ID: 1102457966

View in Genome Browser
Species Human (GRCh38)
Location 12:113082474-113082496
Sequence GAGGGGAAAGGGATGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2348
Summary {0: 1, 1: 2, 2: 20, 3: 251, 4: 2074}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102457958_1102457966 -7 Left 1102457958 12:113082458-113082480 CCCAAGTGCAGCCTATGAGGGGA 0: 1
1: 0
2: 0
3: 4
4: 162
Right 1102457966 12:113082474-113082496 GAGGGGAAAGGGATGGAGGTGGG 0: 1
1: 2
2: 20
3: 251
4: 2074
1102457951_1102457966 28 Left 1102457951 12:113082423-113082445 CCGCCTAAAGCTTTCCATTGCTG 0: 1
1: 0
2: 0
3: 21
4: 203
Right 1102457966 12:113082474-113082496 GAGGGGAAAGGGATGGAGGTGGG 0: 1
1: 2
2: 20
3: 251
4: 2074
1102457952_1102457966 25 Left 1102457952 12:113082426-113082448 CCTAAAGCTTTCCATTGCTGAGA 0: 1
1: 0
2: 1
3: 17
4: 191
Right 1102457966 12:113082474-113082496 GAGGGGAAAGGGATGGAGGTGGG 0: 1
1: 2
2: 20
3: 251
4: 2074
1102457959_1102457966 -8 Left 1102457959 12:113082459-113082481 CCAAGTGCAGCCTATGAGGGGAA 0: 1
1: 0
2: 1
3: 4
4: 145
Right 1102457966 12:113082474-113082496 GAGGGGAAAGGGATGGAGGTGGG 0: 1
1: 2
2: 20
3: 251
4: 2074
1102457954_1102457966 14 Left 1102457954 12:113082437-113082459 CCATTGCTGAGACAGCTGAGGCC 0: 1
1: 0
2: 1
3: 22
4: 241
Right 1102457966 12:113082474-113082496 GAGGGGAAAGGGATGGAGGTGGG 0: 1
1: 2
2: 20
3: 251
4: 2074

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102457966 Original CRISPR GAGGGGAAAGGGATGGAGGT GGG Intronic
Too many off-targets to display for this crispr