ID: 1102453474

View in Genome Browser
Species Human (GRCh38)
Location 12:113057423-113057445
Sequence CCAGGAGACAAGAGGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 793
Summary {0: 1, 1: 1, 2: 6, 3: 68, 4: 717}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102453474_1102453489 16 Left 1102453474 12:113057423-113057445 CCCTCTCCCCTCTTGTCTCCTGG 0: 1
1: 1
2: 6
3: 68
4: 717
Right 1102453489 12:113057462-113057484 GTGGGGTGGGGCGTGCCCACGGG 0: 1
1: 0
2: 3
3: 30
4: 259
1102453474_1102453483 -2 Left 1102453474 12:113057423-113057445 CCCTCTCCCCTCTTGTCTCCTGG 0: 1
1: 1
2: 6
3: 68
4: 717
Right 1102453483 12:113057444-113057466 GGCAGGTCGCGAGCACGAGTGGG 0: 1
1: 0
2: 1
3: 0
4: 36
1102453474_1102453484 -1 Left 1102453474 12:113057423-113057445 CCCTCTCCCCTCTTGTCTCCTGG 0: 1
1: 1
2: 6
3: 68
4: 717
Right 1102453484 12:113057445-113057467 GCAGGTCGCGAGCACGAGTGGGG 0: 1
1: 0
2: 0
3: 1
4: 38
1102453474_1102453482 -3 Left 1102453474 12:113057423-113057445 CCCTCTCCCCTCTTGTCTCCTGG 0: 1
1: 1
2: 6
3: 68
4: 717
Right 1102453482 12:113057443-113057465 TGGCAGGTCGCGAGCACGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
1102453474_1102453485 2 Left 1102453474 12:113057423-113057445 CCCTCTCCCCTCTTGTCTCCTGG 0: 1
1: 1
2: 6
3: 68
4: 717
Right 1102453485 12:113057448-113057470 GGTCGCGAGCACGAGTGGGGTGG 0: 1
1: 0
2: 0
3: 2
4: 60
1102453474_1102453486 3 Left 1102453474 12:113057423-113057445 CCCTCTCCCCTCTTGTCTCCTGG 0: 1
1: 1
2: 6
3: 68
4: 717
Right 1102453486 12:113057449-113057471 GTCGCGAGCACGAGTGGGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 30
1102453474_1102453488 15 Left 1102453474 12:113057423-113057445 CCCTCTCCCCTCTTGTCTCCTGG 0: 1
1: 1
2: 6
3: 68
4: 717
Right 1102453488 12:113057461-113057483 AGTGGGGTGGGGCGTGCCCACGG 0: 1
1: 1
2: 4
3: 42
4: 361
1102453474_1102453487 4 Left 1102453474 12:113057423-113057445 CCCTCTCCCCTCTTGTCTCCTGG 0: 1
1: 1
2: 6
3: 68
4: 717
Right 1102453487 12:113057450-113057472 TCGCGAGCACGAGTGGGGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102453474 Original CRISPR CCAGGAGACAAGAGGGGAGA GGG (reversed) Intronic
900508059 1:3039442-3039464 CCAGGAAATAAGAAGGGGGAGGG - Intergenic
900645004 1:3704993-3705015 CCAGGAGCCAGGAGAGGCGAGGG + Intronic
900703184 1:4060615-4060637 CCAGGAAAAAGGAGGCGAGATGG + Intergenic
900918161 1:5652688-5652710 CTAGGAGACAGGAGGGGGCAAGG + Intergenic
901024387 1:6271402-6271424 ACAGGAGACAAGAGGGGTCTTGG + Intronic
901741179 1:11343009-11343031 ACAGGGGAGAAGAGGGGAGGTGG + Intergenic
902196811 1:14804155-14804177 CCAGGAGCCAAGTGTGGAGGGGG - Intronic
902673698 1:17993703-17993725 CCAGGAGAAAAGAGAGAAAATGG + Intergenic
902741373 1:18440948-18440970 CCAGGAGGCAGAAGGGGTGAGGG - Intergenic
902797802 1:18810555-18810577 CCAGGATCCAAGAAGGGTGAGGG + Intergenic
902899798 1:19507140-19507162 CCAGGACTCAAGAGAGGCGAAGG - Intergenic
903326067 1:22569259-22569281 ACAGGAGACAAGAGGGCATCAGG - Intronic
903366266 1:22807131-22807153 AGAGGAGACAGAAGGGGAGAAGG - Intronic
903551097 1:24157732-24157754 CCAACAGACAAGATGGAAGAAGG - Exonic
904160688 1:28520190-28520212 CCAGGAGGGAAGGGAGGAGAGGG - Intronic
904395710 1:30220076-30220098 CCAGGAGCCAAGGGGAGAGAAGG + Intergenic
904724511 1:32536972-32536994 ACAAGAGATAAGATGGGAGAGGG - Intronic
904873266 1:33635015-33635037 TCCGGACACAAGAGGGCAGAAGG - Intronic
904976430 1:34460480-34460502 CCAGGAGGCAAGTTGGCAGAAGG - Intergenic
905006582 1:34714747-34714769 CCAGGAGACAAGGAGGTAGAAGG - Intronic
905031044 1:34884924-34884946 CTGGGAGACAGGAGGAGAGAGGG - Intronic
905266165 1:36755666-36755688 CAAGGAGACAAAAGGGATGAGGG - Intergenic
906094968 1:43216693-43216715 CCAGGACAGAAGCGGGGAGGAGG - Intronic
906110127 1:43317169-43317191 GGATGAGACAAGAGGGCAGACGG - Intronic
906158072 1:43625819-43625841 GCAGGGGGCAAGAGGGGAGAAGG - Intergenic
906188549 1:43880530-43880552 AAAGGAGACAAGCGGAGAGAGGG - Intronic
906279152 1:44541845-44541867 CCAGGAGACATATGGGAAGAAGG - Intronic
906660194 1:47576444-47576466 CTAAGAGACAAGAAGGTAGAGGG + Intergenic
907286267 1:53382260-53382282 CCAGGAGACAGGAGCAGAGGTGG + Intergenic
907335322 1:53695693-53695715 CCAGAACAAAGGAGGGGAGATGG + Intronic
907865579 1:58396450-58396472 GCAGGAGACAGGAGGGAGGAGGG + Intronic
908472317 1:64456207-64456229 GTGGGAGACAAGAGGGCAGAGGG - Intergenic
909004985 1:70265216-70265238 CAAGGTGACAAGAGTGAAGAGGG + Intronic
909023098 1:70453402-70453424 GCAGGTGAAAAGAGGGAAGAAGG + Intergenic
909117325 1:71554656-71554678 CCAGGAAAAAAGAGGAGAGTAGG - Intronic
909433722 1:75616679-75616701 CGAGAAGGAAAGAGGGGAGAGGG + Intergenic
909564529 1:77039842-77039864 CGAAGACACAAGAGGGGAGGTGG - Intronic
909888033 1:80966882-80966904 CCTGGAATCATGAGGGGAGAAGG + Intergenic
909923277 1:81407796-81407818 GAAGGAGAAAAGAAGGGAGAGGG + Intronic
910502031 1:87903335-87903357 CCAGGTGAACAGAAGGGAGAGGG + Intergenic
910519051 1:88097013-88097035 CCAGGAGCCAGGAAAGGAGAGGG - Intergenic
910649042 1:89544714-89544736 CCAGTAGAAAAGAGGATAGATGG - Intronic
911236020 1:95413233-95413255 GCAGGAGACAGAAGGGCAGAAGG - Intergenic
911888153 1:103329818-103329840 CCAGGAGGCAAGAGGAGTTATGG + Intergenic
912373598 1:109192581-109192603 CAAGGAAACAAGAGGGGAGAGGG - Intronic
912787527 1:112619133-112619155 CCAGGAGCTGGGAGGGGAGAAGG + Exonic
913121568 1:115745983-115746005 CCAGGGTAAAAGAGGGGATAGGG - Intronic
913161770 1:116151901-116151923 GCAGGAGAGAGGAGGAGAGAAGG - Intergenic
914422366 1:147541301-147541323 AGGGGAGACAAGAGGGGAGGAGG + Intergenic
914803664 1:150977297-150977319 CCAGGAGACAAAAGAGAAGGTGG + Intergenic
915651261 1:157312645-157312667 CCTGGAGACCAAAGAGGAGAAGG - Intergenic
915923712 1:159999329-159999351 TGAGGAGAGAAGAGGGGAGCTGG - Intergenic
917590212 1:176468739-176468761 CCAGGAAGCAAGAGGGGGAAAGG - Intronic
917647720 1:177045463-177045485 CCAGCAGAAAAGAAGGAAGAGGG - Intronic
917805777 1:178612341-178612363 CCAAGAGGCAAGAGGTGATAAGG + Intergenic
918114007 1:181482117-181482139 CCAGGTGCTAAGTGGGGAGATGG + Intronic
919926601 1:202194741-202194763 TGAGGAGACAAGAGTGGATAAGG - Intronic
920057490 1:203203056-203203078 CCGGGAGGCAGGAGGGGATAAGG - Intergenic
920147947 1:203878945-203878967 ACAGGAGAAAAGAGGGCTGAAGG - Intergenic
920200299 1:204256137-204256159 CCAGGAGGCCAGAGTGGAGGAGG - Intronic
920512340 1:206560418-206560440 TCAGGAGACAGCAAGGGAGATGG + Intronic
920562494 1:206948620-206948642 CCAGGCTACAGTAGGGGAGAGGG - Intergenic
920663508 1:207940412-207940434 CCATGAGACAAGGAGGGACAGGG + Intergenic
920704536 1:208242050-208242072 CCTGGAGGTCAGAGGGGAGAGGG + Intronic
921315758 1:213888578-213888600 GAAGGGGAGAAGAGGGGAGAGGG + Intergenic
922036542 1:221853742-221853764 CGAGGAGACAAGATGGGGTAAGG + Intergenic
923023366 1:230184560-230184582 GCAGGAAAGAAGAGAGGAGAGGG - Intronic
923656666 1:235922977-235922999 CCAGGAGACAAGGGCGGTGCTGG + Intergenic
923875813 1:238045776-238045798 CTTGGGGAGAAGAGGGGAGAGGG + Intergenic
923962714 1:239103091-239103113 CCAGGTGTGAAGAGGGGAGGTGG - Intergenic
1062895627 10:1101168-1101190 CCAGAAAACAACGGGGGAGACGG - Intronic
1063038277 10:2310913-2310935 CGAGAAGACAAGAGAGGAGAAGG + Intergenic
1063447292 10:6127461-6127483 CCAGGAGACAGAAGAGGAGGTGG + Intergenic
1063447304 10:6127505-6127527 CCAGGAGACAGAAGAGGAGGTGG + Intergenic
1063447315 10:6127549-6127571 CCAGGAGACAGAAGAGGAGGTGG + Intergenic
1063447327 10:6127593-6127615 CCAGGAGACAGAAGAGGAGGTGG + Intergenic
1063447350 10:6127681-6127703 CCAGGAGACAGAAGAGGAGGTGG + Intergenic
1063650946 10:7936130-7936152 CCAGGGGACAACAAGGAAGACGG + Intronic
1063904778 10:10770358-10770380 CCAGCAAGCAGGAGGGGAGAAGG + Intergenic
1064096035 10:12425156-12425178 CCAGGAGCCAGCTGGGGAGAAGG - Intronic
1064742340 10:18446523-18446545 ACTGGAGACAAGAGAGGAGATGG + Intronic
1065772158 10:29087590-29087612 GCAGAAGACAGGAGGGGAAAAGG - Intergenic
1066366399 10:34781115-34781137 CCAGCAGGCTAGAGGGGGGAGGG - Intronic
1066409580 10:35153772-35153794 CTAGGAGTCAAAAGGGGGGAAGG + Intronic
1067116143 10:43436948-43436970 CCAGCGGACAAGAGGGCAGCTGG + Intronic
1067363991 10:45608098-45608120 CCAGGGGACTAGATGGGGGAGGG + Intergenic
1068650526 10:59517768-59517790 CCAGGAGAGAAGTGGGAAGGAGG - Intergenic
1068798198 10:61107814-61107836 AAAGGAGACAAGAGGGAAAAGGG + Intergenic
1068839010 10:61589385-61589407 CCAGGAGACAGGAAGAGAGATGG + Intergenic
1068971059 10:62958876-62958898 GAAGGAGACAAGAGAGGAAAAGG + Intergenic
1069362167 10:67655052-67655074 TCAGGAGAAAACATGGGAGAAGG - Intronic
1069566275 10:69465376-69465398 CCAGAAGACCACAGTGGAGAAGG - Intronic
1069636920 10:69930505-69930527 CCAGGAGAGAAGGGGGAAAAAGG + Exonic
1069639258 10:69944267-69944289 CCAGGAGAAGAGATGGAAGAAGG - Intronic
1070332789 10:75430365-75430387 CCAGCAGAGAAGGAGGGAGAAGG + Intergenic
1070641647 10:78174605-78174627 CAAAGAGACAAGAGGTGAAAGGG - Intergenic
1070662380 10:78316573-78316595 CCAGCAGCCAAGAGGGCAGATGG - Intergenic
1070736213 10:78865459-78865481 CCACAAGGCAAGAGGTGAGAGGG + Intergenic
1071026196 10:81116605-81116627 CCAGGAGTGGAGAGGGAAGAGGG + Intergenic
1071336487 10:84604664-84604686 CCAAGAGAGCAGAGGGGAGGGGG - Intergenic
1071530833 10:86389588-86389610 CCAGGAAACAGGAGGGGACATGG + Intergenic
1071729588 10:88234317-88234339 CCAGGAACCAAGAGAAGAGAAGG - Intergenic
1071826796 10:89333498-89333520 CCAAGAGGCAGGAGGGGGGAGGG + Intronic
1071997257 10:91161404-91161426 CCAGGAGTCAAGAAGGGTCAGGG + Intergenic
1072390679 10:94982964-94982986 CAAGAAGAAAAGTGGGGAGAGGG - Intronic
1072932087 10:99674129-99674151 CAAGGAGACAGGAGAGGGGAAGG + Intronic
1073010739 10:100357464-100357486 AGAGGAGACAAGAGGGTAGGTGG - Intronic
1073045830 10:100637754-100637776 CCAGGGGAAAAGTGGGGAGAAGG - Intergenic
1073053941 10:100687202-100687224 CCAGGGGACCAGAGGGCAGTTGG - Intergenic
1073538835 10:104301551-104301573 CCTGGAGAAAAGAGGGAAGGAGG + Intronic
1074138489 10:110649519-110649541 CCAGGACAGATGAAGGGAGAGGG - Intronic
1074700186 10:116085792-116085814 CCAGGAGACAACATAGGGGAAGG - Intronic
1074709630 10:116166647-116166669 CCTAGAGACAAGAAGGGAGGAGG + Intronic
1074765122 10:116694827-116694849 CCAGGCGGCAAAAGGGCAGAAGG - Intronic
1074908637 10:117887144-117887166 CCAGGAGGGAGAAGGGGAGAGGG - Intergenic
1075221441 10:120588367-120588389 CTGGGAGGCAAGAGGGGAGCAGG - Intronic
1075444148 10:122502161-122502183 CCATGAGACAAAAGCCGAGAGGG + Intronic
1075518913 10:123132402-123132424 CAAGGAGCCAAGAGGGCAGAAGG - Intergenic
1075619418 10:123914876-123914898 TCAGGAGGCAAGAGGGAATATGG - Intronic
1075646343 10:124099351-124099373 CCAGGAGCCAGGGAGGGAGACGG - Intergenic
1076235155 10:128858316-128858338 CAAGGAGACATCAGGGGACACGG + Intergenic
1076266047 10:129110650-129110672 CCAGGACACAAAAGCGGAGCAGG + Intergenic
1076357763 10:129865464-129865486 CCAGAAGACCACAGGGGAGGTGG - Intronic
1077235166 11:1478489-1478511 CCAGGAGGCCAGAAGGAAGAAGG - Intronic
1077411871 11:2407472-2407494 CCAGGAGAGCAGAGTGGACAGGG - Intronic
1078266584 11:9759513-9759535 CCAGGAGGCAGGAGTGGAGAGGG + Intergenic
1078450280 11:11435937-11435959 CCAGGAGAGAAGAGAAAAGAAGG - Intronic
1079090057 11:17474666-17474688 CCAGGAGAGCAGAGGGAACACGG - Intronic
1079237386 11:18700128-18700150 CCAGCAGACAGGCTGGGAGATGG - Intronic
1079749384 11:24178080-24178102 ACAGGAAACAAGAGGGAAAAAGG - Intergenic
1080007302 11:27423461-27423483 CCATCAGAGCAGAGGGGAGAAGG - Intronic
1080225758 11:29958085-29958107 CCAGGAGTCAACATGGCAGAAGG - Intergenic
1080658489 11:34276696-34276718 ACAGAAGACAAGGGGAGAGAGGG + Intronic
1080680234 11:34469107-34469129 CCAGGAAACCAGAAGTGAGAGGG - Intronic
1080915969 11:36659914-36659936 CAAGGAGAAAAGAGGGATGAAGG + Intergenic
1081469831 11:43359281-43359303 CCAGGAGACAAGTGGGGAGCGGG - Intronic
1081525568 11:43925323-43925345 CCTGGTGACAAGAGGGAACATGG + Exonic
1081644963 11:44783909-44783931 CCCTGAGACGAGAGGGGTGAGGG - Intronic
1082751561 11:57023950-57023972 ACAGAAGACAAAAGGGAAGAAGG + Intergenic
1082823568 11:57561483-57561505 GAAGGAGATGAGAGGGGAGAAGG + Intronic
1084150073 11:67284008-67284030 ACAGGTGATAAGAAGGGAGAGGG - Intronic
1084215793 11:67646216-67646238 CCAGGGGAAGAGAGGTGAGAGGG - Intronic
1084609289 11:70191907-70191929 CATGGAGACAGGAGGGCAGAGGG - Intergenic
1085033618 11:73287433-73287455 CCAAGACTCTAGAGGGGAGAAGG + Intronic
1085311263 11:75518296-75518318 CCTGGAGAGATGAGGGGAGTGGG - Intronic
1085753944 11:79188539-79188561 AGAGGAGAGATGAGGGGAGAAGG + Intronic
1086307146 11:85493720-85493742 GTAGGAGAGAAGAGGGGAGGGGG + Intronic
1086843384 11:91717518-91717540 GCAGGAGAGAAGAGTGGTGAAGG + Intergenic
1087892348 11:103549973-103549995 CCAGGAGACTTGAGAGGTGAGGG + Intergenic
1088568111 11:111194759-111194781 CATGGAGACAAGCAGGGAGATGG - Intergenic
1088807474 11:113365522-113365544 GCAGGAGAAAACAGTGGAGAAGG + Intronic
1089509162 11:118985003-118985025 GCAGGAGGGAAGAGCGGAGAGGG - Intergenic
1089522863 11:119077228-119077250 TCATAAAACAAGAGGGGAGATGG - Intronic
1089619352 11:119713577-119713599 CCTGGAGATAAGAGGAGATAAGG - Intronic
1090257622 11:125296531-125296553 CCAGGAGTCAGGGAGGGAGAGGG - Intronic
1090436309 11:126689525-126689547 CCAGGTGACAAGAAGGCAGCTGG - Intronic
1090439810 11:126716113-126716135 TAGGGAGACAGGAGGGGAGAAGG + Intronic
1090446110 11:126766191-126766213 CAAGGAGAAGAGAGGGGAGGAGG - Intronic
1091308588 11:134557002-134557024 CTGAGAGACAGGAGGGGAGAAGG + Intergenic
1091590911 12:1842573-1842595 CGAGGAGAAAAGAGGGAAGCTGG - Intronic
1091673248 12:2467705-2467727 TCAGGAGACACCGGGGGAGAGGG - Intronic
1091703928 12:2681079-2681101 TCATGAGGCCAGAGGGGAGAAGG - Intronic
1091710607 12:2737555-2737577 TCATGAGGCCAGAGGGGAGAAGG - Intergenic
1091713453 12:2759617-2759639 TCATGAGGCCAGAGGGGAGAAGG - Intergenic
1091791622 12:3275204-3275226 CCAGGAGGGAAGTGGAGAGAGGG + Intronic
1092046080 12:5432628-5432650 CCGAGGGACAAGAGGGGAGGAGG - Intronic
1092193636 12:6536471-6536493 CTAAGAGACAAGAGGCAAGAAGG - Intronic
1092899455 12:13044661-13044683 CCCGGAGACGCGCGGGGAGAGGG + Intronic
1092970533 12:13689950-13689972 AGAGGAGAGAAGAGGGGAGAAGG - Intronic
1094711965 12:32973514-32973536 CCAGGAGATCAAAGGGGAAATGG - Intergenic
1095193992 12:39290932-39290954 CTTGGAGTCAACAGGGGAGAGGG - Intergenic
1095319187 12:40805255-40805277 CCAGAAGAAAAGAGGGAAAAGGG - Intronic
1095369623 12:41451751-41451773 CCAGGACACCAGAGGGGACCTGG - Intronic
1096103367 12:48982436-48982458 AAAGGAGAGAAGAGTGGAGAGGG - Intergenic
1096159850 12:49367386-49367408 CCAGGAGAGAAGTGGGGAGGCGG + Intronic
1096874669 12:54618124-54618146 CCAGTATACAATAGTGGAGAAGG + Intergenic
1097042507 12:56164276-56164298 GAAGGGGCCAAGAGGGGAGAAGG - Intronic
1098200735 12:68052598-68052620 CGAGCAGGCAAGAGGGGAAAGGG + Intergenic
1098254785 12:68606071-68606093 AGAGGAGAGGAGAGGGGAGACGG + Intergenic
1099424298 12:82503597-82503619 AGAGGAGAGGAGAGGGGAGAGGG + Intergenic
1100396068 12:94187362-94187384 CCAAGAGAAATGAAGGGAGAGGG + Intronic
1101615365 12:106331141-106331163 CCAGAAGTCAAGATGGGAAAGGG - Intronic
1101843168 12:108342162-108342184 CAAGGGGAGGAGAGGGGAGAGGG + Intergenic
1102068175 12:109996131-109996153 CCAGGAAAGCAGAGGGGAGCGGG + Intronic
1102453474 12:113057423-113057445 CCAGGAGACAAGAGGGGAGAGGG - Intronic
1102464530 12:113120683-113120705 CAAGTAGGCAAGAGGGAAGATGG + Intronic
1102465621 12:113129414-113129436 CCAGGAGACAGGAGGTGAGCAGG + Intronic
1102547569 12:113667661-113667683 CAGAGAGAAAAGAGGGGAGATGG - Intergenic
1102657433 12:114494407-114494429 CCAGGAGACGGCAGGGGACATGG - Intergenic
1102741065 12:115207930-115207952 CAAAGAGAGAAGAGGGGAGGTGG - Intergenic
1103084539 12:118052372-118052394 CCAGGAGCCATCTGGGGAGAAGG + Exonic
1103188555 12:118981561-118981583 CCAGGAGAGAAGAGGCGACGGGG - Exonic
1103834665 12:123809221-123809243 ACAGGAGAGAAGAGGACAGATGG - Intronic
1104895628 12:132162328-132162350 AGAGGAGACAAGAGAGGGGAGGG - Intergenic
1105284487 13:18993280-18993302 CCAGAAGGCAAGAGGACAGAAGG + Intergenic
1105284514 13:18993454-18993476 CCAGGAGGCCAGAAGGCAGAAGG + Intergenic
1105284633 13:18994145-18994167 CCAGAAGGCAAGAAGGCAGAAGG + Intergenic
1105284789 13:18995089-18995111 CCAGAAGGCCAGAGGGTAGAAGG + Intergenic
1105284990 13:18996282-18996304 TCAGAAGACCAGAGGGCAGAAGG + Intergenic
1107544941 13:41426355-41426377 CTAAGAGCCAGGAGGGGAGAAGG + Intergenic
1107600091 13:42004364-42004386 CATGGAGACAGGAGGGAAGAAGG - Intergenic
1107691330 13:42956493-42956515 CCAGCAGGCAGGAGGGGAGTAGG + Intronic
1108556183 13:51595192-51595214 CCAGGAGACCAGTGGGGACAAGG - Intronic
1108788395 13:53935552-53935574 ACAGGAGACTAGAGGGGAAGAGG - Intergenic
1109546427 13:63841145-63841167 CCAAGAGCCAAGGGGGGAAAGGG - Intergenic
1109979156 13:69883870-69883892 CCAGGAGACATGGGGAGAGGTGG - Intronic
1110863304 13:80367478-80367500 GCAAGAGACAGGAGGGCAGAAGG + Intergenic
1112203135 13:97297579-97297601 GCAGGAGACATGAAGGGACAGGG - Intronic
1112485143 13:99812833-99812855 CCTGGAGACAAGTGGGGCCAAGG + Intronic
1112653591 13:101424828-101424850 CCATGAGACACGAGCTGAGAGGG + Intergenic
1113246395 13:108401685-108401707 CCAGGAGCCAGGAGGGAGGAGGG + Intergenic
1113258034 13:108528760-108528782 GGAGGAGACAGGAGGGGAGAGGG - Intergenic
1113585239 13:111460122-111460144 GCAGGAGAGAGGAGGAGAGAGGG + Intergenic
1113784522 13:112995519-112995541 CCAGGAGAGCAGAGGGGAGCTGG + Intronic
1114731755 14:25000495-25000517 CCAGAAGACAGGAGGGCAGGAGG - Intronic
1114848167 14:26349030-26349052 GCAGAAGGCAAGAGGGGAGCAGG - Intergenic
1115077461 14:29408885-29408907 GCAGAAGACAAAAGGGGAGCAGG - Intergenic
1116501963 14:45634522-45634544 CGAAGAAAGAAGAGGGGAGAGGG - Intergenic
1116565982 14:46444736-46444758 CCAGGAGACCAGAGGACAGAGGG - Intergenic
1116759955 14:48999739-48999761 CCAGGAAACAGGAAGGAAGAGGG - Intergenic
1116996232 14:51328100-51328122 ACAGGAGAGGAGAGGGGAGGTGG - Intergenic
1117820691 14:59645618-59645640 CCTGGAGACAAGAAGGGTGAGGG - Intronic
1118252574 14:64176567-64176589 CCAGCAGAGGAGAGGGGTGACGG + Intronic
1118387780 14:65270777-65270799 CCAGGTGACAAAAGGGAAGACGG + Intergenic
1118867156 14:69712665-69712687 GCAGGAGGCAAGAGGGTAAAAGG - Exonic
1118960499 14:70525666-70525688 CTGGGATAGAAGAGGGGAGATGG - Intronic
1119032119 14:71200909-71200931 TCAGGGCACAAGAGGGGAGGTGG - Intergenic
1119213315 14:72849324-72849346 CCAGGAGACATGACGGCAGAGGG + Intronic
1119484457 14:74978689-74978711 CCAGGAGACAAGGAGGGACAAGG + Intergenic
1119574121 14:75702870-75702892 CCAGGAGGCATGAGGGGAGCTGG + Intronic
1121179536 14:91918375-91918397 CCAAGAAACAAGAGGGCAGAAGG + Intronic
1121211555 14:92211212-92211234 ACATGAGACATGAAGGGAGAAGG + Intergenic
1121333071 14:93060044-93060066 GCAGGAGACCAGAGGGCAGGAGG + Intronic
1121602150 14:95213351-95213373 CCAGGGGACAAGCTGGAAGATGG + Exonic
1122218906 14:100222790-100222812 CCAGCACCCAAGAGGGGAGAAGG + Intergenic
1122295524 14:100703640-100703662 CCAGGAGACAAGGCTGCAGATGG - Intergenic
1123004037 14:105312969-105312991 CCAAGTGACAAAAGAGGAGATGG - Exonic
1123028880 14:105441263-105441285 CAAGGAGGCAAGAGGGGCGGGGG - Intronic
1202836320 14_GL000009v2_random:79797-79819 CCAGGAGACAAGCGGAGTGGTGG + Intergenic
1123413891 15:20081358-20081380 TCAGGAGGCAAGAAGGGTGATGG + Intergenic
1123523233 15:21088469-21088491 TCAGGAGGCAAGAAGGGTGATGG + Intergenic
1124006819 15:25801298-25801320 CCAGCAGAGAAGAGGAGCGAGGG + Intronic
1124204085 15:27702370-27702392 ACCGGAGGCAAGAGAGGAGAGGG - Intergenic
1124587725 15:31024990-31025012 CCAGCCCACAGGAGGGGAGATGG - Intronic
1125235849 15:37512536-37512558 CCAGTAGACTAGAGGCAAGAAGG - Intergenic
1125247024 15:37652517-37652539 TCAGGAGATAGGAGGGGATAAGG + Intergenic
1125399601 15:39286855-39286877 CATGGGGACATGAGGGGAGAAGG - Intergenic
1125431593 15:39600447-39600469 ACATGAGACAAGTGGGAAGAAGG + Exonic
1125641097 15:41231281-41231303 CTAGGGGTCAAGAAGGGAGAGGG - Exonic
1125762112 15:42103872-42103894 CCAGGAGGGAAGCAGGGAGAAGG + Intergenic
1125766737 15:42141403-42141425 CGAGGAGACCAGAAGGCAGAAGG + Exonic
1126161897 15:45621321-45621343 CCAGCAGGCAAGAGAGGAGCTGG + Intronic
1126196572 15:45938103-45938125 CCAGGAGGCAATAGGGAAGAGGG + Intergenic
1128151842 15:65368214-65368236 TCTGGAGAGAAGAGGGGAGAGGG + Intronic
1128449489 15:67796423-67796445 GCAGAAGGCAAGAGGGGAGCTGG + Intronic
1128569880 15:68726284-68726306 CCAGGAAGCAAGAGGGGAAGCGG + Exonic
1128582486 15:68819260-68819282 CAAGGGGCCAAGAGGGGAGCTGG + Intronic
1129142358 15:73611580-73611602 CCAGGAGATAAGAAGGAAGGAGG + Intronic
1129196699 15:73972835-73972857 CCAGGAGAAACTGGGGGAGACGG - Intergenic
1129348518 15:74939727-74939749 GCAAGAGACAAGAGGGCAGAAGG - Intergenic
1129360447 15:75020890-75020912 CCAAGAGAGAAAATGGGAGAGGG - Exonic
1130006839 15:80107822-80107844 AGAGGAGAGGAGAGGGGAGAGGG + Intronic
1130392733 15:83473290-83473312 CCAGGGGTGAGGAGGGGAGAGGG + Intronic
1130459981 15:84153661-84153683 AGAGGAGAGGAGAGGGGAGAGGG + Intergenic
1131034224 15:89210654-89210676 CAATGAGACAAGAGGGCTGAGGG - Intronic
1131171757 15:90184169-90184191 CCGGGACGCAAGAGTGGAGAGGG + Intronic
1131487524 15:92834048-92834070 CCAGGAGAGAAGAGGGAGGAGGG - Intergenic
1131680188 15:94713450-94713472 CCATGAGACGAGAGGTGAGTAGG + Intergenic
1131691722 15:94834590-94834612 TCAGGAGAAAAGATGAGAGAAGG - Intergenic
1132734499 16:1378838-1378860 CCAGAAATCAAGGGGGGAGACGG + Intronic
1132760995 16:1508672-1508694 CCAGGTGGGGAGAGGGGAGATGG - Intronic
1133055022 16:3141592-3141614 CCAGGAAACTAGAGGGGAAGAGG - Exonic
1133537074 16:6712719-6712741 CCAGGTGATAGGAGGGGAGGTGG - Intronic
1133796647 16:9051851-9051873 CCAGGAGAATAGTGAGGAGAAGG - Intergenic
1133852059 16:9514594-9514616 ACAGGAGAGAGGAAGGGAGAGGG - Intergenic
1133853011 16:9523914-9523936 CAATGAGAAAAGAGAGGAGAAGG - Intergenic
1134244306 16:12528584-12528606 CCAGGAGACAACAGGAGATGGGG - Intronic
1134849314 16:17468121-17468143 CCAGGAGACCAGAAGGGGGCAGG - Intronic
1135026412 16:19002642-19002664 CCAGGAGACATGAGGGAGCAGGG - Intronic
1135149899 16:19996283-19996305 CCAGTTGACAAGGAGGGAGAGGG - Intergenic
1135663535 16:24316716-24316738 CCAGGAGCCAAGGGTGGGGAAGG - Intronic
1135816128 16:25635711-25635733 CCAGGATACTATGGGGGAGAGGG - Intergenic
1135918134 16:26624404-26624426 CCAGAAAACCAGAGGGGAGGAGG + Intergenic
1136474669 16:30505294-30505316 CTGGGAGGTAAGAGGGGAGAAGG + Exonic
1137540920 16:49361076-49361098 CAAGGGGACTAGAAGGGAGAGGG - Intergenic
1137842975 16:51657072-51657094 ACAGGAATGAAGAGGGGAGAGGG + Intergenic
1138181764 16:54945325-54945347 CGAGGAGAAAAGAAGGGAAAAGG - Intergenic
1139973304 16:70789957-70789979 CAAGGAGACAGGAGAGGAGGTGG - Intronic
1140855558 16:78974992-78975014 CCAGGAGAGAAGAGGGGCTGGGG - Intronic
1140929826 16:79617190-79617212 CCAGAAGTCAAGGAGGGAGAAGG + Intergenic
1141393206 16:83681612-83681634 CCAGGAGAGGAGAGGGGTGGAGG - Intronic
1141603109 16:85137998-85138020 GAAGGAGAGAAGAGGGGAAAAGG - Intergenic
1141927514 16:87179007-87179029 CCAGGAGACCAATGGGGGGAAGG - Intronic
1142103775 16:88291154-88291176 TGAGGAGCCAAGAGGGGAGTGGG - Intergenic
1142353141 16:89588880-89588902 CCTGGAGACCAGGGGGGTGAGGG - Intronic
1142900212 17:3007035-3007057 CCAGGAGGAAAGAGTGGGGAAGG + Intronic
1143026131 17:3942968-3942990 CTTGGAGAAAAGAGGGGAGAAGG - Intronic
1143028331 17:3953740-3953762 TGAGGAGACAAGAGAGGAGTGGG + Intronic
1143411215 17:6710354-6710376 ACATGAAACAAGAGGGGACAGGG - Intronic
1144270223 17:13608074-13608096 CCAAGAGACCAGAGAGGACATGG + Intergenic
1144710840 17:17400639-17400661 TCAGGAGACAAGAGGAGGCAAGG - Intergenic
1144765111 17:17728341-17728363 CTTGGAGACCAGAGGGAAGACGG - Intronic
1144879752 17:18425240-18425262 CTAGAAGACCAGAGGGGAGGAGG + Intergenic
1145057751 17:19714501-19714523 CCAGGAGAAAGGGGTGGAGATGG - Intronic
1145748255 17:27336512-27336534 ACAGGTGACAGGAGGGGAGGGGG - Intergenic
1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG + Intronic
1146291774 17:31612913-31612935 GCAGGAGAAAGGAGAGGAGAAGG - Intergenic
1146471412 17:33127932-33127954 GCAGGAGAGAAGAGGCTAGAAGG - Intronic
1147186804 17:38717499-38717521 CCAGGAGGCTGGAGGAGAGAGGG - Exonic
1147484724 17:40801630-40801652 GCAGGAGACAGGAGGGAAGTGGG + Intergenic
1147598898 17:41733976-41733998 CCAGGGGACAAGAGCAGAGGAGG + Intronic
1147754859 17:42761402-42761424 CCCGGAGGGGAGAGGGGAGAGGG + Intronic
1147879304 17:43643634-43643656 CCAGGAGAACAGAGGGAAGCCGG - Exonic
1147952571 17:44115331-44115353 GCAGGAGATAAGAGGTGGGAAGG - Intronic
1147996123 17:44361351-44361373 CCAGGAGACAGGTGGGAAGTGGG + Intronic
1148071557 17:44911599-44911621 CCAGGAGATGCCAGGGGAGAAGG - Intronic
1148074711 17:44928642-44928664 CCAGGAGACCTGAGGGGTTATGG - Intronic
1148219158 17:45849992-45850014 TCAGGAAACAAGTGTGGAGACGG + Intergenic
1148229118 17:45920229-45920251 CCAGGTGACAGGAGGACAGAGGG - Intronic
1148341955 17:46878544-46878566 GCAGGAGAAAAATGGGGAGAGGG + Intronic
1148344778 17:46895866-46895888 CCAGGAGACAAGTGGGAGCAGGG + Intergenic
1148466142 17:47866390-47866412 CCTGGAGACAAGGAGGAAGATGG + Intergenic
1148467548 17:47873941-47873963 GGAGGAGGGAAGAGGGGAGAAGG - Intergenic
1148584785 17:48769678-48769700 CCAGGAGCTTAAAGGGGAGAGGG - Intronic
1148716607 17:49720285-49720307 GGAGGAGAACAGAGGGGAGAGGG + Intronic
1148779217 17:50112212-50112234 ACAGGACAGAGGAGGGGAGAGGG + Intronic
1148973367 17:51504644-51504666 CCAGGAGTTAAGGGAGGAGAAGG - Intergenic
1149633727 17:58149065-58149087 CTAGGAGAGACGAGGGGAGAAGG - Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151302534 17:73237985-73238007 ACAGGAGAGATGAGGCGAGAAGG + Intronic
1151326007 17:73380144-73380166 CCCAGAGAGAAGAGTGGAGAGGG - Intronic
1151366041 17:73617157-73617179 CCCGCAGAGAGGAGGGGAGAGGG + Intronic
1151366060 17:73617202-73617224 CCTGCAGAGAGGAGGGGAGAGGG + Intronic
1151460728 17:74252641-74252663 CCTGGTGAGAAGAGAGGAGAAGG - Intronic
1151462018 17:74260103-74260125 CCAAGAGAGAAGAGAGGGGATGG - Intronic
1151501997 17:74496150-74496172 CCAGGAAACAAAAGGGATGATGG + Intergenic
1151562385 17:74877672-74877694 CCAGGGGAAGTGAGGGGAGAAGG - Exonic
1151700354 17:75739649-75739671 CTAGGAGACAAGGTGGGTGAGGG - Intronic
1152395356 17:80029687-80029709 AAAGGAGACAAGAGGGGAGACGG - Intronic
1153183802 18:2465177-2465199 CAAAGAGACAAGAAGGGAGCAGG + Intergenic
1153476265 18:5502023-5502045 GCAGGAGGCAGGAGGGAAGATGG - Intronic
1153530336 18:6039638-6039660 CCAGGAAACAGGATGGAAGAGGG - Intronic
1153973077 18:10244093-10244115 CCAGGAGACAGGAGAAGACAAGG + Intergenic
1154039121 18:10836387-10836409 GGAGGAGACAGGAGTGGAGAGGG - Intronic
1154082560 18:11272797-11272819 GCAGCAGACAAGAGAAGAGAAGG - Intergenic
1155727082 18:29100080-29100102 CCTGCAGACAAGATGGGAGATGG - Intergenic
1156191027 18:34720523-34720545 ACAGGAGACTACAGAGGAGAAGG + Intronic
1156381018 18:36561318-36561340 CCAGGAGACAGGATGGGTGGCGG + Intronic
1156456396 18:37297046-37297068 CAGGGAGAGAAGAGGGGAGCAGG + Intronic
1157325597 18:46666720-46666742 CAAAGAGACAAATGGGGAGATGG + Intergenic
1157406297 18:47424903-47424925 TCAGGATAGAAGAGGAGAGATGG - Intergenic
1157475792 18:48022642-48022664 CCAGGAGACACTGGTGGAGAGGG + Intergenic
1157503537 18:48208491-48208513 CCAGGAGACAAAGGGGGTGGGGG + Intronic
1157545709 18:48545090-48545112 CCAGGAAAGGAGATGGGAGACGG + Intronic
1158380102 18:56920142-56920164 CCAGGAAATAAGAGGGAACATGG - Intronic
1160556728 18:79730371-79730393 CCAGGAAACCAGGAGGGAGACGG - Intronic
1160901616 19:1431714-1431736 CCAGTAGAGAAGAAGGGACATGG + Intronic
1160930917 19:1568975-1568997 CTAGGAGAGACTAGGGGAGAGGG - Intergenic
1161246270 19:3254052-3254074 CCAGGAGGGAAGATGGAAGAGGG + Intronic
1161249218 19:3271308-3271330 GCTGGAGGCAGGAGGGGAGATGG - Intronic
1161592185 19:5133860-5133882 CTAGAAGAACAGAGGGGAGAGGG - Intronic
1161915482 19:7225037-7225059 AGAGGAGAGAGGAGGGGAGAGGG + Intronic
1161950287 19:7463968-7463990 CCTGGAGGCAGGAGGGGAGACGG - Intronic
1162097707 19:8320947-8320969 CCAGGAGAGAGGAAAGGAGAGGG + Intronic
1162111940 19:8404120-8404142 GCAGGAGAGGGGAGGGGAGAGGG - Exonic
1162567445 19:11451956-11451978 CCAAGAGACAGCAGGGGAGAGGG + Exonic
1162736037 19:12747672-12747694 GCAGGAGGCTAGAGGGCAGAGGG - Intronic
1162774922 19:12973671-12973693 CTTGGAGAAATGAGGGGAGATGG + Exonic
1162897896 19:13776377-13776399 CCAGGAGACAAGGGAGAAGGTGG - Intronic
1163710633 19:18844732-18844754 CCAGGGGACATGATGGGTGAAGG - Intronic
1163720831 19:18897419-18897441 CCAGGATACCAGACGGAAGAGGG - Intergenic
1164235033 19:23324208-23324230 CCAGGAGAGGAGAGGAGAAAAGG - Intronic
1164597421 19:29539402-29539424 CCAGGGGAGAAGTGGGGAGAAGG + Intronic
1164620025 19:29689860-29689882 CCAAGAGAGAAGAGGTTAGAGGG + Intergenic
1164783917 19:30914349-30914371 CCAGGAAAGAGGAGAGGAGAAGG - Intergenic
1165021684 19:32929690-32929712 GCAGAAGACAACATGGGAGAAGG + Intronic
1165045937 19:33105069-33105091 CCAGGAGCTAGGAGGGGAGTGGG - Intronic
1165100537 19:33436115-33436137 CGGGGAGAAAAGAAGGGAGAAGG + Intronic
1165162235 19:33823582-33823604 TCAGGAGACTGGAGGGCAGAAGG + Intergenic
1165742008 19:38210323-38210345 CCAGGAGAGAGGAAGGGAGCAGG - Intergenic
1165827479 19:38713587-38713609 CCTGGAGACAGGCGGGGAGGCGG - Intronic
1166110417 19:40619318-40619340 GCAGGAGACAACAGGGGAGAGGG - Intronic
1166158049 19:40930131-40930153 CCAGGAGAGTGGAGGAGAGAGGG + Intergenic
1166166916 19:40997160-40997182 CCAGGAGAGTGGAGGAGAGAGGG + Intronic
1166547071 19:43639949-43639971 CCCGGAGACAATCGGGGGGACGG + Intergenic
1167081007 19:47275974-47275996 ACAGGAGACAAGAGGAGGGGTGG + Intergenic
1167435143 19:49474774-49474796 CGAGGAAATAGGAGGGGAGATGG + Intronic
1167478071 19:49712449-49712471 GGAGCAGACAAAAGGGGAGAGGG + Intronic
1167621749 19:50564618-50564640 CCAGGGAAGATGAGGGGAGATGG + Intronic
1167634954 19:50649044-50649066 CCAGGAGAGAAGGAGGGAGGAGG + Intronic
1168075560 19:53979236-53979258 CAAGCAGATAAGAGGAGAGAGGG + Intronic
1168089946 19:54075882-54075904 CAAGGAGACACAAGGGGAGATGG - Exonic
1168726161 19:58583288-58583310 GGAGGAGACAAGAAGAGAGAGGG - Intergenic
925189530 2:1871579-1871601 CCAGGTGGCTAGAGGGGTGAAGG + Intronic
925799760 2:7586630-7586652 CCAGAAGACCAGAGGGGAGAAGG - Intergenic
925971525 2:9109964-9109986 ACAGGGGACAACAGGGGAGCCGG + Intergenic
925981681 2:9182128-9182150 CCAGGAGAGAAGTGGGTTGAGGG + Intergenic
926331869 2:11832373-11832395 CCTGGAGAAAAGATGGGGGAAGG + Intergenic
926395715 2:12440396-12440418 CCAAGAGACAGGAAGGGATATGG - Intergenic
926459275 2:13108984-13109006 CCAGGGGAAAAGGTGGGAGAAGG + Intergenic
926608256 2:14919000-14919022 ACAGAAGACAACTGGGGAGATGG + Intergenic
927496819 2:23556688-23556710 CCAGGAGACGGGAGGGGAGGAGG - Intronic
927538775 2:23887943-23887965 CGAGGGGAAAAGAAGGGAGATGG - Exonic
927908634 2:26880623-26880645 CATGGAGAAAAGAGGGGAGGCGG - Intronic
928029895 2:27769230-27769252 TCAAGAGAGGAGAGGGGAGAGGG - Intergenic
928199167 2:29236295-29236317 CCGCAAGCCAAGAGGGGAGATGG - Intronic
928225473 2:29444486-29444508 CCAGGAGACAACAGAGGACTGGG + Intronic
928437562 2:31265431-31265453 CCAGAAGACAATAAGGGAGCTGG - Intronic
929125515 2:38519729-38519751 CCAGGAGACAATAGTGGCAAAGG + Intergenic
929444522 2:41991999-41992021 GCAGGAGAGGGGAGGGGAGAGGG + Intergenic
929456465 2:42069555-42069577 CCAGGAGGGCAGAAGGGAGAAGG - Intergenic
929670979 2:43876265-43876287 CCAAGAGGCAAAAGGGCAGAGGG - Intronic
930280715 2:49366504-49366526 CCATGAGACAATAGAGGTGATGG + Intergenic
930699095 2:54441201-54441223 CTAGGAGGGAAGAAGGGAGAAGG - Intergenic
931640721 2:64378873-64378895 CCTGGACACTAGAGAGGAGATGG - Intergenic
931889439 2:66654926-66654948 CAAGGAGATAATAAGGGAGAAGG + Intergenic
933949284 2:87314213-87314235 GAAGGAGAAAAGAGGAGAGAGGG + Intergenic
934066613 2:88347634-88347656 CGGGGAGAGAAGAGGTGAGATGG - Intergenic
934067127 2:88350654-88350676 CCAGGAGACCACAGAGCAGAAGG + Intergenic
934076954 2:88436711-88436733 CCAGGAGACAGGAAGGGAAAGGG - Intergenic
934673726 2:96234412-96234434 CCAGGAGACAGGAATGGAGGAGG - Intergenic
934694931 2:96392957-96392979 TCAGTGGACAGGAGGGGAGAGGG - Intergenic
935046413 2:99487546-99487568 TCAGGAGACGAGACGGGAAAAGG - Intronic
935208317 2:100915941-100915963 GCAGCATAAAAGAGGGGAGAAGG + Intronic
935434430 2:103013888-103013910 CCAGGAGACAGGTGGGAGGAAGG + Intergenic
935675273 2:105589805-105589827 CCAGAAGACATGAGTGGAAATGG + Intergenic
935977579 2:108594120-108594142 CCAGCAGAGAAGAGGTGGGAAGG + Intronic
936573355 2:113634383-113634405 CCAGGAGCCAGGAGGGTGGAAGG + Intronic
937224437 2:120360162-120360184 CCTAGAGAAAAGAGGTGAGATGG - Intergenic
937260580 2:120584480-120584502 CCAGAAGAAAATAGGGGATATGG + Intergenic
937939153 2:127271719-127271741 CCAGGAGCCCAGAGATGAGAGGG + Intronic
938934394 2:136116362-136116384 CAGGGAGGGAAGAGGGGAGAAGG + Intronic
939281249 2:140068063-140068085 TCAGGAGACAACAGGGCAGGTGG - Intergenic
939695856 2:145323540-145323562 CCAGGAAAGAAGTGTGGAGAAGG - Intergenic
940774487 2:157872551-157872573 GCAGGAGAAAATAGGGGAGGAGG + Intronic
940886991 2:158998849-158998871 CCAAGAGATCAGAGGGGAGGGGG - Intronic
941663260 2:168216941-168216963 CCAGGAGCCCAGAGGGGCGCTGG + Intronic
941799966 2:169648290-169648312 ACTGGAGAAAAGAGGGGATAGGG + Intronic
941972434 2:171366019-171366041 ACAGGATACTAAAGGGGAGATGG + Intronic
942413675 2:175736647-175736669 CCAGAAAAAAAAAGGGGAGAAGG + Intergenic
942565131 2:177258435-177258457 CCAGGAGAGTTGAGGGGAAATGG + Intronic
942936311 2:181561071-181561093 CCAAAAGACAAGAGGGTATAAGG - Intronic
943754552 2:191544486-191544508 CCAGGAAACAAGAGGGGTAGAGG - Intergenic
944104789 2:196068553-196068575 CCAGGCCACAAGTGGGGTGAAGG + Intronic
944823127 2:203451741-203451763 CCAGGAAAGAAGTGGGGAGGAGG - Intronic
944937578 2:204585136-204585158 CAAGAAAACAAGAGGGAAGAGGG - Intronic
945235710 2:207629575-207629597 CCAGGAGACAGGAGGGACAAAGG - Intergenic
945582783 2:211616998-211617020 CATGGAAACAAGAGTGGAGATGG - Intronic
946191794 2:218011435-218011457 CCGGGAGAGAAGAGGGGCGGAGG + Intergenic
947051516 2:226049035-226049057 CTAGGAGAGAAGTAGGGAGAGGG + Intergenic
947073240 2:226314910-226314932 TCAGCAGAGAAGAGGGAAGAAGG + Intergenic
947168227 2:227284252-227284274 CCAGGAGCCAAGGGGGAACAAGG + Exonic
948079136 2:235191348-235191370 CCAGGAGAGGAGAGGAGAGAAGG - Intergenic
948167819 2:235876761-235876783 CCTGGGGGCAAGAGAGGAGAAGG - Intronic
948542215 2:238699104-238699126 CCAGGAGCGAAGAGGGTAGGAGG - Intergenic
948667511 2:239545779-239545801 CCAGGTGACAGGAGGGAAGGCGG - Intergenic
948814062 2:240500697-240500719 CCATGAGACAAACGGGGAGAGGG + Intronic
948916057 2:241035610-241035632 CTAGGCTACGAGAGGGGAGAGGG + Intronic
949043100 2:241858454-241858476 CCAGGAGCAAAGAGGGGACTTGG + Intronic
1168808680 20:688723-688745 GGAGGAGAGAAGCGGGGAGATGG + Intergenic
1168827351 20:822858-822880 AGAGGAGACAAGAGAGGGGAAGG + Intergenic
1168955023 20:1828685-1828707 CCAGGAGCCCAGAGGGAAGCTGG + Intergenic
1170205411 20:13792670-13792692 CCCGGAGAAAAGAGGGCTGAGGG + Intronic
1170763858 20:19274033-19274055 CCAGAGGGGAAGAGGGGAGAAGG - Intronic
1170842807 20:19937985-19938007 ACAGGAGACAGGACGGGAGGTGG - Intronic
1171012519 20:21516315-21516337 CCAGGGGAAAAAAGGGGGGAAGG - Intergenic
1171263607 20:23752830-23752852 CCAGGAGAGGAGAGGGTGGAAGG + Intergenic
1171485181 20:25481003-25481025 CCAGGAGCCAGCAGGGGAGGGGG + Intronic
1172100073 20:32480022-32480044 ACGGGAGACCAGAGGGGAAATGG + Intronic
1172991647 20:39041118-39041140 CCAGGACAAAACAGTGGAGATGG - Intergenic
1173006467 20:39143163-39143185 CCAGGAGGCATGATGGGAGAAGG - Intergenic
1173638965 20:44585776-44585798 GCAGGAGACTAGAGGGCACAGGG - Intronic
1173863454 20:46298943-46298965 CCAGGAGATAAGTGGGGTGGGGG - Intronic
1174296404 20:49548387-49548409 CCAGGAGAGAAGGCGGCAGATGG + Intronic
1176138786 20:63536193-63536215 CCAGGTGAGAAGTGGGGAGGAGG - Intronic
1176387175 21:6144071-6144093 GCAGGAGGCAACAGGGGAGCAGG - Intergenic
1176521196 21:7825784-7825806 CCAGGGGAGAAGAGGGCAGTGGG + Exonic
1176739383 21:10585954-10585976 TCAGAAGAAAAAAGGGGAGAAGG - Intronic
1177089058 21:16743398-16743420 CTATGAGAAAAGAGGGCAGATGG - Intergenic
1177504705 21:22005379-22005401 CCAGAAGACAGAAGAGGAGACGG + Intergenic
1177739944 21:25142048-25142070 AAAGGAGAAAAGAGGAGAGATGG - Intergenic
1178286449 21:31329241-31329263 TAAGGAGACAATAGGGCAGAAGG - Intronic
1178379894 21:32099067-32099089 CCAGGACAGAAGAGGTGAGAAGG - Intergenic
1178471922 21:32901520-32901542 GCAGAATACTAGAGGGGAGAGGG + Intergenic
1178582407 21:33847848-33847870 CCAGGAGATCAGAGGAAAGATGG - Intronic
1178655216 21:34455796-34455818 CCAGGGGAGAAGAGGGCAGTGGG + Intergenic
1178944363 21:36933929-36933951 CCTGGAGACAAGGGGGAAGATGG + Intronic
1179229543 21:39489037-39489059 CAAGAAGACCAGAGGGAAGAAGG + Intronic
1179430614 21:41318608-41318630 CCAGGAGAGATGAGGGTGGATGG - Intronic
1179602619 21:42490196-42490218 GCAGGAGAGGAGTGGGGAGACGG - Intronic
1179736298 21:43394181-43394203 GCAGGAGGCAACAGGGGAGCAGG + Intergenic
1181054029 22:20251326-20251348 GCAGGAAACAAGAGAGGAAAGGG + Intronic
1181359674 22:22324712-22324734 CCAGGGGACAAGAGAGGTTATGG - Intergenic
1181922382 22:26330484-26330506 CTAGCAGAGAAGAGAGGAGAGGG + Intronic
1182099047 22:27645151-27645173 CCAGGAGACAAGAGAGGACTGGG - Intergenic
1182114662 22:27749161-27749183 GCAGAAGGAAAGAGGGGAGAAGG + Exonic
1182299473 22:29329658-29329680 ACAGGAGACAAGACTGGGGAGGG + Intronic
1182387575 22:29958555-29958577 CACTGAGACAAGAGGGGAGCAGG - Intronic
1182546228 22:31078210-31078232 TCAGGAGGCAAGAAGGGTGATGG - Intronic
1183233284 22:36596511-36596533 CTAGGGGTCAAGAAGGGAGAGGG + Intronic
1183262009 22:36801384-36801406 CCAGGAGATGAGAGAGGACAAGG + Intronic
1183297321 22:37037873-37037895 CCAGGAGCCAAGGGAGGAGGGGG + Intergenic
1183407741 22:37638888-37638910 CCAGGAGGAATGAGAGGAGACGG + Intronic
1183420051 22:37706473-37706495 CCAGGAGCCAAGACCAGAGATGG + Intronic
1184098534 22:42329582-42329604 CAAGGAGACGGGAGGGGAGGTGG + Intronic
1184504914 22:44894780-44894802 CCAGGGGACATAAAGGGAGAGGG + Intronic
1184685501 22:46094993-46095015 CCAGGGGAGGGGAGGGGAGACGG - Intronic
1184739796 22:46421229-46421251 CCAGGAGCCCAGAGAGGGGAGGG + Intronic
1184787776 22:46680167-46680189 CCAGGACACCAAAGTGGAGAGGG - Intergenic
1184872963 22:47252326-47252348 CCAGGAAAGAAGAGGAGGGAGGG + Intergenic
1185426827 22:50776497-50776519 CCAGGAGCCAGGAGGGTGGAAGG - Intronic
949809548 3:7991565-7991587 GCAGGAGACCAGAGGGGTGGAGG + Intergenic
949828202 3:8185270-8185292 TCAGGAGACCAGAGGGCAGGAGG + Intergenic
949894014 3:8755927-8755949 CCGGGAGGCAAGAAGGGAAAAGG + Intronic
949981159 3:9502398-9502420 CCAGGGCACAAGTGGGCAGAGGG + Intronic
950006843 3:9696940-9696962 CCAGGACAGAAGAGGGGGGTTGG + Intronic
950121518 3:10485109-10485131 GCAGGGGACAAGAGGTGAGGGGG + Intronic
950425673 3:12923647-12923669 CCATGAGACAAAAAGGGCGACGG + Intronic
950671876 3:14532202-14532224 GCGGGAGAAAAGACGGGAGAAGG + Intronic
950719802 3:14874924-14874946 CCAGGACAAGCGAGGGGAGAAGG - Intronic
950853775 3:16086849-16086871 CCAGGAGGCAGGAGGGGGCAGGG + Intergenic
951453120 3:22862046-22862068 CCAGGAAGCAAGATGGGAAAAGG + Intergenic
951709903 3:25576866-25576888 ACAGAAGAGAAGAGAGGAGAAGG - Intronic
952509051 3:34035922-34035944 GCAGGAGACAAGAAGTGAGTGGG + Intergenic
952748052 3:36800663-36800685 TCAGGAGACAGGAGGAGAAAAGG + Intergenic
953024898 3:39139155-39139177 CCTGGAGACCAGACAGGAGAGGG - Intergenic
953029917 3:39172625-39172647 TCAGGCTCCAAGAGGGGAGATGG + Intergenic
953262299 3:41351763-41351785 ACAGAAGACAAGATGGGAAAGGG - Intronic
954322936 3:49844285-49844307 CCAGGAACCAAGATGGGAGGGGG - Intronic
954388675 3:50257833-50257855 CCAGGGGACAAGGGAGGAGAAGG + Intronic
954934983 3:54318208-54318230 CCAGGAGAGAAGAGCACAGACGG + Intronic
954985767 3:54790294-54790316 CCAGCAGATGAGAGGGGAGAAGG - Intronic
955096193 3:55800711-55800733 CAAGGAGAGAAAAGTGGAGATGG - Intronic
955144370 3:56301493-56301515 GGGGGAGAGAAGAGGGGAGAGGG - Intronic
955339257 3:58112326-58112348 CCAGGGGAGCAGAGGGGAGAAGG - Intronic
955522451 3:59788162-59788184 CCAGGAGAAATGATGGGAGAGGG - Intronic
955711115 3:61779957-61779979 CCAGGAAACAATAGAGGAGTAGG - Intronic
956007640 3:64797745-64797767 TCAGGAATCATGAGGGGAGAAGG + Intergenic
956258545 3:67311227-67311249 GCGGGAGACAAGAGAGGAAAGGG + Intergenic
956774137 3:72550843-72550865 GCAAGAGAGAAAAGGGGAGAGGG - Intergenic
959283492 3:104378376-104378398 GCAGAAGACAAAAGGGGAGCAGG - Intergenic
959676937 3:109046244-109046266 CGTGGAGACTAGAAGGGAGAGGG + Intronic
960580651 3:119275817-119275839 CCTGCAGATAATAGGGGAGAGGG - Intergenic
960737664 3:120798422-120798444 CCTGGAGAAAGGAGGTGAGAAGG - Intergenic
960769808 3:121181143-121181165 AGAGGAGAAAAGAGGGGAGGGGG + Intronic
961804210 3:129477192-129477214 CCAGGAGGCAAGTGGAGACAGGG - Intronic
962010627 3:131387241-131387263 CCAGAAGGGAAGTGGGGAGAAGG - Intronic
962203094 3:133415932-133415954 TCAGGCGAGTAGAGGGGAGATGG - Intronic
962388950 3:134955914-134955936 TCAGCAGGGAAGAGGGGAGAAGG - Intronic
962479270 3:135784764-135784786 ACATGAGACAAGAGGGCAAAAGG - Intergenic
962632192 3:137289507-137289529 CCAGGTGACAAGGTGGGGGAGGG + Intergenic
963320319 3:143803499-143803521 CCAGGAGACAACAGCTGTGATGG - Intronic
964086967 3:152830731-152830753 ACAGGAGGCCAGCGGGGAGAGGG - Intergenic
964668595 3:159200824-159200846 CCTGGACAGATGAGGGGAGAAGG + Intronic
964716041 3:159722916-159722938 CCTGGAGAAAAGTGGGGAGCAGG + Intronic
964762664 3:160149012-160149034 CCAGGTGACAAGAGGGGAAAAGG - Intergenic
966152226 3:176877428-176877450 CCTGGAGACAATAAGGGTGAGGG - Intergenic
966420752 3:179732100-179732122 CCAGGAGACCAGAGGGGTATGGG + Intronic
967177038 3:186870370-186870392 ACAGGAGTTAAGAGGGGGGATGG + Intergenic
967847919 3:194058547-194058569 CGGGGAGAGAAGAGGGGAGTGGG + Intergenic
967892859 3:194375445-194375467 AAAGGAGAGAGGAGGGGAGAAGG + Intergenic
967963885 3:194945560-194945582 CAAGGAGAAGAGAGGGGGGAAGG + Intergenic
968227745 3:196985773-196985795 ACAGGAGGCAAGATGGGAAAGGG - Intergenic
968474786 4:799103-799125 ACAGGTGAAAAGAGGGCAGAAGG - Intronic
968485637 4:859704-859726 CCAGGAGAGAAGAGGGGGCCTGG + Exonic
968706647 4:2081447-2081469 TCAGGAGGCATGAGGGGACACGG - Intronic
968748695 4:2374917-2374939 CCAGGTGCCAACAGGGGACATGG - Intronic
969042214 4:4307981-4308003 CCAGGAGAGAGGAGTGGAGGTGG - Intronic
969208685 4:5669610-5669632 CAGGGAGACAGAAGGGGAGAAGG - Intronic
969515710 4:7647084-7647106 CCAGGGGACGAGAGGGAAGTAGG + Intronic
969540541 4:7786041-7786063 CCAGGAGAACAGAGATGAGATGG + Intronic
970104696 4:12568413-12568435 ACAAGAGACAAGAGGAGAGAAGG - Intergenic
970231028 4:13911493-13911515 CCAGCAGCTGAGAGGGGAGATGG + Intergenic
971376034 4:26056443-26056465 CTGGCAGAAAAGAGGGGAGAGGG - Intergenic
971412085 4:26384885-26384907 GCAAGAGGCAAGAGGGGAGAGGG - Intronic
972369672 4:38410762-38410784 ACAGGATACAAGAGGCGATAGGG + Intergenic
972706916 4:41553768-41553790 CCTGGATCCAAGAGGGAAGATGG - Intronic
972810854 4:42584271-42584293 GGAGGAGAAAAGAGGGGAGAAGG + Intronic
973652013 4:53005951-53005973 CCAGGAGAAAAGAGGAAGGAGGG + Intronic
974339373 4:60594511-60594533 CCAGGAAACAAGGAAGGAGAAGG - Intergenic
976873696 4:89828581-89828603 CCATGAAACAAAAGGGAAGAAGG + Intronic
977550132 4:98433116-98433138 CCATGAGAAATGAGGGCAGATGG + Intronic
977709986 4:100113901-100113923 GCAGGAGACAGGAGGGCAGGAGG - Intergenic
977744860 4:100534885-100534907 GCAGGAGACGAGAGGGGGTAGGG - Intronic
978591709 4:110330802-110330824 GCAGGAGACAAAGGGGGAGAAGG - Intergenic
978943710 4:114469662-114469684 CCAGAAAACAAGCAGGGAGAAGG - Intergenic
979671310 4:123362993-123363015 CCAGAAGACATGAAAGGAGAGGG + Intergenic
979993579 4:127404561-127404583 CCCGGACACAAGATGAGAGAGGG + Intergenic
981155064 4:141425385-141425407 CCAGAAGCCAAGAGAGGTGATGG + Intergenic
981172339 4:141638902-141638924 CCAGGAGAGATGAGGGGAAAAGG - Intronic
981656496 4:147117719-147117741 CCAGGAGAGAAGGAGTGAGACGG - Intergenic
982294439 4:153812409-153812431 CCAGGAGCCCAGAGGTGAGTTGG - Intergenic
983099787 4:163610892-163610914 GCAGGAAACAAGAGGAGGGACGG - Intronic
983311285 4:166064387-166064409 TCAGGAGAAAGCAGGGGAGATGG + Intronic
983524387 4:168745855-168745877 GCAGGAGAAAAGAGGAGGGATGG + Intronic
984853664 4:184175070-184175092 CTGGGAGCCAAGAGGAGAGACGG - Intronic
985046816 4:185949073-185949095 CCAGGAAACAGGAGGGGGGTTGG + Intronic
985652202 5:1112360-1112382 GAAGGGGACAAGAGGGGAGGCGG - Intergenic
986120704 5:4833471-4833493 CAAGGGGACAACAGAGGAGATGG - Intergenic
986127186 5:4894005-4894027 ACAAGAGGAAAGAGGGGAGAGGG + Intergenic
986223048 5:5787687-5787709 CCAGGAAACGAAAGGAGAGAGGG - Intergenic
986623583 5:9702727-9702749 CCAGAAGACATAAGGGCAGAAGG + Intronic
990785077 5:59409612-59409634 TCAGAAGACAAAAGGGGAGTAGG - Intronic
991063966 5:62406211-62406233 CCTGGAGACAAGAGCAGAGAAGG + Intronic
991069962 5:62466122-62466144 CCAGAACACAAGAGGATAGAAGG - Intronic
991503305 5:67299039-67299061 CCCTTAGACAAGAGGGTAGATGG + Intergenic
991997226 5:72400115-72400137 CCAAGAAAGAAGAGGAGAGAAGG - Intergenic
993109057 5:83632973-83632995 ACAGGAGACAGGAGGGCAGGAGG - Intergenic
994049703 5:95348566-95348588 CCAGGAGACCTTAGGAGAGAAGG - Intergenic
995156186 5:108915976-108915998 GCAGGAGAGAAGAGGGAAGTGGG - Intronic
995457569 5:112368381-112368403 CAAGGTGGCAATAGGGGAGAGGG - Intronic
996287816 5:121815538-121815560 CCAGCAGACAGTAGGGCAGAGGG - Intergenic
996683879 5:126258437-126258459 CCAGGAGAAAAGATGGGCAAAGG + Intergenic
996872502 5:128207002-128207024 CCAGGAAGCAAGGGTGGAGAAGG + Intergenic
999073113 5:148768811-148768833 GCAAGAGACAAGAGGAGAAATGG - Intergenic
999420881 5:151441450-151441472 GGAGGAGACAAGTGGGTAGAAGG + Intronic
1000263924 5:159616655-159616677 GCTGGAGAGAAGAGCGGAGAAGG - Intergenic
1000388803 5:160701636-160701658 CCAGGAGACATTAGGGTAGGAGG - Intronic
1001423039 5:171601300-171601322 GCAGGAGACAAGAGGGGTTGAGG - Intergenic
1001761778 5:174213768-174213790 CCAGGAGACAAGCTGGGACCTGG - Intronic
1002508783 5:179699089-179699111 CCGGGAGGCTAGAGGTGAGAGGG + Exonic
1002762764 6:214652-214674 CTAGGGGCCAAGAAGGGAGAAGG + Intergenic
1003357649 6:5389322-5389344 ACAGGACACAAGAGAGAAGATGG - Intronic
1004524299 6:16391855-16391877 CCAGCAGCCTGGAGGGGAGAAGG + Intronic
1004653066 6:17630718-17630740 AGGGGAGACAAGAGGGGAGAGGG + Intronic
1005614304 6:27557908-27557930 CCAGGAGGGGAGAGGGGAGTGGG + Intergenic
1006022796 6:31127250-31127272 CCAGAACACAGGAGGGAAGATGG - Intronic
1006193704 6:32224219-32224241 GCAGGTGATAGGAGGGGAGAAGG + Intergenic
1006418803 6:33920749-33920771 CCAGGTACCAAGAGAGGAGAGGG + Intergenic
1006788904 6:36686126-36686148 CCAGCGGACAAGTGGGGAGGAGG - Exonic
1006897154 6:37478556-37478578 CCTGGCGAGGAGAGGGGAGAGGG - Intronic
1007085299 6:39140134-39140156 GCAGGAAATCAGAGGGGAGAAGG + Intergenic
1007224556 6:40303520-40303542 CCATGAGAGGAGAGAGGAGAGGG + Intergenic
1007397341 6:41585351-41585373 CCAGGAGCCCAGATGGGACAGGG + Intronic
1007511350 6:42376477-42376499 CCAGAAGGGCAGAGGGGAGAGGG + Intronic
1007575905 6:42925188-42925210 CCAGGAGAGAACGGCGGAGAGGG - Intronic
1008045786 6:46849901-46849923 GAAGAAGAAAAGAGGGGAGATGG - Intergenic
1008378821 6:50820452-50820474 GGAGGAGATAAGAGAGGAGAGGG + Intronic
1008487451 6:52051529-52051551 GGCGGAGACAAGAGGGAAGATGG - Intronic
1010077902 6:71822297-71822319 CCAGGAGAAAACAGGGCAGAGGG + Intergenic
1010357556 6:74951857-74951879 CCAGGAGAGAATAGGAAAGAGGG - Intergenic
1010487408 6:76432132-76432154 GCACGAGACAAGATGAGAGAGGG + Intergenic
1011124015 6:83986995-83987017 CCAGGTGAGATGAGGGCAGATGG - Intergenic
1011775201 6:90722154-90722176 CCAGCAGAGAGGAGAGGAGAGGG + Intergenic
1013487071 6:110607327-110607349 CCCCGAGGGAAGAGGGGAGAGGG + Intergenic
1013636526 6:112034173-112034195 CCAGGAAACTAAAGGGGACAGGG - Intergenic
1014166790 6:118233930-118233952 CCAGTTGACAATAGGAGAGAAGG - Intronic
1014242430 6:119032594-119032616 GCAGGAGAAGAGGGGGGAGAGGG + Intronic
1014492116 6:122075497-122075519 CCAGGAGAAAGGTGGGAAGAAGG + Intergenic
1014949915 6:127542346-127542368 CCAGGAGACATGAGAGGAAGAGG + Intronic
1015189849 6:130460705-130460727 ACAGGAGAGAAGAGGAGAAAGGG + Intergenic
1016277835 6:142375414-142375436 TCAGGAGAAATGATGGGAGAGGG + Intronic
1016393222 6:143595878-143595900 TCAGTAGACAGGAAGGGAGAAGG - Intronic
1016841856 6:148533238-148533260 GCAGGAGCCAGGTGGGGAGAGGG - Intronic
1018847783 6:167567174-167567196 ACAGGGGACAGGAGGGAAGATGG + Intergenic
1018869531 6:167770488-167770510 CAAGGAGAAAGGAGGGGGGAAGG - Intergenic
1019029156 6:168995410-168995432 CCAGGAGAGGTGAGGTGAGATGG - Intergenic
1019029163 6:168995445-168995467 CCAGGAGAGGTGAGGTGAGATGG - Intergenic
1019081049 6:169429992-169430014 CCAGGAGACATGAGGGGCCTTGG - Intergenic
1019267355 7:125297-125319 CCAGGAGCCTGGAGGGGAGCAGG - Intergenic
1019484889 7:1284915-1284937 CCAGGGGACAAGCAGGGAGAAGG + Intergenic
1019521644 7:1463395-1463417 GGAGGAGACAGGAGGGGAGGAGG + Intergenic
1019775498 7:2909833-2909855 CCAGGGGACAAGAGCTGGGAGGG - Intronic
1019862293 7:3670645-3670667 CCCAGAGACAAGAAGGGAGGTGG - Intronic
1021316585 7:19155744-19155766 ACGGGAGACAAGGAGGGAGAGGG + Intergenic
1021367820 7:19803115-19803137 ACAGGAAATAAGAAGGGAGAAGG - Intergenic
1021444690 7:20719701-20719723 GCAGGAGACATGAGAGCAGATGG + Intronic
1022099180 7:27158907-27158929 ACAGAGGGCAAGAGGGGAGAAGG - Intergenic
1024197206 7:47071083-47071105 CAGGGAAACAAGAGAGGAGAGGG + Intergenic
1024291420 7:47807363-47807385 ACAGGAGCCAAGGGGTGAGAGGG + Intronic
1024883111 7:54111848-54111870 CCAGGAGATTACAGGGAAGATGG + Intergenic
1025163541 7:56688558-56688580 CCTGCAGACAAGAGGCGAGTTGG + Intergenic
1025240923 7:57273005-57273027 CCTGCAGACAAGAGGGGAGTTGG - Intergenic
1025256675 7:57388660-57388682 GCAGGAGGCCAGAGGGGAGCAGG - Intergenic
1025996336 7:66529778-66529800 CCAGGAAATAAGACGGGAGCAGG + Intergenic
1026132993 7:67635724-67635746 ACAGGAGGGAAGAGGAGAGAAGG - Intergenic
1026826872 7:73587907-73587929 TGGGGAGCCAAGAGGGGAGAGGG + Intergenic
1026834848 7:73631806-73631828 ACTGGAGAGAAGAGAGGAGAAGG - Intergenic
1026948021 7:74328437-74328459 CCAGGGGATGAGAGGGGAGTTGG + Intronic
1026979409 7:74517853-74517875 CCAGGTGCCCAGAGTGGAGAGGG + Intronic
1026988348 7:74568995-74569017 CCAGGAAATAAGACGGGAGCAGG + Intronic
1027434319 7:78148577-78148599 CTAGGAGACAGGAGGTGAGCAGG + Intronic
1027890858 7:83972561-83972583 CCAAGAGATATGATGGGAGATGG + Intronic
1028283504 7:88964510-88964532 CCAGGAGTCAGGAGGAAAGATGG + Intronic
1028842103 7:95439811-95439833 CTGGGAGAAAAGAGGGGAGCAGG + Intergenic
1029078937 7:97957076-97957098 CTAAGAGCCAGGAGGGGAGAGGG + Intergenic
1029516384 7:101026079-101026101 ATAGGAGACAAGGGGAGAGAAGG - Intronic
1030146210 7:106358780-106358802 CCAGGAACCAAGAGGGGTGATGG - Intergenic
1030196523 7:106858684-106858706 AAAGGAGGCAAGAGGGGAGGAGG + Intergenic
1031512604 7:122668547-122668569 CTAGCAGTCAAGAGAGGAGACGG + Intronic
1032189226 7:129753878-129753900 CCAGAAGACAGGATAGGAGAGGG + Intronic
1032196724 7:129793718-129793740 CCAGGGGACATGAGGGGACCAGG + Intergenic
1032267852 7:130381176-130381198 GCAGGTCAGAAGAGGGGAGAAGG + Exonic
1033017533 7:137687110-137687132 CCAAGAGTCAAGTGGGGAAAGGG + Intronic
1033568610 7:142604739-142604761 GCAGGAGACTAGAGAGAAGAGGG - Intergenic
1033740846 7:144274702-144274724 CCAGGGCACAAGAGGGGAAGGGG - Intergenic
1033753060 7:144374911-144374933 CCAGGGCACAAGAGGGGAAGGGG + Intronic
1034475401 7:151278678-151278700 CCAGGGGACAGGAAGGGGGAAGG - Intergenic
1034532050 7:151701888-151701910 CCAGGAGGCAGGTGGGGAGCAGG + Intronic
1034549010 7:151808634-151808656 TCAGGAGACAGTAGGGGAGATGG + Intronic
1035339586 7:158151658-158151680 AAAGGAAACAAGAGGGAAGAAGG - Intronic
1035366445 7:158351868-158351890 CGAGCAGACAGGAGGGGAGCTGG - Intronic
1035371579 7:158382416-158382438 TGAGGAGAGAAGAGGGGAGTGGG - Intronic
1036638182 8:10565503-10565525 CCAGAAGACAGGAGGTGAGAGGG - Intergenic
1036659094 8:10696244-10696266 GGAGGAGAGAAGTGGGGAGATGG + Intronic
1036761021 8:11508617-11508639 CCAGGAGACCCGAAGGCAGAGGG - Intronic
1037243791 8:16807473-16807495 CCAGGTGACAGGCGGGGAGTAGG - Intergenic
1037490828 8:19395620-19395642 CCAGGGGACAAGAGGCAAGTTGG + Exonic
1037603141 8:20415714-20415736 CCAGGTGGTAAGAAGGGAGAGGG + Intergenic
1037794285 8:21978841-21978863 GCAGGAGATTAGAGGGCAGAGGG - Intronic
1037864201 8:22430056-22430078 GCAGCAGACATGAGGGAAGAAGG + Intronic
1037886550 8:22599118-22599140 GGAGGAGAGGAGAGGGGAGAGGG - Intronic
1038700126 8:29842179-29842201 CCAGGACGCAGGAGGGGAGTGGG - Intergenic
1039842910 8:41306666-41306688 CAAAGAGAAAAGTGGGGAGAGGG - Intronic
1040288922 8:46114408-46114430 ACAGGGGAGAAGAGGCGAGATGG - Intergenic
1041119703 8:54573903-54573925 TCAGGAATCAAGAGGGGAGCAGG + Intergenic
1041278261 8:56186116-56186138 GCAGGAGACAAGAAGGGTGAAGG + Intronic
1042213258 8:66402886-66402908 ACAGGAGCCAGGAGGGGAGAGGG + Intergenic
1044117730 8:88354982-88355004 GCAGAAGACAAAAGGGGAGGAGG + Intergenic
1044130446 8:88517216-88517238 TCAGAAGAAAATAGGGGAGAGGG - Intergenic
1044818971 8:96143386-96143408 CCAGGAGCCAGGAGTGGGGAAGG - Exonic
1044972153 8:97630214-97630236 CCAGGCAGCAAGATGGGAGAAGG - Intergenic
1045023476 8:98064376-98064398 CCAGGAGACAGGAGGGGAGACGG - Exonic
1045049165 8:98307107-98307129 AGAGGAGAGGAGAGGGGAGAGGG - Intergenic
1045326694 8:101122697-101122719 ACAGGAGACAGGAGAGGAAAAGG + Intergenic
1045799917 8:106090283-106090305 GGAGGCTACAAGAGGGGAGAGGG - Intergenic
1047552891 8:125895859-125895881 AGAGGAGACAGGAGGGAAGAAGG - Intergenic
1047610811 8:126518973-126518995 CCAGCTGAGCAGAGGGGAGAAGG + Intergenic
1048301999 8:133258619-133258641 CCAGGAGGGAAGTGAGGAGAAGG - Intronic
1048498118 8:134952203-134952225 CCAGGGGACAGGATGGCAGAAGG - Intergenic
1048523009 8:135174354-135174376 CAAGGAGACAAGAGTAGAAATGG + Intergenic
1049041422 8:140114804-140114826 CCAAGAGACAAGAGGAGGGAGGG + Intronic
1049181546 8:141225695-141225717 CCGGGAGACAAGAAGGCACAGGG + Intronic
1049229337 8:141473995-141474017 CCAGGAACCAGGAGGGGTGAGGG - Intergenic
1049279719 8:141738112-141738134 CCAGGAGCCCCGGGGGGAGATGG + Intergenic
1049279737 8:141738171-141738193 CCAGGAGCCCCGGGGGGAGACGG + Intergenic
1049312674 8:141941686-141941708 GAAGGAGAAAAGAGGAGAGAAGG + Intergenic
1049337099 8:142092388-142092410 CCAGGAGGCTAGAGGGCAGTGGG - Intergenic
1049463400 8:142740251-142740273 CCAGGAGACACCAGGGGACTGGG + Intergenic
1049568371 8:143355481-143355503 GCAGGAGAGAAGAGAGCAGAGGG + Intronic
1049582207 8:143417966-143417988 TCTGGAGAGAAGAGGGAAGAGGG + Intergenic
1049762102 8:144336413-144336435 AGAGGAGAGAAGAGGAGAGAAGG - Intergenic
1049849435 8:144822937-144822959 CCAGGGGTCCTGAGGGGAGATGG - Intergenic
1049956337 9:696402-696424 TTAGGAAACAAGAGGGAAGAAGG + Intronic
1050089212 9:1999996-2000018 CCATGAGACAGTAGGTGAGAAGG + Intergenic
1050203674 9:3175812-3175834 CCAGGAAGCAAGAGTGGAGGGGG - Intergenic
1051047751 9:12895506-12895528 CATGGAGACAAGAGAGTAGAAGG + Intergenic
1051358814 9:16264172-16264194 CCAGAAGCCAAGAGCAGAGATGG - Intronic
1051382558 9:16473010-16473032 ACAGGAGACAACAGTGGAAAAGG + Intronic
1051422667 9:16904172-16904194 CCAGGAGCCAACAAGGGGGAAGG + Intergenic
1052607120 9:30718830-30718852 CCAGGAGAGAAGAGAGAAAATGG - Intergenic
1053152950 9:35754485-35754507 CAAGGAGGCAGGAGGGGCGAGGG + Exonic
1053161647 9:35817650-35817672 GCAGGAGACAAGAAGAGAAAGGG - Exonic
1053651739 9:40176509-40176531 GAAGAAGAAAAGAGGGGAGATGG + Intergenic
1053902129 9:42805831-42805853 GAAGAAGAAAAGAGGGGAGATGG + Intergenic
1054532846 9:66199693-66199715 GAAGAAGAAAAGAGGGGAGATGG - Intergenic
1055296178 9:74836125-74836147 CCAGGAGCTGAGGGGGGAGAGGG - Intronic
1057076800 9:92142181-92142203 TGAGGAGACAAGAGTGGATAAGG - Intergenic
1058205483 9:102100670-102100692 CTAGTGGCCAAGAGGGGAGATGG - Intergenic
1059356068 9:113700403-113700425 CCAGGTGATAACAAGGGAGAAGG + Intergenic
1059429885 9:114243580-114243602 CCTGGGGACAAGAGGAAAGAGGG + Intronic
1059901271 9:118928821-118928843 CCAGGAGGGAAGAGAGAAGAGGG + Intergenic
1060067215 9:120513234-120513256 CCAGGAAACAAGATGGGAAAAGG - Intronic
1060496688 9:124124697-124124719 CCAGGAGAAAGGAGGCCAGAGGG - Intergenic
1061179306 9:129014379-129014401 CCAGGAGGCCAGCGGGGAGCGGG + Intronic
1061736397 9:132663087-132663109 CAAGGAGAAAAGAGGGGTGGGGG + Intronic
1061902135 9:133678363-133678385 GCGGGAGACAAGAGGGGATGAGG - Intronic
1062196052 9:135274826-135274848 CCAGCAGGCAGGAGGAGAGAGGG - Intergenic
1062271889 9:135713651-135713673 GCAGGAGAGCAGAGGGGGGATGG - Intronic
1062464649 9:136675670-136675692 CTGGGAGAGCAGAGGGGAGACGG - Intronic
1062616373 9:137398364-137398386 ACAGGGGACAAGAGGGAAGGGGG - Intronic
1185545383 X:939570-939592 AGAGGAGACAAGAGGGGAAGGGG - Intergenic
1185623899 X:1469171-1469193 CGAAAAGAAAAGAGGGGAGAGGG - Intronic
1185799979 X:3001657-3001679 CCAGGCCACTTGAGGGGAGAAGG - Intergenic
1186381773 X:9068224-9068246 GCAGGAAACAAGAGCTGAGAAGG + Intronic
1186428382 X:9483570-9483592 CCAGGCGAGAAGATGGGAGGAGG - Intronic
1186455664 X:9708123-9708145 CCAGGAGAAATGAGGGGACATGG - Intronic
1187358543 X:18602091-18602113 TCACAAGACAAGAGGAGAGAGGG - Intronic
1188048171 X:25451970-25451992 GCAGGATATAAGAGGAGAGAAGG + Intergenic
1188370004 X:29358187-29358209 ATAGGAGACAAGAGGGCAGGAGG + Intronic
1188623947 X:32261165-32261187 CCAGGAGAAAAGAGAGCTGAAGG - Intronic
1189104890 X:38225290-38225312 CCAGGAGACAAGGAAGGAAAAGG + Intronic
1190938808 X:55020509-55020531 CCAGGAGAAAACAGGAGAAAAGG + Intronic
1192929011 X:75785056-75785078 CCAGGAGACAGGAGCGGGAACGG + Exonic
1193600295 X:83502400-83502422 CCAGGAGGAAAGAGTAGAGAAGG - Intergenic
1195709449 X:107762295-107762317 CCAGGAGACAAGAGAGCTGAAGG + Intronic
1196237426 X:113299722-113299744 CGAGGAGAGAGGAGAGGAGAGGG - Intergenic
1197757114 X:130003089-130003111 CCAGGAGACCAGTGTGGAGGTGG - Intronic
1200057965 X:153471376-153471398 CCAGGAGCCGTGAGGGGAGCAGG - Intronic
1200308567 X:155053986-155054008 CCAGGAGGGTAGAGGGGAGGTGG + Intronic
1201239505 Y:11945116-11945138 CTAAGAGACAAAAGAGGAGATGG + Intergenic
1202379265 Y:24261512-24261534 AGAGGAGAGGAGAGGGGAGAGGG - Intergenic
1202491517 Y:25408609-25408631 AGAGGAGAGGAGAGGGGAGAGGG + Intergenic