ID: 1102457930

View in Genome Browser
Species Human (GRCh38)
Location 12:113082337-113082359
Sequence CCACGGGTCTTGAGAGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 120}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102457930_1102457945 20 Left 1102457930 12:113082337-113082359 CCTCTGGCTCTCAAGACCCGTGG 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1102457945 12:113082380-113082402 GAGTAGGAGGAAGGAAGATAGGG 0: 1
1: 1
2: 13
3: 215
4: 1897
1102457930_1102457946 21 Left 1102457930 12:113082337-113082359 CCTCTGGCTCTCAAGACCCGTGG 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1102457946 12:113082381-113082403 AGTAGGAGGAAGGAAGATAGGGG 0: 1
1: 0
2: 4
3: 122
4: 1251
1102457930_1102457939 -2 Left 1102457930 12:113082337-113082359 CCTCTGGCTCTCAAGACCCGTGG 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1102457939 12:113082358-113082380 GGAGCCTGTTGCTGGGGAAGGGG 0: 1
1: 0
2: 5
3: 68
4: 577
1102457930_1102457941 4 Left 1102457930 12:113082337-113082359 CCTCTGGCTCTCAAGACCCGTGG 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1102457941 12:113082364-113082386 TGTTGCTGGGGAAGGGGAGTAGG 0: 1
1: 1
2: 9
3: 82
4: 887
1102457930_1102457933 -9 Left 1102457930 12:113082337-113082359 CCTCTGGCTCTCAAGACCCGTGG 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1102457933 12:113082351-113082373 GACCCGTGGAGCCTGTTGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 85
1102457930_1102457938 -3 Left 1102457930 12:113082337-113082359 CCTCTGGCTCTCAAGACCCGTGG 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1102457938 12:113082357-113082379 TGGAGCCTGTTGCTGGGGAAGGG 0: 1
1: 0
2: 4
3: 52
4: 608
1102457930_1102457934 -8 Left 1102457930 12:113082337-113082359 CCTCTGGCTCTCAAGACCCGTGG 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1102457934 12:113082352-113082374 ACCCGTGGAGCCTGTTGCTGGGG 0: 1
1: 0
2: 3
3: 6
4: 138
1102457930_1102457943 11 Left 1102457930 12:113082337-113082359 CCTCTGGCTCTCAAGACCCGTGG 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1102457943 12:113082371-113082393 GGGGAAGGGGAGTAGGAGGAAGG 0: 1
1: 5
2: 71
3: 642
4: 4076
1102457930_1102457937 -4 Left 1102457930 12:113082337-113082359 CCTCTGGCTCTCAAGACCCGTGG 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1102457937 12:113082356-113082378 GTGGAGCCTGTTGCTGGGGAAGG 0: 1
1: 0
2: 0
3: 63
4: 484
1102457930_1102457947 24 Left 1102457930 12:113082337-113082359 CCTCTGGCTCTCAAGACCCGTGG 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1102457947 12:113082384-113082406 AGGAGGAAGGAAGATAGGGGTGG 0: 1
1: 1
2: 33
3: 466
4: 4476
1102457930_1102457944 19 Left 1102457930 12:113082337-113082359 CCTCTGGCTCTCAAGACCCGTGG 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1102457944 12:113082379-113082401 GGAGTAGGAGGAAGGAAGATAGG 0: 1
1: 1
2: 12
3: 202
4: 1664
1102457930_1102457942 7 Left 1102457930 12:113082337-113082359 CCTCTGGCTCTCAAGACCCGTGG 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1102457942 12:113082367-113082389 TGCTGGGGAAGGGGAGTAGGAGG 0: 1
1: 0
2: 7
3: 117
4: 1070
1102457930_1102457932 -10 Left 1102457930 12:113082337-113082359 CCTCTGGCTCTCAAGACCCGTGG 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1102457932 12:113082350-113082372 AGACCCGTGGAGCCTGTTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102457930 Original CRISPR CCACGGGTCTTGAGAGCCAG AGG (reversed) Intronic
900543576 1:3216342-3216364 CCACGGGGCTGGGAAGCCAGAGG + Intronic
900739220 1:4320513-4320535 CCACGGGTCCACAGAGTCAGAGG + Intergenic
905461360 1:38124921-38124943 CCACTGGGGTTGAGAACCAGGGG + Intergenic
916345835 1:163790446-163790468 CCTCTGGTACTGAGAGCCAGGGG + Intergenic
923475149 1:234325054-234325076 CCAGGGGCTATGAGAGCCAGTGG + Intergenic
923971936 1:239213402-239213424 CCAGTGGTCTTGATACCCAGTGG - Intergenic
924004842 1:239598071-239598093 CCAGGGGTCCTGAAGGCCAGGGG + Intronic
1063320205 10:5045356-5045378 CTGCGGGTCTGGAGAGGCAGTGG + Intronic
1064258832 10:13768325-13768347 CCAAGAGTCCTGAGAGCCGGAGG + Intronic
1064397847 10:14995912-14995934 CCGCGGATCCTAAGAGCCAGGGG + Intergenic
1064981584 10:21172323-21172345 CCTCAGAGCTTGAGAGCCAGTGG - Intronic
1066629890 10:37448685-37448707 CCAGGGGTCTTAAAAGACAGAGG + Intergenic
1067691688 10:48505880-48505902 ACACGGGTGTGGAGAGCCACAGG - Intronic
1069621613 10:69840883-69840905 CCCGGGGTTCTGAGAGCCAGGGG - Intronic
1071491803 10:86141230-86141252 CCAAGGGTGTTGACAGCCTGGGG - Intronic
1073291056 10:102413550-102413572 CCACTGGACTTGAGACCAAGAGG + Intronic
1075037279 10:119080286-119080308 CCAGGGACCTGGAGAGCCAGAGG + Intronic
1075671608 10:124267123-124267145 CCAGGGGTGTCGTGAGCCAGTGG + Intergenic
1076395619 10:130135996-130136018 CCAGGGGTCCCGACAGCCAGGGG + Intergenic
1077281613 11:1748616-1748638 CCCGGGGTCTGGAGAGCCCGCGG - Intronic
1077327237 11:1969139-1969161 CCCCGTGTCCTGAGAGGCAGGGG - Intronic
1079801029 11:24869088-24869110 TCAGGAGTTTTGAGAGCCAGTGG + Intronic
1081146813 11:39571273-39571295 CCATGGGACTTGAGGGCCAAAGG + Intergenic
1081156029 11:39692089-39692111 AAAAGGGTCTTGATAGCCAGGGG - Intergenic
1084014441 11:66370341-66370363 CCCCTGGGCTTGAGAGCAAGAGG - Intronic
1084228337 11:67731891-67731913 CCGCGGGTCCTAAGAGCCAGGGG + Intergenic
1084661919 11:70551036-70551058 CCAAGGGGCTGGAGTGCCAGCGG + Intronic
1084846848 11:71907474-71907496 CCGCGGATCCTAAGAGCCAGGGG - Intronic
1202810219 11_KI270721v1_random:24319-24341 CCCCGTGTCCTGAGAGGCAGGGG - Intergenic
1094515652 12:31123647-31123669 CCGCGGATCCTAAGAGCCAGGGG - Intergenic
1096187249 12:49589226-49589248 CCCCGAGTCTTGAGTGGCAGTGG - Intronic
1096482676 12:51952482-51952504 CCACGGGGCATGAGTGCCGGAGG - Intronic
1097354849 12:58589567-58589589 TCACTGGTTTTTAGAGCCAGGGG - Intronic
1101203434 12:102461025-102461047 CAACAGGTTTTGAGACCCAGGGG + Intronic
1102457930 12:113082337-113082359 CCACGGGTCTTGAGAGCCAGAGG - Intronic
1107545148 13:41427967-41427989 CCGCGGATCCTAAGAGCCAGGGG + Intergenic
1108053079 13:46464308-46464330 ATTGGGGTCTTGAGAGCCAGGGG - Intergenic
1109538118 13:63741569-63741591 ACGCGGGTCCTAAGAGCCAGGGG + Intergenic
1110702669 13:78567158-78567180 TCACTGGTCTAGAGAGGCAGTGG + Intergenic
1112394360 13:99014881-99014903 TGAAGGGTCTTGAGAGCGAGAGG - Intronic
1113647696 13:112010893-112010915 CCACAGGTCTTGGGACCCAGGGG - Intergenic
1116984571 14:51205035-51205057 CCACAGGCCTTGCGAGGCAGAGG + Intergenic
1119079677 14:71680831-71680853 CCTCGGGTCTTTATAGCCACAGG + Intronic
1122448357 14:101783635-101783657 CCATGGGTCTTGACTGCCATGGG - Intronic
1122811899 14:104293354-104293376 CCAGGGGCCTGGAGGGCCAGGGG + Intergenic
1128092670 15:64929628-64929650 CCCTGGGACTTGAGGGCCAGAGG - Intronic
1130452343 15:84068499-84068521 TCACGTGTCTTGAGAAGCAGAGG - Intergenic
1131466135 15:92655932-92655954 CCTCGGGACTTGAGACCCCGTGG + Exonic
1132743887 16:1428802-1428824 CCCCGGGTCGGGAGGGCCAGGGG + Intergenic
1133665251 16:7961007-7961029 CCAGGGTGCTTGAGAGCCAGTGG - Intergenic
1134630869 16:15755242-15755264 CCAGGACTCTTGAGAGCCACAGG + Intronic
1135630609 16:24033214-24033236 CCAAGGGTCCTGAGGCCCAGAGG + Intronic
1136477069 16:30520071-30520093 CCAGGGGGCCTCAGAGCCAGGGG + Intronic
1137557803 16:49483799-49483821 CCAGAGGTGTGGAGAGCCAGAGG + Intergenic
1141421719 16:83921996-83922018 CCAGGGTTCCTGAGAGCAAGTGG - Exonic
1142290004 16:89189556-89189578 CCATGGGGCTTGAGGGCCAGAGG + Intronic
1151519506 17:74618050-74618072 CCCCAGGTCTTGGGAGTCAGAGG + Intronic
1152228254 17:79102546-79102568 CCAGGGGTCCAGAGTGCCAGTGG - Intronic
1152716499 17:81903027-81903049 CCAGAGGTCTTCAGACCCAGGGG + Intronic
1155246935 18:23919720-23919742 CTGCGGGGCTGGAGAGCCAGAGG + Intronic
1157330779 18:46702402-46702424 CCAAGGGCCATGAGAGCCACGGG - Intronic
1158398034 18:57094980-57095002 CCAGGGGTCCTGGGATCCAGAGG + Intergenic
1158834894 18:61320624-61320646 ACACAGATCTTGAGAACCAGAGG - Intergenic
1161507018 19:4649575-4649597 TCAAGGGCGTTGAGAGCCAGTGG + Intronic
1162550879 19:11357537-11357559 CCCCGGGTCTTCAGGGCCAGGGG + Intronic
926784983 2:16509655-16509677 CCACAGGTCTTGGCAGCCACAGG - Intergenic
927104552 2:19812105-19812127 CCAAGGGTTTTGAGCACCAGTGG - Intergenic
927333171 2:21890270-21890292 CCACGTGTCTTGATAAACAGTGG + Intergenic
928242500 2:29598554-29598576 CCATGGGTCTAGAGAGCAAAGGG + Intronic
931462249 2:62459163-62459185 CCACAGGTATTGGGAGTCAGAGG + Intergenic
932110502 2:68994997-68995019 CCACTGGTCTTCAGAGGGAGCGG - Intergenic
933457223 2:82531027-82531049 CCATGGCTCCTAAGAGCCAGGGG + Intergenic
938701730 2:133885654-133885676 CCATGTGACTTGAGAGGCAGAGG + Intergenic
938745270 2:134272003-134272025 CCACAGGACTTCAGAGGCAGTGG - Intronic
943062894 2:183057153-183057175 CCAAAGGTCTTGGCAGCCAGAGG - Intergenic
946339633 2:219059231-219059253 CAACGGATCTAGAAAGCCAGGGG + Intronic
946449911 2:219771060-219771082 CCACAGCTCTTGAGAGTCATTGG - Intergenic
948142618 2:235685028-235685050 CCAGGGGTTGTGAGAGTCAGGGG + Intronic
1170604783 20:17867720-17867742 CCAGGGGGCTTGAGCTCCAGCGG - Intergenic
1172844685 20:37922815-37922837 CCATGGCTCCTGGGAGCCAGTGG - Intronic
1173397175 20:42690411-42690433 CCACGGGGCTGGAGAGGCAGAGG + Intronic
1175266324 20:57705706-57705728 CTAAGGGGCTTGAGGGCCAGAGG - Intronic
1175919224 20:62442235-62442257 CCACTGGGGCTGAGAGCCAGGGG + Intergenic
1179153622 21:38830877-38830899 GCACAGGGCTTGAGGGCCAGAGG + Intergenic
1180005863 21:45020217-45020239 CCATGGGTCTGCAGAGACAGTGG - Intergenic
1183818671 22:40325757-40325779 CCAAGGCTCCTGCGAGCCAGTGG + Exonic
1185091325 22:48776396-48776418 CCAGGGGGCTGGAGAGCCTGGGG + Intronic
950108479 3:10403519-10403541 ACAAGGGTCCTGAGAGCAAGAGG + Intronic
951577620 3:24129981-24130003 CAGGTGGTCTTGAGAGCCAGGGG - Intronic
952893802 3:38063005-38063027 CCAGGGGTCTTGAGAAATAGGGG + Intronic
957045011 3:75366948-75366970 CCGCGGATCCTAAGAGCCAGGGG + Intergenic
960146195 3:114206217-114206239 CCACTGGTCTAGAGTGCCATAGG + Intergenic
961061850 3:123835282-123835304 CCACTGGTCTAGAAAGCCTGAGG + Intronic
961274474 3:125716034-125716056 CCGCGGATCCTAAGAGCCAGGGG - Intergenic
961877014 3:130031001-130031023 CCGCGGATCCTAAGAGCCAGGGG + Intergenic
969788456 4:9475273-9475295 CCGCGGGTCCTAAGAGCCAGGGG - Intergenic
969826047 4:9759001-9759023 CCGCGGATCCTAAGAGCCAGGGG - Intergenic
978856279 4:113398242-113398264 CAAGGGGTCCAGAGAGCCAGAGG - Intergenic
979945475 4:126826084-126826106 CCACAGGTTTTGAGGTCCAGAGG - Intergenic
986515854 5:8563014-8563036 TCACGGCACTTGGGAGCCAGGGG + Intergenic
987337132 5:16906779-16906801 CCAAGGGGCTTGAGAGGCAAGGG - Intronic
990143694 5:52734392-52734414 CCAAGTGTCTTGAAAACCAGTGG + Intergenic
994726615 5:103443873-103443895 CCTGGGTTCTTGATAGCCAGAGG + Intergenic
999619690 5:153460146-153460168 ACACTGGTGTAGAGAGCCAGTGG - Intergenic
999921347 5:156324824-156324846 CCACAGTCTTTGAGAGCCAGTGG - Intronic
1001591460 5:172868294-172868316 CCACGGATTTTCAGAGCCAGGGG - Intronic
1004879013 6:19987038-19987060 CTAATGGTCTGGAGAGCCAGAGG + Intergenic
1006791497 6:36704134-36704156 CCAAGGGTGATGGGAGCCAGGGG + Intronic
1014739264 6:125128049-125128071 CCATTGGTCTTGAAACCCAGTGG - Intronic
1016844401 6:148556707-148556729 CCAAGGGTGCTGAGAGGCAGTGG - Intergenic
1017298676 6:152831084-152831106 CCATGGGACTTGAGAGCAAGAGG - Intergenic
1018583976 6:165335521-165335543 GTACGAGTCATGAGAGCCAGGGG + Intronic
1019157994 6:170051784-170051806 CCAGGGGTCAGCAGAGCCAGTGG - Intergenic
1020099667 7:5388074-5388096 CCACGGGTCTGGAGAGGCCTCGG - Exonic
1020218361 7:6213620-6213642 CCAGGGGCCTTGAGAACCAATGG + Intronic
1020312132 7:6876294-6876316 CCGCGGATCCTAAGAGCCAGGGG + Intergenic
1023864204 7:44231189-44231211 CCACGGGGCTTAAAGGCCAGGGG + Intronic
1027275317 7:76549813-76549835 CCACGGCTCCTGAGAGGCCGGGG - Intergenic
1034447442 7:151120839-151120861 CCCTGGGGCCTGAGAGCCAGAGG - Intronic
1034588957 7:152122433-152122455 GGACGCGTCTTGAGAGGCAGAGG - Intergenic
1042243982 8:66692595-66692617 CCACAGCACTTGAGAGACAGAGG + Intronic
1049081337 8:140445559-140445581 CCATGGATCCTGGGAGCCAGTGG + Intronic
1049259119 8:141629404-141629426 CCAAGGGCCCCGAGAGCCAGCGG - Intergenic
1049631086 8:143658017-143658039 CCACGGTTCTTGGGTCCCAGTGG + Intergenic
1056690362 9:88803106-88803128 CCATGGGTCCTGAAAACCAGTGG + Intergenic
1056864808 9:90219923-90219945 CCGCGGATCCTAAGAGCCAGGGG - Intergenic
1061041017 9:128140490-128140512 CCGCGGATCCTAAGAGCCAGCGG + Intergenic
1061582568 9:131546537-131546559 CGACTGATCTTGAGAGCCCGGGG + Intergenic
1062209586 9:135356488-135356510 CCAAGGGTCTTGAACGCCAGGGG + Intergenic
1192314473 X:70041323-70041345 ACTGGGGCCTTGAGAGCCAGTGG - Exonic
1199756682 X:150871317-150871339 CCAGGGGTTTTGAGAGATAGAGG - Intronic