-173158633 CCCCTGCACTCCAGCCTGGGTGG - Intergenic
984600841 4:181725029-181725051 TACAGGAATTCCAGACTGGGAGG - Intergenic
984632449 4:182075236-182075258 TCACTGCACTCCAGCCTGGGCGG - Intergenic
984935417 4:184885230-184885252 ACTGAGAACTACAGCCTGGGAGG - Intergenic
985538160 5:475840-475862 CCCTGGAACCCCATCCTGGGTGG + Intronic
985646216 5:1085889-1085911 TCCAGGACGTCCAGCCGGGGTGG - Intronic
985979389 5:3449735-3449757 TCACTGAACTCCAGCCTGGGTGG - Intergenic
987110506 5:14681575-14681597 TCCGGGTCCTGCAGCCAGGGCGG - Exonic
987353543 5:17042514-17042536 TCACTCAACTCCAGCCTGGGCGG - Intergenic
987579117 5:19765917-19765939 TCATTGCACTCCAGCCTGGGTGG - Intronic
988022821 5:25645156-25645178 CCCCCGCACTCCAGCCTGGGTGG + Intergenic
988169645 5:27637265-27637287 CCACGGCACTCCAGCCTGGGCGG - Intergenic
988458338 5:31408795-31408817 TCTGTGAACTACTGCCTGGGAGG - Intronic
988933011 5:36055271-36055293 GCCATGCACTCCAGCCTGGGTGG - Intronic
989122834 5:38021296-38021318 TCACTGCACTCCAGCCTGGGCGG + Intergenic
989600952 5:43200338-43200360 TCACTGCACTCCAGCCTGGGAGG - Intronic
991054602 5:62306855-62306877 CCCGGGGACACCAGCCCGGGAGG + Intronic
991686806 5:69189316-69189338 CCCGGGAACAGCAGCCTGGAGGG - Intergenic
991688286 5:69201816-69201838 CCAGTGCACTCCAGCCTGGGTGG + Intronic
991777529 5:70099767-70099789 TCACTGTACTCCAGCCTGGGTGG - Intergenic
991856817 5:70975211-70975233 TCACTGTACTCCAGCCTGGGTGG - Intronic
992221350 5:74576794-74576816 CCCCTGCACTCCAGCCTGGGAGG + Intergenic
992223219 5:74593149-74593171 CCCATGCACTCCAGCCTGGGAGG - Intergenic
992754241 5:79889209-79889231 GCCTGGACCTGCAGCCTGGGGGG + Intergenic
992848698 5:80781505-80781527 TCACTGCACTCCAGCCTGGGTGG - Intronic
993662977 5:90662231-90662253 TCACTGCACTCCAGCCTGGGTGG - Intronic
993807269 5:92426649-92426671 CCACTGAACTCCAGCCTGGGCGG - Intergenic
994202104 5:96988648-96988670 ACCATGTACTCCAGCCTGGGTGG - Intronic
995444739 5:112229946-112229968 CCAGTGCACTCCAGCCTGGGAGG + Intronic
995860234 5:116633512-116633534 TCACTGCACTCCAGCCTGGGTGG - Intergenic
996535291 5:124571203-124571225 TCACTGCACTCCAGCCTGGGTGG - Intergenic
997477516 5:134153439-134153461 TCACTGCACTCCAGCCTGGGGGG + Exonic
997515085 5:134482471-134482493 CCACGGCACTCCAGCCTGGGCGG - Intergenic
997855002 5:137365160-137365182 ACTGAGAACTGCAGCCTGGGAGG - Intronic
998094074 5:139387615-139387637 TCAGGGCACTCGGGCCTGGGTGG - Exonic
998843227 5:146278759-146278781 TCACTGCACTCCAGCCTGGGAGG - Intronic
998921155 5:147069828-147069850 TCACTGTACTCCAGCCTGGGAGG - Intronic
999157329 5:149467489-149467511 TCCTGGAACTCCAGTTTTGGAGG + Intergenic
999759378 5:154688612-154688634 CCCCTGCACTCCAGCCTGGGCGG + Intergenic
1000738432 5:164934192-164934214 TCCGGGAAGTTCAAACTGGGCGG - Intergenic
1001140783 5:169142008-169142030 CCAGTGCACTCCAGCCTGGGCGG + Intronic
1001935719 5:175702589-175702611 TCACTGCACTCCAGCCTGGGCGG - Intergenic
1002097957 5:176843119-176843141 TCATTGCACTCCAGCCTGGGCGG + Intronic
1002344783 5:178540885-178540907 TCTCTGAACTCCAGCCTAGGTGG + Intronic
1002510222 5:179711015-179711037 TCACTGCACTCCAGCCTGGGTGG + Intronic
1002608370 5:180397357-180397379 CCCCTGCACTCCAGCCTGGGCGG - Intergenic
1002723017 5:181276179-181276201 CCACGGCACTCCAGCCTGGGTGG - Intergenic
1003115112 6:3278422-3278444 TCTGGGACCCTCAGCCTGGGAGG - Intronic
1003494260 6:6650372-6650394 CCCCTGCACTCCAGCCTGGGAGG - Intronic
1003660061 6:8052005-8052027 ACCCTGCACTCCAGCCTGGGTGG - Intronic
1003746542 6:9008298-9008320 CCAGTGTACTCCAGCCTGGGTGG - Intergenic
1004106970 6:12674741-12674763 TCACTGCACTCCAGCCTGGGCGG + Intergenic
1004751205 6:18564378-18564400 TCACTGCACTCCAGCCTGGGTGG + Intergenic
1005451642 6:25978704-25978726 CCAGTGCACTCCAGCCTGGGTGG - Intronic
1005471943 6:26169859-26169881 TCACTGCACTCCAGCCTGGGTGG + Intronic
1005531915 6:26716054-26716076 CCATGGCACTCCAGCCTGGGTGG + Intergenic
1005538880 6:26785611-26785633 CCATGGCACTCCAGCCTGGGTGG - Intergenic
1005559721 6:27026225-27026247 CCCCTGAACTCCAGCCTGGGTGG - Intergenic
1005698180 6:28371134-28371156 CCAGTGCACTCCAGCCTGGGTGG + Intergenic
1005789715 6:29285653-29285675 TCACTGCACTCCAGCCTGGGTGG + Intergenic
1005934246 6:30507860-30507882 TCCTGGGACCCCAGCCTGAGTGG - Intergenic
1006520874 6:34570439-34570461 CCCCTGAACTCCAGCCTGGGTGG - Intergenic
1006540307 6:34734643-34734665 TCACTGCACTCCAGCCTGGGTGG - Intergenic
1006690526 6:35880019-35880041 CCACGGCACTCCAGCCTGGGTGG + Intronic
1007210809 6:40192124-40192146 TCAGGGAACCCCAGTCTGTGGGG + Intergenic
1007273028 6:40652822-40652844 TCAAGGAACCCCAGCCTGAGGGG + Intergenic
1007276775 6:40679817-40679839 TCAGGGAGCCCCAGCCTGAGGGG + Intergenic
1007729593 6:43937894-43937916 TCAGGGAGCCCCAGCCTGAGTGG - Intergenic
1007736695 6:43986478-43986500 TCAGGGATCTCCAGTCTGAGGGG - Intergenic
1007740104 6:44004847-44004869 TCAGGGAGCTCCAGTCTGAGGGG - Exonic
1008758385 6:54824756-54824778 GCCGGGAAGTTCAGACTGGGTGG - Intergenic
1009327114 6:62365398-62365420 TCATTGCACTCCAGCCTGGGCGG - Intergenic
1010503649 6:76630943-76630965 CCACTGAACTCCAGCCTGGGAGG + Intergenic
1011286914 6:85734395-85734417 TCACTGAACTCCAGCCTGGGTGG + Intergenic
1012127918 6:95454009-95454031 TCCGGGAAGTTCAAACTGGGTGG - Intergenic
1012408447 6:98928366-98928388 CCAGGGCACTCCAGCCTGGGCGG - Intronic
1012646578 6:101691337-101691359 TCATTGCACTCCAGCCTGGGTGG - Intronic
1013352785 6:109320410-109320432 CCACTGAACTCCAGCCTGGGTGG - Intergenic
1013730152 6:113155532-113155554 GCATGCAACTCCAGCCTGGGAGG + Intergenic
1013956931 6:115852681-115852703 TCCAGGAAGTTCAGACTGGGTGG + Intergenic
1015098652 6:129448241-129448263 CCATGGCACTCCAGCCTGGGTGG + Intronic
1015405124 6:132828264-132828286 ACACTGAACTCCAGCCTGGGCGG - Intergenic
1015936166 6:138407608-138407630 GCCGGGCACACCAGACTGGGAGG - Intronic
1016463912 6:144307023-144307045 TCACTGCACTCCAGCCTGGGTGG + Intronic
1017340438 6:153315231-153315253 CCAGTGCACTCCAGCCTGGGAGG + Intergenic
1017474303 6:154772647-154772669 CCCTTGAACTCCAGCCTGGGTGG + Intronic
1017531106 6:155292867-155292889 TCACTGCACTCCAGCCTGGGCGG - Intronic
1017824750 6:158073235-158073257 TCACTGCACTCCAGCCTGGGTGG - Intronic
1017920518 6:158868533-158868555 TCACTGCACTCCAGCCTGGGCGG - Intergenic
1017992078 6:159499455-159499477 TCACTGCACTCCAGCCTGGGTGG - Intergenic
1018214790 6:161516427-161516449 ACTGTGCACTCCAGCCTGGGTGG + Intronic
1018447512 6:163870959-163870981 TCACTGCACTCCAGCCTGGGTGG + Intergenic
1019196213 6:170284594-170284616 GCCGGCCACTCCAGCTTGGGAGG - Intronic
1019358708 7:594180-594202 TCCTGGAAGGCCAGCCTGGGTGG - Intronic
1019389029 7:774917-774939 TCCGTGCACTCCTGCCTGGAAGG - Intronic
1019411894 7:910287-910309 CCCCTGCACTCCAGCCTGGGTGG - Intronic
1019416293 7:928178-928200 CCACTGAACTCCAGCCTGGGCGG + Intronic
1019430970 7:999533-999555 TCACTGCACTCCAGCCTGGGCGG + Intronic
1019719749 7:2560995-2561017 TCATTGCACTCCAGCCTGGGTGG - Intronic
1019762252 7:2822000-2822022 TCCTGGAATGTCAGCCTGGGCGG - Intronic
1020208567 7:6139815-6139837 TCCGGGCACTGCGGCCTGTGTGG - Intronic
1020289060 7:6708584-6708606 CCCCTGCACTCCAGCCTGGGCGG - Intergenic
1021189572 7:17604060-17604082 CCACTGAACTCCAGCCTGGGAGG + Intergenic
1022310910 7:29194951-29194973 TCCAGCAACTCCAGCCTGTCCGG + Exonic
1022364252 7:29695710-29695732 CCACGGCACTCCAGCCTGGGTGG - Intergenic
1022697114 7:32718024-32718046 CCACGGCACTCCAGCCTGGGCGG + Intergenic
1022945789 7:35282170-35282192 TCACTGCACTCCAGCCTGGGTGG + Intergenic
1023398422 7:39773242-39773264 TCACGGCACTCCAGCCTTGGTGG - Intergenic
1023468766 7:40490071-40490093 TCAAGGAACTCAAGCCTGGGTGG - Intronic
1023746068 7:43323563-43323585 CCACTGAACTCCAGCCTGGGCGG + Intronic
1025134233 7:56397248-56397270 TCACGGCACTCCAGCCTTGGTGG + Intergenic
1026131702 7:67626445-67626467 TCACTGCACTCCAGCCTGGGTGG - Intergenic
1026674357 7:72416693-72416715 TCACTGCACTCCAGCCTGGGCGG + Intronic
1026921759 7:74160744-74160766 TCATTGTACTCCAGCCTGGGTGG + Intergenic
1027153252 7:75748044-75748066 CCAGCGCACTCCAGCCTGGGTGG + Intergenic
1027997560 7:85444648-85444670 CCATAGAACTCCAGCCTGGGCGG + Intergenic
1028467606 7:91170804-91170826 CCACTGAACTCCAGCCTGGGTGG - Intronic
1028474666 7:91240133-91240155 CCACTGAACTCCAGCCTGGGTGG - Intergenic
1029255321 7:99265653-99265675 TCCGGGTACTGCAGCCTGTTTGG - Intergenic
1029533269 7:101139559-101139581 TCACTGAACTCCAGGCTGGGTGG + Intergenic
1029606759 7:101603692-101603714 CCAGTGTACTCCAGCCTGGGCGG - Intergenic
1030329583 7:108256967-108256989 CCACTGAACTCCAGCCTGGGTGG + Intronic
1031048925 7:116925377-116925399 TCACTGCACTCCAGCCTGGGTGG + Intergenic
1032227614 7:130045849-130045871 CCAGTGCACTCCAGCCTGGGTGG + Intronic
1032438589 7:131923125-131923147 TCATCGTACTCCAGCCTGGGTGG - Intergenic
1032485488 7:132284131-132284153 CCAGTGCACTCCAGCCTGGGTGG + Intronic
1032548811 7:132765675-132765697 GCCGAGAACTCCAGCCCAGGGGG + Intergenic
1033194612 7:139317220-139317242 GCCGTGCACTCCAGCTTGGGTGG - Intergenic
1034072843 7:148203697-148203719 GTCGTGTACTCCAGCCTGGGTGG + Intronic
1034487590 7:151375696-151375718 TCTGTGAACACCAGCCTGAGTGG + Intronic
1034613205 7:152391276-152391298 TCAGTGCACTTCAGCCTGGGTGG - Intronic
1035729641 8:1845097-1845119 CCACTGAACTCCAGCCTGGGTGG + Intronic
1036620545 8:10422244-10422266 CCAGTGTACTCCAGCCTGGGTGG + Intronic
1036821741 8:11945523-11945545 TGCGGGAGCTGGAGCCTGGGTGG + Intergenic
1037332505 8:17757564-17757586 TCACTGCACTCCAGCCTGGGTGG - Intronic
1037540533 8:19866435-19866457 CCCCTGTACTCCAGCCTGGGTGG - Intergenic
1037846489 8:22287205-22287227 TCACTGCACTCCAGCCTGGGCGG + Intronic
1037940119 8:22944942-22944964 TCACTGCACTCCAGCCTGGGCGG - Intronic
1038035665 8:23683889-23683911 TCACTGCACTCCAGCCTGGGCGG - Intergenic
1038564242 8:28606592-28606614 TCACTGCACTCCAGCCTGGGTGG - Intronic
1038765484 8:30423875-30423897 CCATGGCACTCCAGCCTGGGTGG - Intronic
1038842474 8:31197948-31197970 CCAGTGCACTCCAGCCTGGGTGG - Intergenic
1039482815 8:37887489-37887511 CCACGGCACTCCAGCCTGGGTGG + Intronic
1040024518 8:42769665-42769687 TCACTGCACTCCAGCCTGGGTGG + Intronic
1041381113 8:57255112-57255134 TCTGGTAACTCCTGCCTGGGTGG - Intergenic
1041399825 8:57430278-57430300 ACCAGGATCTCCAGCCTGTGGGG + Intergenic
1041436340 8:57846025-57846047 CACTGCAACTCCAGCCTGGGTGG + Intergenic
1041447832 8:57972390-57972412 TCACTGCACTCCAGCCTGGGAGG - Intergenic
1041668680 8:60470637-60470659 TCACTGCACTCCAGCCTGGGCGG + Intergenic
1042819387 8:72913713-72913735 TCCTGGAACTCCAGACTGGCTGG - Intronic
1045505469 8:102775240-102775262 CCAGTGCACTCCAGCCTGGGTGG + Intergenic
1045522851 8:102918329-102918351 TCATTGCACTCCAGCCTGGGCGG - Intronic
1046978324 8:120308977-120308999 TCACTGCACTCCAGCCTGGGCGG - Intronic
1047598215 8:126400003-126400025 TCACTGCACTCCAGCCTGGGCGG + Intergenic
1047833592 8:128662741-128662763 GCCACGCACTCCAGCCTGGGCGG + Intergenic
1049305631 8:141902397-141902419 TCCCGGCACTCAAGCCTGGTGGG - Intergenic
1049471118 8:142775456-142775478 TCTGGGAGCTCCAGGCTGAGGGG - Intronic
1049862239 8:144907424-144907446 CCAAGGCACTCCAGCCTGGGTGG - Intergenic
1050240132 9:3626186-3626208 TCTGGAAGCTCCATCCTGGGAGG + Intergenic
1051436964 9:17043504-17043526 CCCCCGCACTCCAGCCTGGGTGG - Intergenic
1051873610 9:21767565-21767587 TCATGGAACTCCAGCCTGGGAGG - Intergenic
1055510499 9:76991647-76991669 CCACTGAACTCCAGCCTGGGCGG - Intergenic
1057199298 9:93131814-93131836 ACGTGGAACTCCAACCTGGGTGG - Intronic
1057817406 9:98305775-98305797 TCACTGCACTCCAGCCTGGGTGG + Intronic
1057904463 9:98973615-98973637 CCCAGAGACTCCAGCCTGGGTGG + Intronic
1058028330 9:100167184-100167206 TCACTGCACTCCAGCCTGGGTGG + Intronic
1059016094 9:110517556-110517578 CCACTGAACTCCAGCCTGGGTGG + Intronic
1060950180 9:127596653-127596675 TCACTGCACTCCAGCCTGGGTGG - Intergenic
1061032664 9:128095429-128095451 TCCTGGAACTGCAGACTGTGGGG - Intronic
1061512194 9:131068198-131068220 TCTTCGACCTCCAGCCTGGGAGG + Exonic
1061810542 9:133160237-133160259 CCACGGTACTCCAGCCTGGGTGG + Intronic
1062226564 9:135455737-135455759 GCCGGGAACTCCAGCGGGAGGGG - Intergenic
1062476855 9:136732464-136732486 TGCATGCACTCCAGCCTGGGCGG + Intergenic
1203524058 Un_GL000213v1:69116-69138 GCCGTGAACTCCAGCATTGGAGG + Intergenic
1185525211 X:773018-773040 CCCCTGCACTCCAGCCTGGGTGG + Intergenic
1185654991 X:1677486-1677508 CCATTGAACTCCAGCCTGGGAGG - Intergenic
1186479581 X:9885911-9885933 TCACTGTACTCCAGCCTGGGTGG + Intronic
1186762002 X:12733264-12733286 TCACTGCACTCCAGCCTGGGTGG - Intergenic
1187499605 X:19828742-19828764 CCCCTGCACTCCAGCCTGGGTGG + Intronic
1187810100 X:23166583-23166605 CCACGGCACTCCAGCCTGGGCGG - Intergenic
1189384952 X:40529627-40529649 TCACGCCACTCCAGCCTGGGTGG - Intergenic
1190601474 X:52097150-52097172 CCCTTGCACTCCAGCCTGGGTGG + Intergenic
1190821540 X:53977983-53978005 TCACTGCACTCCAGCCTGGGGGG - Intronic
1190823556 X:53996581-53996603 CCACTGAACTCCAGCCTGGGTGG - Intronic
1190866806 X:54391712-54391734 TCACTGCACTCCAGCCTGGGTGG - Intergenic
1190992451 X:55566274-55566296 TCCAGGAACTCCAGTCAGGCAGG + Intergenic
1191135389 X:57058683-57058705 GCCAGGAAGTCCAGACTGGGTGG - Intergenic
1192122643 X:68471552-68471574 CCCGTGCACTCCAGCCTGGGCGG - Intergenic
1192129705 X:68537763-68537785 TGGTGCAACTCCAGCCTGGGCGG + Intergenic
1192325889 X:70131665-70131687 TTCCAGCACTCCAGCCTGGGTGG + Intergenic
1192738505 X:73871458-73871480 CCACCGAACTCCAGCCTGGGTGG - Intergenic
1194138350 X:90176503-90176525 CCAGTGCACTCCAGCCTGGGTGG - Intergenic
1194712568 X:97253246-97253268 TCATTGCACTCCAGCCTGGGCGG + Intronic
1195039714 X:101002947-101002969 TCACTGAACTCCAGCCTGGGTGG - Intergenic
1196538077 X:116871164-116871186 CCATGGCACTCCAGCCTGGGTGG + Intergenic
1196889785 X:120280777-120280799 TCTGTGGACTCCAGCCTGGCTGG - Intronic
1197177132 X:123498239-123498261 CCAGTGCACTCCAGCCTGGGTGG - Intergenic
1198128850 X:133674185-133674207 TCACTGTACTCCAGCCTGGGTGG + Intronic
1198832283 X:140763944-140763966 TCACAGAACGCCAGCCTGGGAGG - Intergenic
1200484148 Y:3746739-3746761 CCAGTGCACTCCAGCCTGGGTGG - Intergenic
1202603399 Y:26617838-26617860 TCAGTGCACCCCAGCCTGGGTGG + Intergenic