ID: 1102454352

View in Genome Browser
Species Human (GRCh38)
Location 12:113062729-113062751
Sequence TTCCGCTGGCTGCACTGCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 336}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102454352_1102454358 0 Left 1102454352 12:113062729-113062751 CCCGTGCAGTGCAGCCAGCGGAA 0: 1
1: 0
2: 1
3: 11
4: 336
Right 1102454358 12:113062752-113062774 GAAAGCCCCGGTGTCAGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 124
1102454352_1102454356 -5 Left 1102454352 12:113062729-113062751 CCCGTGCAGTGCAGCCAGCGGAA 0: 1
1: 0
2: 1
3: 11
4: 336
Right 1102454356 12:113062747-113062769 CGGAAGAAAGCCCCGGTGTCAGG 0: 1
1: 0
2: 0
3: 6
4: 116
1102454352_1102454364 9 Left 1102454352 12:113062729-113062751 CCCGTGCAGTGCAGCCAGCGGAA 0: 1
1: 0
2: 1
3: 11
4: 336
Right 1102454364 12:113062761-113062783 GGTGTCAGGCTGGGGCCACAGGG 0: 1
1: 0
2: 6
3: 28
4: 355
1102454352_1102454366 20 Left 1102454352 12:113062729-113062751 CCCGTGCAGTGCAGCCAGCGGAA 0: 1
1: 0
2: 1
3: 11
4: 336
Right 1102454366 12:113062772-113062794 GGGGCCACAGGGGAGAAGCCAGG 0: 1
1: 1
2: 4
3: 58
4: 554
1102454352_1102454368 26 Left 1102454352 12:113062729-113062751 CCCGTGCAGTGCAGCCAGCGGAA 0: 1
1: 0
2: 1
3: 11
4: 336
Right 1102454368 12:113062778-113062800 ACAGGGGAGAAGCCAGGCTCTGG 0: 1
1: 0
2: 7
3: 51
4: 472
1102454352_1102454365 10 Left 1102454352 12:113062729-113062751 CCCGTGCAGTGCAGCCAGCGGAA 0: 1
1: 0
2: 1
3: 11
4: 336
Right 1102454365 12:113062762-113062784 GTGTCAGGCTGGGGCCACAGGGG 0: 1
1: 0
2: 3
3: 40
4: 349
1102454352_1102454357 -1 Left 1102454352 12:113062729-113062751 CCCGTGCAGTGCAGCCAGCGGAA 0: 1
1: 0
2: 1
3: 11
4: 336
Right 1102454357 12:113062751-113062773 AGAAAGCCCCGGTGTCAGGCTGG 0: 1
1: 0
2: 1
3: 14
4: 182
1102454352_1102454363 8 Left 1102454352 12:113062729-113062751 CCCGTGCAGTGCAGCCAGCGGAA 0: 1
1: 0
2: 1
3: 11
4: 336
Right 1102454363 12:113062760-113062782 CGGTGTCAGGCTGGGGCCACAGG 0: 1
1: 0
2: 1
3: 19
4: 275
1102454352_1102454359 1 Left 1102454352 12:113062729-113062751 CCCGTGCAGTGCAGCCAGCGGAA 0: 1
1: 0
2: 1
3: 11
4: 336
Right 1102454359 12:113062753-113062775 AAAGCCCCGGTGTCAGGCTGGGG 0: 1
1: 1
2: 1
3: 12
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102454352 Original CRISPR TTCCGCTGGCTGCACTGCAC GGG (reversed) Intronic
901042897 1:6376214-6376236 TTCCTCAGGCTGGAGTGCACTGG - Intronic
901357372 1:8662810-8662832 TGCCGCTTGCTGCACTGCCTTGG + Intronic
901587210 1:10306715-10306737 TTGTCCTGGCTGCAGTGCACTGG - Intronic
901607313 1:10469558-10469580 TTACCCAGGCTGCAGTGCACTGG + Intronic
901614754 1:10529772-10529794 TTCCGCTGGTAGAAGTGCACAGG - Intronic
901934643 1:12619005-12619027 AGACGCTGGCTGCACAGCACAGG - Intergenic
902007275 1:13242474-13242496 TTGCGCTGGCTGCAGGGCAATGG + Intergenic
907428539 1:54396882-54396904 TTAAGGTGGCTGCACTGCTCGGG + Intronic
908856427 1:68434805-68434827 TTCCTCAGGCTGGACTGCAATGG + Intronic
909312750 1:74174420-74174442 TTGCCCAGGCTGCACTGCAATGG + Intronic
909545825 1:76845365-76845387 TTCAGCTGCCTGCATTGCAGAGG + Intergenic
910507669 1:87968613-87968635 TACAGCTGGCTCCACTGGACTGG + Intergenic
910802852 1:91162795-91162817 TTGCCCTGTCTGCAGTGCACTGG + Intergenic
911750814 1:101495726-101495748 TTGCCCTGGCTGCAGTGCAGTGG + Intergenic
912487898 1:110043568-110043590 CTCCTCTGGCTGCACTTCCCTGG + Intronic
914092264 1:144512248-144512270 TTCCGCAGGCTGGAGTGCAGTGG + Intergenic
915372058 1:155359613-155359635 TTCCACAGGCTGCAGTGCATTGG + Intronic
915385393 1:155487123-155487145 TTGCCCTGGCTGGACTGCAATGG - Intronic
915839964 1:159205701-159205723 TTCCGCTGGCAGCTCTGCCCTGG + Exonic
918867886 1:189926526-189926548 TCCCCCTGGCTGGACTGCAGCGG - Intergenic
919906569 1:202082552-202082574 TTCCCCAGGCTGCAGTGCAGTGG + Intergenic
920492224 1:206425572-206425594 TTGCGCAGGCTGGACTGCAGTGG + Intronic
921135895 1:212258708-212258730 TTGCCCAGGCTGCACTGCAATGG - Intergenic
921687117 1:218102992-218103014 TTGCCCTGGCTGGAATGCACTGG + Intergenic
922669343 1:227497077-227497099 TTGCCCAGGCTGCACTGCAGTGG + Intergenic
922670249 1:227504225-227504247 TTGCCCAGGCTGCACTGCAGTGG - Intergenic
922927139 1:229358988-229359010 TTCCACTGGCAGCACTAGACAGG - Intergenic
923207631 1:231774212-231774234 TTGCCCTGGCTGGACTGCAGTGG - Intronic
923303381 1:232664140-232664162 TTACCCTGGCTGGAATGCACTGG - Intergenic
923309449 1:232721655-232721677 TTGCCCTGGCTGCAGTGCAGTGG - Intergenic
923589220 1:235303687-235303709 TTCTGCAGGCTGCAGTGCAATGG - Intronic
923610291 1:235486049-235486071 TTGCCCAGGCTGCACTGCAGTGG - Intronic
1063071395 10:2670092-2670114 TTCCACTGGCTGCAAATCACAGG - Intergenic
1063180300 10:3592159-3592181 TTCACCTGGCTGCAATGCTCAGG - Intergenic
1064034274 10:11902633-11902655 TTCCACCGGCAGCACTGTACCGG + Intergenic
1064072927 10:12246028-12246050 TTGCCCAGGCTGCAGTGCACTGG - Intronic
1065619091 10:27560572-27560594 TTGCCCTGGCTGGACTGCAATGG - Intergenic
1066404126 10:35103180-35103202 TTGCCCAGGCTGCACTGCAGTGG + Intergenic
1068759237 10:60689357-60689379 TTGCTCAGGCTGCACTGCAGTGG - Intronic
1069008529 10:63345446-63345468 TTCCCCAGGCTGCAGTGCAATGG - Intronic
1069646148 10:69999254-69999276 TTCCCCAGGCTGGAATGCACTGG - Intergenic
1069934182 10:71903979-71904001 TTCCCCAGGCTGCAGTGCAATGG + Intergenic
1070199059 10:74185795-74185817 TCGCCCAGGCTGCACTGCACTGG - Intronic
1070792009 10:79195238-79195260 TTTCGCTGTCTGCAAAGCACAGG - Intronic
1071349244 10:84722960-84722982 TTCCTCTGGCTGGAGTGCAATGG - Intergenic
1071789491 10:88939225-88939247 TTCCGCTGTCTCCAAAGCACAGG + Intronic
1072536617 10:96369166-96369188 CTCCCCTGGCTGCACCGCACTGG - Intronic
1075328830 10:121557346-121557368 TTGCCCAGGCTGCACTGCAGTGG + Intronic
1076156535 10:128210036-128210058 TTCCGCAGGCAGCACGGGACAGG - Intergenic
1076307204 10:129473875-129473897 TTCCTCTGGCCCCACTGCCCTGG - Intronic
1077001981 11:328056-328078 TTCCACTGGCGGCATTGCAGGGG + Intergenic
1077512220 11:2973806-2973828 TTGCCCAGGCTGCAGTGCACTGG + Intronic
1081319674 11:41675764-41675786 TTGCCCAGGCTGAACTGCACTGG - Intergenic
1082263684 11:50097255-50097277 TTCCTCTGGCTTCAGTGAACAGG + Intergenic
1083868338 11:65471034-65471056 TTGCCCAGGCTGGACTGCACTGG + Intergenic
1084049783 11:66592204-66592226 TTCCACTGGCTGCCCTCCATAGG - Exonic
1084686699 11:70700361-70700383 TGCCCCTGGCTGCACTGGAGGGG - Intronic
1084984143 11:72852622-72852644 TTGCCCAGGCTGCAATGCACTGG - Intronic
1089107606 11:116026209-116026231 TTCCACTGACAGCACTACACAGG + Intergenic
1090058774 11:123445777-123445799 TTCCCCAGGCTGAAGTGCACTGG - Intergenic
1092209287 12:6635944-6635966 TTCCGCTGCCTGCTCTGGGCTGG + Exonic
1092343570 12:7696953-7696975 TTGCCCTGGCTGCAGTGCAATGG + Intergenic
1093032910 12:14305234-14305256 TTGCGCTGGCTGGACTGCAGTGG - Intergenic
1093530997 12:20163622-20163644 TTCAGCTGCCTGACCTGCACAGG + Intergenic
1094244094 12:28268101-28268123 TTGCCCAGGCTGCAGTGCACTGG + Intronic
1095544601 12:43350641-43350663 TTGCCCTGGCTGCAGTGCAGTGG + Intergenic
1096051920 12:48617277-48617299 TTGCGCAGGCTGCAGTGCAGTGG - Intergenic
1097098914 12:56572247-56572269 TTCCCCAGGCTGCAGTGCAGTGG - Intronic
1098685018 12:73409078-73409100 TTGCCCAGGCTGCAGTGCACTGG + Intergenic
1100832586 12:98530295-98530317 TTGCCCAGGCTGCACTGCAGTGG - Intronic
1102139366 12:110601910-110601932 TTGCCCTGGCTGCAGTGCAGTGG - Intergenic
1102454352 12:113062729-113062751 TTCCGCTGGCTGCACTGCACGGG - Intronic
1102476830 12:113194196-113194218 TTGCTCAGGCTGCAGTGCACTGG - Intergenic
1102510642 12:113413079-113413101 TTCCCCAGGCTGCAGTGCAGTGG - Intronic
1102523871 12:113497085-113497107 TTGCCCTGGCTGGACTGCAGTGG + Intergenic
1102916501 12:116757898-116757920 TTCCACTGGCAGCACTAGACAGG - Intronic
1103049975 12:117770600-117770622 ATCTGGTGGCTGCACTCCACAGG - Intronic
1103534116 12:121623030-121623052 TTCCCCAGGCTGCAGTGCAGTGG - Intergenic
1104469749 12:129020040-129020062 TTCCCCAGGCTGGAGTGCACTGG + Intergenic
1104835728 12:131789018-131789040 TTGCGCTGGCTGGAGTGCAGTGG + Intronic
1104879540 12:132060872-132060894 TTGCCCAGGCTGCACTGCAATGG - Intronic
1105360548 13:19710875-19710897 TTGCCCTGGCTGCAGTGCAGTGG + Intronic
1105784997 13:23739726-23739748 TTCTGCTTGCTGCCGTGCACAGG - Intronic
1106678239 13:31984318-31984340 TTGCCCAGGCTGCACTGCAGTGG - Intergenic
1107045536 13:35988345-35988367 AGCAGCTGGCTGCACAGCACTGG - Intronic
1107202397 13:37737510-37737532 TTCCGCAGGCTGGAATGCACTGG + Intronic
1109820502 13:67646302-67646324 ATTTGCTGGCTTCACTGCACAGG + Intergenic
1111148690 13:84218979-84219001 CTCCACTGACTGCACTGGACAGG + Intergenic
1113365289 13:109670115-109670137 TGCAGCTGGCTGCTCTGCTCAGG - Intergenic
1117196304 14:53343029-53343051 TGCCACTGGCTGGACTGCAGAGG + Intergenic
1118800199 14:69182721-69182743 TTGCCCTGGCTGCAGTGCAGTGG + Intergenic
1119663717 14:76469131-76469153 TTGCCCTGGCTGGACTGCAGTGG + Intronic
1119674673 14:76544824-76544846 TTGCCCTGGCTGGACTGCAGTGG - Intergenic
1120907061 14:89630036-89630058 TTCCCCAGGCTGGACTGCAGTGG + Intronic
1121503255 14:94456594-94456616 TTCCACTGACAGCACTACACAGG - Intergenic
1202841949 14_GL000009v2_random:129862-129884 TTGCTCTGGCTGCAGTGCAGTGG + Intergenic
1123810215 15:23917479-23917501 TTGCGCAGGCTGGAGTGCACTGG + Intergenic
1124097487 15:26662116-26662138 TTCCTTTGTATGCACTGCACAGG - Intronic
1124800996 15:32832736-32832758 TTCTGCTGGCTGGAGTGCAGTGG - Intronic
1124814852 15:32979514-32979536 TTGCGCAGGCTGCAGTGCAATGG - Intronic
1125558853 15:40610791-40610813 TTCCCCAGGCTGCAGTGCAATGG + Exonic
1125598743 15:40903957-40903979 TTAAACTGTCTGCACTGCACTGG + Exonic
1127255618 15:57290301-57290323 TTCCCCTGGCTGGAATGCAATGG - Intronic
1129265959 15:74393186-74393208 TCTCTCTGGCTGCACTGCAGAGG + Intergenic
1129680400 15:77655603-77655625 CTCCACTGGCTGCACACCACTGG + Intronic
1130321116 15:82842933-82842955 TTCCCCAGGCTGGAGTGCACCGG + Intronic
1130549242 15:84879319-84879341 GTCAGCTGGCTGGACTCCACGGG - Intergenic
1131354512 15:91733005-91733027 TTCCCCGTGCTGCACTGGACAGG + Intergenic
1132773080 16:1575509-1575531 TTGCCCAGGCTGCACTGCAGTGG - Intronic
1133997332 16:10758431-10758453 TTGCGCTGGCTGGACTGCACTGG - Intronic
1134171021 16:11969896-11969918 TTGCCCAGGCTGGACTGCACTGG + Intronic
1134204729 16:12227858-12227880 TTGCCCAGGCTGCAGTGCACTGG - Intronic
1134389442 16:13805634-13805656 TTCCCCACGCTGCAGTGCACTGG - Intergenic
1135317881 16:21466161-21466183 TTCCCCTGGCTGGAGTGCAGCGG - Intergenic
1135370775 16:21897956-21897978 TTCCCCTGGCTGGAGTGCAGCGG - Intergenic
1135441010 16:22472757-22472779 TTCCCCTGGCTGGAGTGCAGCGG + Intergenic
1135526773 16:23219194-23219216 TTCCCCGGGCTGCAGTGCAGTGG - Intergenic
1135908551 16:26538267-26538289 TTGCCCAGGCTGCAGTGCACTGG + Intergenic
1136249598 16:28995554-28995576 TTGCCCAGGCTGCACTGCAGTGG - Intergenic
1136314650 16:29445842-29445864 TTCCCCTGGCTGGAGTGCAGCGG - Intronic
1136328093 16:29547606-29547628 TTCCCCTGGCTGGAGTGCAGCGG - Intergenic
1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG + Intronic
1136442777 16:30287611-30287633 TTCCCCTGGCTGGAGTGCAGCGG - Intergenic
1137423265 16:48354245-48354267 TTACCCAGGCTGCACTGCAGTGG + Exonic
1137441976 16:48505622-48505644 TTCCCCAGGCTGGACTGCAGTGG - Intergenic
1138281024 16:55772410-55772432 ACCAGCTGGCTGCCCTGCACTGG + Intergenic
1139340451 16:66264772-66264794 TCCCGCTGGCTGTCCTGCCCGGG - Intergenic
1139619680 16:68127646-68127668 TTCCCCAGGCTGGACTGCAGTGG - Intronic
1139837491 16:69851048-69851070 TTCCACTGGCTGGAGTGCAGTGG + Intronic
1139889521 16:70240095-70240117 TTCCCCTGGCTGGAGTGCAGCGG - Intergenic
1140291686 16:73665251-73665273 TTGCGCAGGCTGGAGTGCACTGG + Intergenic
1140777628 16:78264583-78264605 TTCCTCTTGCAGCACTGCAGAGG + Intronic
1146046248 17:29510335-29510357 TTACCCTGGCTGCAGTGCAGTGG - Intronic
1146277004 17:31522529-31522551 CTGCCCTGGCTGCACTGCCCTGG - Intronic
1146725569 17:35152994-35153016 TTCTGCTGGCTGGATGGCACTGG - Intronic
1146986964 17:37229341-37229363 TTCCGCAGGCTGGAGTGCAGTGG + Intronic
1147161580 17:38572154-38572176 ATCCCCTGGCTGTGCTGCACCGG + Intronic
1147615834 17:41826958-41826980 TTCCGCAGGCTACAGTGCAGTGG - Intronic
1147787447 17:42989672-42989694 TTCCCCTGGCTGGAGTGCAGTGG + Intronic
1148036367 17:44664320-44664342 TTCCCCAGGCTGCAGTGCAATGG - Intronic
1148247973 17:46047945-46047967 TTCCCCAGGCTGCAGTGCATTGG + Intronic
1149834146 17:59897129-59897151 TTCAGCAGGCTTCATTGCACAGG + Intronic
1150051203 17:61964894-61964916 TTGCGCAGGCTGTACTGCAGTGG - Intronic
1150424016 17:65062799-65062821 TTGCCCAGGCTGCAGTGCACTGG + Intergenic
1150606851 17:66699169-66699191 TTGCCCAGGCTGCAGTGCACTGG - Intronic
1150814157 17:68379278-68379300 TTGCCCTGGCTGCAGTGCAGTGG + Intronic
1151433308 17:74079582-74079604 CTGTGCTGGCTGCACTCCACTGG + Intergenic
1151652499 17:75478738-75478760 TTCCGCTGTTTTCACTGCTCAGG - Intronic
1151827972 17:76534214-76534236 TTGCCCAGGCTGCAGTGCACTGG + Intronic
1151845038 17:76647765-76647787 TTCACCAGGCTGCAGTGCACTGG + Intergenic
1151962112 17:77411043-77411065 TTGCCCAGGCTGGACTGCACTGG - Intronic
1152183191 17:78838054-78838076 TTGCCCAGGCTGGACTGCACTGG - Intronic
1152518190 17:80838403-80838425 TGCCCCCGGCCGCACTGCACGGG + Intronic
1152651478 17:81495748-81495770 TTCCCCAGGCTGCAGTGCAATGG - Intergenic
1153040503 18:809337-809359 TTGCCCAGGCTGCAATGCACTGG + Intronic
1153366821 18:4265725-4265747 TTGCTCAGGCTGCACTGCAATGG + Intronic
1153955055 18:10089037-10089059 TGCCCCTGGCTGTACTGCCCTGG + Intergenic
1154106777 18:11530626-11530648 TCCCGCTGGCTGCCTTGCATTGG - Intergenic
1154235686 18:12603612-12603634 TTCCCCAGGCTGCAGTGCAGTGG + Intronic
1155145845 18:23082732-23082754 TTCCCCTGGCTGGGGTGCACTGG - Intergenic
1155202829 18:23532471-23532493 TTCCTCAGGCTGCAGTGCAGTGG + Intronic
1155796649 18:30045772-30045794 TTTCGCTGGCTGGAGTGCCCTGG - Intergenic
1156011097 18:32498945-32498967 CTCCACTGGCAGCACTGGACAGG - Intergenic
1157671048 18:49529043-49529065 TTACCCAGGCTGCAGTGCACTGG + Intergenic
1161386368 19:3995881-3995903 TTACGCAGGCTGGAGTGCACTGG + Intergenic
1162689991 19:12421553-12421575 TTGCCCAGGCTGCAGTGCACTGG - Intronic
1162776083 19:12980406-12980428 TTGCGCTGGCTGGAGTGCAATGG + Intergenic
1163032948 19:14556238-14556260 TCCCTCTGCCTGGACTGCACTGG + Intronic
1164757408 19:30700425-30700447 TTGCCCAGGCTGCAGTGCACTGG + Intronic
1164837932 19:31370034-31370056 TTCCCCAGGCTGCAGTGCAGTGG - Intergenic
1164993653 19:32703386-32703408 TTCCCCAGGCTGCAGTGCAATGG + Intronic
1165248055 19:34509157-34509179 TTACCCTGGCTGGAGTGCACTGG - Exonic
1165425520 19:35743331-35743353 TTCCGCAGGCTGGAGTGCAAAGG - Intronic
1166769408 19:45271855-45271877 TTCGGCTGGCCTCACTGCAGAGG - Intronic
925346644 2:3176483-3176505 TTCCGCTGCCACCACTGCCCTGG - Intergenic
926170091 2:10547694-10547716 ATCTGCTGTCTGCACTGCACTGG - Intergenic
927645786 2:24876030-24876052 TTGCCCAGGCTGCACTGCAGTGG + Intronic
928573282 2:32629159-32629181 TTGCTCTGGCTGGAGTGCACTGG + Intronic
929479497 2:42290690-42290712 TTCCCCTGGCTGCAGTGCAGTGG - Intronic
930133027 2:47872362-47872384 TTGCACAGGCTGCACTGCAATGG + Intronic
931317282 2:61144602-61144624 TTCCCCAGGCTGCAGTGCAGTGG - Intergenic
933826999 2:86171266-86171288 TTCCTCAGGCTGAACTGCAGGGG + Exonic
935176547 2:100654161-100654183 TTGCCCTGGCTGCAGTGCAATGG + Intergenic
935835718 2:107050965-107050987 TTGCCCTGGCTGCAGTGCAGTGG + Intergenic
936075647 2:109399986-109400008 TCCCTCTGGCTGCCCTGGACAGG + Intronic
937744066 2:125389748-125389770 TTCCCCAGGCTGGAATGCACTGG - Intergenic
937909143 2:127067029-127067051 TTCCCCTGGCTGGAGTGCAGTGG - Intronic
938008193 2:127806245-127806267 TTGCCCTGGCTGCAGTGCAGTGG + Intronic
938174449 2:129111824-129111846 TTGCCCTGGCTGCAGTGCAGTGG - Intergenic
938776839 2:134549385-134549407 TTGCCCAGGCTGCACTGCAGTGG + Intronic
940884219 2:158974770-158974792 TTGCCCAGGCTGGACTGCACTGG + Intronic
942384630 2:175428813-175428835 TTCCCCAGGCTGGACTGCAATGG - Intergenic
944010587 2:194969861-194969883 TTGCGCAGGCTGAACTGCAGTGG + Intergenic
945591289 2:211734857-211734879 TTGCAGTGGCTGCACTGCAGGGG - Intronic
945972578 2:216245067-216245089 TTGCCCAGGCTGCAGTGCACTGG + Intergenic
947209218 2:227691570-227691592 TTCTCCAGGCTGAACTGCACTGG - Intronic
948781044 2:240322029-240322051 TTCCCCAGGCTGCAGTGCAGTGG - Intergenic
1168782690 20:507220-507242 TTGCCCTGGCTGCAGTGCAGTGG - Intronic
1169420680 20:5456751-5456773 TTGCCCTGGCTGCAGTGCAGTGG + Intergenic
1172114111 20:32563500-32563522 TTCCACTGCCTGCGCTGCTCAGG + Intronic
1172565670 20:35928397-35928419 TTGCCCTGGCTGGAGTGCACTGG - Intronic
1175382533 20:58573688-58573710 TTCCGCTGTCTGCACAAAACTGG + Intergenic
1178272873 21:31209351-31209373 TTCACCTGGCTGCCCTTCACGGG + Intronic
1178399625 21:32274244-32274266 TTGCCCAGGCTGCAGTGCACTGG + Intronic
1178533403 21:33393399-33393421 TTCTCCTGGCTGCAGTGCAATGG - Intergenic
1178968327 21:37146195-37146217 TTGCCCAGGCTGCACTGCAGTGG - Intronic
1179443247 21:41410878-41410900 TTCCACTGGCTGCCCTCCCCAGG - Intergenic
1180697990 22:17765966-17765988 TTCCGCAGGCCGGACTGCAGTGG + Intronic
1182230054 22:28831070-28831092 GTCCCCAGGCTGCACTGCAGTGG - Intergenic
1183449542 22:37884789-37884811 TTACCCAGGCTGCACTGCAGTGG - Intronic
1183454579 22:37915210-37915232 TTGCCCAGGCTGCAGTGCACTGG - Intronic
1183699477 22:39442519-39442541 TTCCGCAGGCTGGAGTGCAGTGG - Intergenic
1183902902 22:41019834-41019856 TGCCGCTGGGTGAACTACACAGG - Intergenic
1183985558 22:41568321-41568343 TCCCCCAGGCTGCACTGCAGAGG + Intronic
1184120352 22:42445904-42445926 TTCTGCTGGCTGGCCTGCAGTGG + Intergenic
1184525875 22:45022248-45022270 TTGCCCAGGCTGCACTGCAATGG + Intergenic
949170414 3:989749-989771 TTGCCCAGGCTGCACTGCACTGG - Intergenic
950804969 3:15593835-15593857 TTCCCCAGGCTGCAGTGCAATGG + Intronic
952349244 3:32518589-32518611 TTGTCCTGGCTGCACTGCAGTGG + Intergenic
953498743 3:43412447-43412469 CACCGTTGCCTGCACTGCACTGG + Intronic
953527686 3:43707666-43707688 TTGCCCTGGCTGCAGTGCAGTGG + Intronic
954312850 3:49783671-49783693 TTGCGCTGGCTGGAGTGCAGTGG - Intronic
954318892 3:49817471-49817493 TTGCCCAGGCTGCACTGCAGTGG - Intergenic
954648976 3:52148572-52148594 GCCCGCTGTCTGCACAGCACTGG + Intronic
954736049 3:52707207-52707229 TTGCCCAGGCTGCAGTGCACTGG + Intronic
955088875 3:55729796-55729818 TTACCCTGGCTGGACTGCAGTGG - Intronic
956152674 3:66259753-66259775 TCACTCTGGCTGCAATGCACAGG - Intronic
956506074 3:69941620-69941642 TTCCCTTGGCTGCAGTGTACTGG - Intronic
959065958 3:101657464-101657486 TTCCGCAGGCTGGAGTGCAGTGG - Intronic
959708915 3:109364999-109365021 TTGCGCAGGCTGCAGTGCAGTGG + Intergenic
960829580 3:121832365-121832387 TTACCCTGGCTGCAGTGCAGTGG + Intronic
961222796 3:125213011-125213033 TTCCGCTGGTTGCACTGTCGAGG - Intergenic
961623483 3:128243179-128243201 TGGTGCTGGCTGCGCTGCACGGG + Intronic
961717509 3:128868721-128868743 TTTCGCAGGCTGCAGTGCAATGG + Intergenic
963925222 3:150944201-150944223 TTCACCAGGCTCCACTGCACTGG - Intronic
967516956 3:190381137-190381159 TCTCGCTGTTTGCACTGCACCGG - Intronic
967576688 3:191103001-191103023 TTCCCCAGGCTGCAGTGCAGGGG - Intergenic
968016292 3:195337486-195337508 TTGCGCAGGCTGCAGTGCAATGG + Intronic
968584835 4:1411467-1411489 TGCCACTGGCTACACTGCATGGG + Intergenic
968902236 4:3437164-3437186 TGGGGCTGGCTGCCCTGCACAGG + Intronic
969276070 4:6136747-6136769 GTCAGCTGGCTGGACTGGACAGG - Intronic
970025446 4:11619103-11619125 TTCCCCAGGCTGCAGTGCAGTGG - Intergenic
970663103 4:18308104-18308126 CTCTGCTGGCTGTCCTGCACTGG - Intergenic
970848660 4:20574745-20574767 TTGCCCAGGCTGCAGTGCACTGG - Intronic
972548753 4:40107961-40107983 TTGCCCTGGCTGCAGTGCAGTGG + Intronic
974656590 4:64831629-64831651 TTCCACTGGCAGCAGTGCCCTGG + Intergenic
976157242 4:82159587-82159609 TTCCACTGACAGCACTACACAGG + Intergenic
982782971 4:159510459-159510481 TTCCCCAGGCTGCAGTGCAATGG + Intergenic
982947560 4:161644484-161644506 TTGCCCTGGCTGCAGTGCAATGG - Intronic
984348386 4:178560671-178560693 TTCCGCAGGCTGGAGTGCAGTGG - Intergenic
987027433 5:13941316-13941338 TTACCCTGGCTGGACTGCAGTGG - Intronic
987675451 5:21067568-21067590 TTCCCCAGGCTGCAGTGCAGTGG - Intergenic
989372586 5:40724591-40724613 TTCCCCAGGCTGGAGTGCACTGG - Intronic
991440278 5:66640345-66640367 TTGCCCAGGCTGCACTGCAGTGG + Intronic
994912599 5:105931625-105931647 TTGCCCTGGCTGCAGTGCAGTGG - Intergenic
997316615 5:132941965-132941987 TTCCCCGGGCTGGAGTGCACTGG - Intronic
998255828 5:140586868-140586890 TTGCGCAGGCTGCAGTGCAACGG - Intronic
999564824 5:152847199-152847221 TTACCCTGGCTGCAGTGCAGTGG + Intergenic
1001028502 5:168244537-168244559 TTCCTCTGGCTGCCCAGCAGCGG + Exonic
1003503091 6:6718508-6718530 TTGCCCTGGCTGCAGTGCAATGG + Intergenic
1004179199 6:13366218-13366240 TTCCCCAGGCTGCATTGCAGTGG + Intronic
1004287071 6:14330847-14330869 TTCCCCAGGCTGCAGTGCAGTGG - Intergenic
1005805229 6:29468326-29468348 TTCCTCTGGCTCCACAGCTCAGG + Intergenic
1006121991 6:31812859-31812881 TCACGCAGGCTGCACTGCAGTGG + Intronic
1006805769 6:36788068-36788090 TTCCCCAGGCTTCAGTGCACTGG + Intronic
1007766589 6:44164130-44164152 TTCCCCAGGCTGCAGTGCAGTGG - Intronic
1009342033 6:62567676-62567698 TTGCCCAGGCTGCACTGCAGTGG - Intergenic
1010113100 6:72265931-72265953 TACCACTGGATGCAATGCACTGG + Intronic
1010349819 6:74860091-74860113 TTGCCCTGGCTGGAGTGCACTGG + Intergenic
1010824541 6:80456173-80456195 TTCCTCTGGCTGGAGTGCAGTGG - Intergenic
1011586169 6:88927620-88927642 TTCCCCTGGCTGGAGTGCAATGG - Intronic
1011648960 6:89488186-89488208 TTCCTCTGGCAATACTGCACTGG - Intronic
1012521399 6:100125555-100125577 TTCCCCTGCCTCCAATGCACAGG - Intergenic
1013561998 6:111314889-111314911 TTCCCCAGGCTGGAGTGCACCGG + Intronic
1013848269 6:114481589-114481611 TTCACATTGCTGCACTGCACTGG - Intergenic
1014214100 6:118736425-118736447 TCCCCCAGGCTGGACTGCACTGG - Intergenic
1014314367 6:119844626-119844648 TTCTGCTCACAGCACTGCACTGG + Intergenic
1017957004 6:159187059-159187081 TGCCGCTGGCTCCTCTGCTCAGG + Intronic
1019561172 7:1658526-1658548 TTCCCCTGGCTGGAGTGCAGTGG - Intergenic
1019736374 7:2651651-2651673 CCACGCTGGCTTCACTGCACAGG + Intronic
1019809703 7:3156280-3156302 TTCCCCTGGCTGGAGTGCAGTGG - Intronic
1020078037 7:5271449-5271471 TTTCCCTGGCTGGACTGCAGTGG - Intergenic
1021343306 7:19490311-19490333 TTCTGCTGGTTCCACTGCCCTGG + Intergenic
1021508537 7:21410880-21410902 TTCCTCTAGGAGCACTGCACTGG - Intergenic
1021684512 7:23170172-23170194 TTGCCCTGGCTGCAGTGCAATGG - Intronic
1021688982 7:23214068-23214090 TTCCTCTGGTAGCACTGCGCTGG - Intergenic
1023115162 7:36855307-36855329 TTCCCATGGCTGCAGTCCACTGG - Exonic
1023701491 7:42895668-42895690 TTCCACTGACAGCACTGGACAGG + Intergenic
1024946943 7:54818036-54818058 CTCCTCTGACAGCACTGCACAGG - Intergenic
1025980341 7:66400076-66400098 TTCCTCTGGCTTCAGTGAACAGG + Intronic
1026191631 7:68133711-68133733 TTCCTCTGGCTGGAGTGCAGTGG - Intergenic
1026334290 7:69380552-69380574 TTGCCCAGGCTGCAATGCACTGG + Intergenic
1026711528 7:72745062-72745084 TTCCTCAGGCTGCAGTGCAGTGG + Intronic
1027057385 7:75059300-75059322 TTCCTCTGGCTGCAGCGCAGTGG + Intronic
1027166397 7:75837447-75837469 TTGCCCTGGCTGGACTGCAGTGG - Intergenic
1027205225 7:76092448-76092470 TTCCTCTGGCTTCAGTGAACAGG + Intergenic
1030896933 7:115072318-115072340 TTTCTCTGGCTGGAGTGCACTGG + Intergenic
1031826509 7:126572429-126572451 ATCCGATGGCTGCTCTGCACAGG + Intronic
1031960695 7:127987034-127987056 ATCAGCAGGCAGCACTGCACTGG + Intronic
1034153698 7:148937117-148937139 TTGCCCAGGCTGCAGTGCACTGG - Intergenic
1035402872 7:158578800-158578822 TTGCCCAGGCTGCAGTGCACTGG + Intronic
1038424888 8:27458659-27458681 TACCCCTGGCTGTACTGCTCAGG + Exonic
1039161912 8:34631349-34631371 TTGCCCTGGCTGCAGTGCAATGG + Intergenic
1039261919 8:35781142-35781164 TCCCTCTGGCTTCACTGCAAGGG - Intronic
1039354687 8:36802067-36802089 TTCCCCAGGCTGCAGTGCAGTGG - Intronic
1040006107 8:42622297-42622319 TTGCCCAGGCTGCAGTGCACTGG + Intergenic
1041154314 8:54968871-54968893 TCCCGCAGGCTGCAGTGCAGTGG - Intergenic
1041881993 8:62762274-62762296 TTGCCCAGGCTGGACTGCACTGG - Intronic
1042462160 8:69082214-69082236 TTCCCCAGGCTGGAGTGCACTGG + Intergenic
1043503728 8:80881886-80881908 TTGCCCAGGCTGGACTGCACTGG - Intergenic
1044526310 8:93255400-93255422 TTGCCCAGGCTGGACTGCACTGG - Intergenic
1045058140 8:98386916-98386938 TTCCCCAGGCTGCAGTGCAGTGG - Intergenic
1045443524 8:102238597-102238619 TCCCGCTCGCTGCTCTGCCCCGG - Intronic
1046446269 8:114324574-114324596 TTCCACTGGCTGGAGTGCAGTGG + Intergenic
1047231253 8:123000237-123000259 TTCCCCAGGCTGCAGTGCAGTGG - Intergenic
1049340928 8:142112303-142112325 CTCAGCTGGCTGCACTCCTCCGG - Intergenic
1049385390 8:142340510-142340532 TGGCGGTGGCTGCACAGCACTGG + Intronic
1049667443 8:143852547-143852569 CTCCACTGGCTGCACTGGAGTGG - Intergenic
1049799536 8:144511417-144511439 GCCCGCTGACTGCACTGCATTGG - Exonic
1049824311 8:144658312-144658334 TTGCCCTGGCTGCAGTGCAATGG + Intergenic
1051427022 9:16942309-16942331 TTCCCCAGGCTGGACTGCAATGG - Intergenic
1052939234 9:34118923-34118945 TTGCCCAGGCTGCAGTGCACTGG - Intronic
1053235831 9:36453251-36453273 TTGCCCTGGCTGGAGTGCACTGG + Intronic
1054443946 9:65293689-65293711 CTCCACTGACAGCACTGCACAGG - Intergenic
1054486327 9:65727817-65727839 CTCCACTGACAGCACTGCACAGG + Intronic
1056642982 9:88387030-88387052 TTCCCCAGGCTGCAGTGCAGTGG - Intergenic
1059230877 9:112720371-112720393 TTGCCCTGGCTGGACTGCAGTGG - Intergenic
1060403066 9:123359486-123359508 TTGCCCTGGCTGCAGTGCAGTGG + Intronic
1186208937 X:7229916-7229938 TTGCCCAGGCTGCAGTGCACTGG + Intronic
1186837625 X:13453161-13453183 TTCCCCAGGCTGCAGTGCAGTGG - Intergenic
1187268296 X:17757132-17757154 TTCTGGTGGCTGCACAGGACAGG + Intergenic
1187438933 X:19299798-19299820 TTGCGCAGGCTGCAGTGCAGTGG + Intergenic
1187521092 X:20014754-20014776 TTCCCCAGGCTGGACTGCAGTGG + Intronic
1189540509 X:41982904-41982926 TTCCTCTGGCTGGACTGAAAAGG - Intergenic
1189737464 X:44086368-44086390 TACTGCTGGCTGCCCTGCCCTGG - Intergenic
1190004884 X:46726212-46726234 TTACCCAGGCTGCAGTGCACTGG - Intronic
1191860921 X:65666364-65666386 TTGCCCTGGCTGGAGTGCACTGG + Intronic
1192820453 X:74639218-74639240 CTCCGCTGGCAGCACTAGACAGG + Intergenic
1194201561 X:90958430-90958452 GTATGCTGGCTGCACTGTACTGG - Intergenic
1195930512 X:110070274-110070296 TTCCCCAGGCTGCAGTGCAGTGG - Intronic
1197967246 X:132078421-132078443 TTCAGCTGGCTTCATTGCAGTGG + Exonic
1198866586 X:141129561-141129583 TTGCCCAGGCTGCACTGCAGTGG - Intergenic
1199601847 X:149545715-149545737 TTCCGCTGGCTGCTCAGCAGGGG - Exonic
1199648535 X:149933768-149933790 TTCCGCTGGCTGCTCAGCAGAGG + Exonic
1200223544 X:154404190-154404212 TTGCTCAGGCTGCAGTGCACTGG + Intronic
1200547402 Y:4533885-4533907 GTATGCTGGCTGCACTGTACTGG - Intergenic
1201281467 Y:12346432-12346454 TTCCTCAGGCTGCAGTGCACTGG + Intergenic
1201341324 Y:12937447-12937469 TTACCCAGGCTGCAGTGCACTGG + Intergenic
1201918543 Y:19209073-19209095 TTACCCTGGCTGGACTGCAGTGG + Intergenic