ID: 1102458783

View in Genome Browser
Species Human (GRCh38)
Location 12:113087468-113087490
Sequence GTCCTGGGGAACACAGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 262}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102458783_1102458797 -6 Left 1102458783 12:113087468-113087490 CCCCAGGCTGTGTTCCCCAGGAC 0: 1
1: 0
2: 1
3: 27
4: 262
Right 1102458797 12:113087485-113087507 CAGGACTGTGGGGGGAGGAGGGG 0: 1
1: 0
2: 9
3: 98
4: 1097
1102458783_1102458796 -7 Left 1102458783 12:113087468-113087490 CCCCAGGCTGTGTTCCCCAGGAC 0: 1
1: 0
2: 1
3: 27
4: 262
Right 1102458796 12:113087484-113087506 CCAGGACTGTGGGGGGAGGAGGG 0: 1
1: 0
2: 6
3: 100
4: 1046
1102458783_1102458800 12 Left 1102458783 12:113087468-113087490 CCCCAGGCTGTGTTCCCCAGGAC 0: 1
1: 0
2: 1
3: 27
4: 262
Right 1102458800 12:113087503-113087525 AGGGGGAGAAGGCAGCTATGAGG 0: 1
1: 0
2: 3
3: 80
4: 462
1102458783_1102458799 1 Left 1102458783 12:113087468-113087490 CCCCAGGCTGTGTTCCCCAGGAC 0: 1
1: 0
2: 1
3: 27
4: 262
Right 1102458799 12:113087492-113087514 GTGGGGGGAGGAGGGGGAGAAGG 0: 1
1: 8
2: 102
3: 1189
4: 7854
1102458783_1102458794 -8 Left 1102458783 12:113087468-113087490 CCCCAGGCTGTGTTCCCCAGGAC 0: 1
1: 0
2: 1
3: 27
4: 262
Right 1102458794 12:113087483-113087505 CCCAGGACTGTGGGGGGAGGAGG 0: 1
1: 0
2: 14
3: 355
4: 11749
1102458783_1102458798 -5 Left 1102458783 12:113087468-113087490 CCCCAGGCTGTGTTCCCCAGGAC 0: 1
1: 0
2: 1
3: 27
4: 262
Right 1102458798 12:113087486-113087508 AGGACTGTGGGGGGAGGAGGGGG 0: 1
1: 3
2: 12
3: 366
4: 9274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102458783 Original CRISPR GTCCTGGGGAACACAGCCTG GGG (reversed) Intronic
900108766 1:997011-997033 GTCTCAGGAAACACAGCCTGAGG - Intergenic
900333516 1:2149146-2149168 GGTCTGGGGACCACACCCTGCGG + Intronic
900336535 1:2166749-2166771 ATGCTGGGAAGCACAGCCTGGGG - Intronic
900345641 1:2209058-2209080 CCCCTGGGGAACCCGGCCTGGGG - Intronic
900683778 1:3933757-3933779 AGCCTGGGCAACACAGCCAGAGG + Intergenic
901980905 1:13033396-13033418 GATCTCGGAAACACAGCCTGGGG - Intronic
902001183 1:13195535-13195557 GATCTCGGAAACACAGCCTGGGG + Intergenic
902020416 1:13341239-13341261 GATCTCGGAAACACAGCCTGGGG + Intergenic
902040211 1:13486953-13486975 GTCCTGGGAGAGACAGACTGTGG - Intronic
902282456 1:15384424-15384446 GCCCTGGGGGACACTGCCTCGGG - Intronic
903134991 1:21303321-21303343 GTGGTGGGGAACACAGATTGTGG + Intronic
903587198 1:24425056-24425078 TTCCTGGGCAGCTCAGCCTGGGG - Intronic
904676232 1:32200860-32200882 CTCCTGGGGAGCACAGGCTCCGG + Intronic
905823247 1:41010480-41010502 GCCCTGGGGATGACAGCTTGGGG + Intronic
905975107 1:42168740-42168762 GTGCTGGGGACCAGGGCCTGAGG - Intergenic
905992738 1:42353482-42353504 GTCCTGGGTAACAAAGCCACAGG + Intergenic
906643804 1:47458453-47458475 GTGCTGGGGATTACAGCCTCTGG + Intergenic
908602141 1:65752144-65752166 TGCCTGGGAAACACAGCCAGTGG + Intergenic
911105359 1:94126338-94126360 GTGGTGGGGAACACAGCCTCAGG - Intergenic
915916544 1:159944179-159944201 GTCCTGGGGACCACTTTCTGAGG - Intronic
917185597 1:172351453-172351475 GTCCTGGGCAACAGACCATGTGG - Intronic
917731273 1:177877282-177877304 GAGCTGGGGAACACAGGCTAAGG - Intergenic
919751119 1:201038869-201038891 GCCCTGGGGTGCACAGCCAGAGG - Intergenic
920062825 1:203239746-203239768 CTCCTGGTGAAAACAGGCTGAGG - Intronic
920366588 1:205451140-205451162 ATCCTGGGGGACAGAGCCAGGGG - Intronic
921307706 1:213813661-213813683 CTCCTGAAGAACACAGCCTTTGG - Intergenic
921450010 1:215294618-215294640 CTCCTGGGGACCACAGTCTTAGG + Intergenic
923006972 1:230057941-230057963 GTCCTGGGGAAAGGAGCCAGCGG - Intergenic
923255693 1:232219507-232219529 GTGCTGGGGCTGACAGCCTGGGG + Intergenic
924055396 1:240119442-240119464 GGCCTGGGGTTCTCAGCCTGGGG + Intronic
924197145 1:241620072-241620094 GTACTGGGGAATACAGGGTGGGG + Intronic
924384777 1:243490671-243490693 GCCCTTGGGCACACAGGCTGAGG + Intronic
924427847 1:243970248-243970270 TTCGTGGGGAGCCCAGCCTGCGG + Intergenic
1062922460 10:1290395-1290417 GTCCTGGGGACCCCAGCATCTGG - Intronic
1064695265 10:17958541-17958563 GCCATGGAGAACACAGGCTGTGG - Intronic
1064800556 10:19065603-19065625 TTGCTGAGGAACACAACCTGGGG + Intronic
1068963269 10:62886684-62886706 GTGCTGTGGGACAGAGCCTGGGG - Intronic
1069825116 10:71250166-71250188 ATCCTGGGGAGCAGGGCCTGGGG - Intronic
1069878423 10:71577193-71577215 TTCTTGGGGAGCACAGCCTATGG - Intronic
1069993432 10:72328771-72328793 GGCCTGGGCACCACAACCTGGGG - Intergenic
1070143140 10:73753883-73753905 GTCCTGGGGCACGCAGACTGTGG - Intronic
1070570971 10:77638798-77638820 GTCCTGGGGAGCTCAGCCTGTGG - Intergenic
1071497940 10:86181301-86181323 GTCCTGGGGGCCACAGCTTCAGG - Intronic
1071739569 10:88341691-88341713 GTTTTGTGGAAAACAGCCTGAGG + Intronic
1072623804 10:97098321-97098343 GAGCTGGGGAAGACAGGCTGAGG + Intronic
1074376642 10:112946435-112946457 GCCGTGGGTGACACAGCCTGTGG + Intergenic
1074495900 10:113979868-113979890 GTCCTGGAAAATTCAGCCTGGGG - Intergenic
1074670961 10:115790331-115790353 GTTCTGGGGAACAGAAACTGTGG - Intronic
1074703079 10:116109565-116109587 CTCTGGGGGAACACAGCCCGGGG - Intronic
1075377940 10:121994600-121994622 ATCCTGGGGAAGACAGACTGCGG + Intronic
1075596347 10:123732422-123732444 TTTCCGGGGAACTCAGCCTGAGG - Intronic
1075630733 10:123999398-123999420 GTCCTGGGCTACACAGCGGGAGG - Intergenic
1076078969 10:127560745-127560767 TTACTGGAGAAGACAGCCTGCGG + Intergenic
1076149493 10:128150720-128150742 GTCCAGGGGCACGTAGCCTGCGG + Intergenic
1076477725 10:130764201-130764223 GTCCGGGGGATCTCAGCATGGGG + Intergenic
1076794109 10:132790530-132790552 GTCCTGGGCCACTCGGCCTGGGG - Intergenic
1079528139 11:21415287-21415309 GTCCAGAGGTGCACAGCCTGTGG + Intronic
1080273500 11:30476184-30476206 GTCTTGGGGAACATAGTCTAGGG - Intronic
1081936153 11:46905238-46905260 ATCCTGGACAACACAGCCTGAGG + Intronic
1083284222 11:61647548-61647570 GGGCTGGGCAACCCAGCCTGTGG - Intergenic
1083329598 11:61891395-61891417 GTCCTGGGGATCCCAGGCGGTGG + Exonic
1084007707 11:66332060-66332082 GGCCTTGGGCACACAGTCTGGGG + Exonic
1084762503 11:71283005-71283027 TTCCTGAGGACCACAGTCTGGGG - Intergenic
1088745563 11:112801369-112801391 GCCCTGAGGAACACCACCTGTGG - Intergenic
1089200777 11:116723659-116723681 GACCTGGGGAAGAGAGCCTGTGG - Intergenic
1089460549 11:118650587-118650609 GTCCTGGGTAACAGAGCCCAGGG - Intronic
1089731640 11:120523021-120523043 GTCCTGGGGACAGGAGCCTGAGG + Intronic
1089848852 11:121479971-121479993 GTCCTGGGGACCACACTGTGCGG - Intronic
1090855561 11:130607174-130607196 GTCTAGGGGAACTCACCCTGGGG + Intergenic
1091325395 11:134683121-134683143 AGACTGAGGAACACAGCCTGAGG - Intergenic
1091391615 12:129537-129559 GTCCTGGGGGATACAACCTAGGG + Intronic
1091801844 12:3329286-3329308 GGGCTGGCAAACACAGCCTGGGG + Intergenic
1092262924 12:6962119-6962141 GTCCTGGGGAGTAAAGCCGGTGG + Intergenic
1101630524 12:106489091-106489113 GTCCTGTGGATCACAGCATCGGG + Intronic
1102458783 12:113087468-113087490 GTCCTGGGGAACACAGCCTGGGG - Intronic
1104891498 12:132142377-132142399 CTCCTGGAGAGCGCAGCCTGTGG - Exonic
1107827314 13:44340050-44340072 ATCCTGGGGTAAACATCCTGAGG + Intergenic
1108575638 13:51788202-51788224 GTCCTGCGGAACAGTGCCTCGGG + Intronic
1108648513 13:52453259-52453281 GTCCTGGCAAAAACATCCTGGGG - Intergenic
1109207834 13:59501341-59501363 CCCCAGGGGAACAAAGCCTGTGG - Intergenic
1110978336 13:81867429-81867451 GTTCTTGGGAACACAGGCTAAGG - Intergenic
1112261869 13:97884568-97884590 CTCCTGGGGAACAGAGCATGGGG + Intergenic
1112331031 13:98477073-98477095 TTTCTGGGGAACAGAGTCTGTGG - Intronic
1114309529 14:21454343-21454365 GGCCTGGGCGACACAGCCAGAGG - Intronic
1117731701 14:58728967-58728989 GCACTGGGGCACACAGACTGTGG - Intergenic
1119159693 14:72442629-72442651 GTCCTGTGGCACACAGCCAATGG - Intronic
1119620903 14:76131273-76131295 GCCCTGGGGAATGCAGACTGTGG + Intergenic
1120213570 14:81658420-81658442 GTCCTGGGGAAAACAGCAAAAGG - Intergenic
1121702059 14:95962088-95962110 GGCATGGGGCAGACAGCCTGTGG - Intergenic
1122101827 14:99418561-99418583 TTCCTGGGCAGGACAGCCTGTGG + Intronic
1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG + Intronic
1123767981 15:23500786-23500808 GTCCTGGGCCACACCGGCTGTGG + Intergenic
1124266956 15:28244774-28244796 GTCCTGAGGAAAACAGCCCCAGG - Intronic
1126118359 15:45229120-45229142 GTTCTTGAGAACTCAGCCTGTGG + Intergenic
1126166539 15:45658747-45658769 GACCTTGGGACCACAGCCAGTGG + Intronic
1127794325 15:62425312-62425334 CCCCTGGGGAATACTGCCTGCGG + Intronic
1128331333 15:66757541-66757563 GGCCTGGGAGACCCAGCCTGAGG - Intronic
1128374390 15:67065321-67065343 GTCCTGGGAAACACGGCGAGAGG - Intronic
1129323282 15:74786607-74786629 GACCTGGGGAACACCTGCTGAGG - Intronic
1129854120 15:78811789-78811811 GGCCTGGGGAACACAGCGAAGGG - Intronic
1130148242 15:81291989-81292011 GTCCTGGGGTTCACTACCTGTGG + Intronic
1130637693 15:85640878-85640900 GTCCTGGGGAAAACATCCAGGGG - Intronic
1131778042 15:95823421-95823443 CCACTGGGGATCACAGCCTGGGG - Intergenic
1132672517 16:1107638-1107660 GGCCTGGGGGGCACGGCCTGAGG + Intergenic
1133891428 16:9882987-9883009 GTGGTGGTGAACACAGCCTTCGG + Intronic
1134663880 16:16004132-16004154 GTGGTGGGGAACACTGACTGTGG + Intronic
1135143336 16:19940232-19940254 ACCCTGGGGAACACAGGCTGCGG + Intergenic
1136185662 16:28587452-28587474 GTCCCGGTGCTCACAGCCTGAGG + Intronic
1138620299 16:58205861-58205883 GTCCTGGGCAAGAGAGCCAGAGG + Intergenic
1138738554 16:59280526-59280548 GTTCTGGGGAACACACACTTTGG - Intergenic
1139636281 16:68260359-68260381 GGCCCCTGGAACACAGCCTGCGG - Exonic
1139827731 16:69770692-69770714 GTCTTGGGGAACTAAACCTGTGG + Intronic
1140070586 16:71646088-71646110 CACCTGGGGAACACATCCTCTGG + Exonic
1140748401 16:78001199-78001221 ATTCTGGGGAACACACTCTGGGG + Intergenic
1141432775 16:83979438-83979460 GTCCTGGGGGGCACTGGCTGGGG + Intronic
1142142260 16:88477933-88477955 CTCCTGGAGCCCACAGCCTGAGG + Intronic
1142155312 16:88530255-88530277 GTCCTTGCCCACACAGCCTGCGG + Intronic
1142286878 16:89175110-89175132 GACCTGGTGAACTCAGGCTGTGG + Intronic
1144052541 17:11509274-11509296 ATCTTGGGGAACACAGTCTGAGG + Intronic
1144521626 17:15956367-15956389 GTCAAGAGGAAGACAGCCTGTGG - Intronic
1145066045 17:19762114-19762136 GTCCTTGGGAACAGAGGGTGTGG - Intergenic
1145242340 17:21247366-21247388 CTCCTGGGAGCCACAGCCTGAGG - Intronic
1146283556 17:31559880-31559902 TTCCCGGGGAACGCCGCCTGAGG + Intergenic
1146285481 17:31571634-31571656 GGCCTGGGGAAGACTGGCTGGGG + Intronic
1146660947 17:34664881-34664903 GTCCTGGGGGTCTCAGCCTGAGG + Intergenic
1146666566 17:34709001-34709023 GTGCTGAGGAGCACAGGCTGTGG - Intergenic
1148874454 17:50678325-50678347 GTCCTTGAGAACAGACCCTGTGG - Intronic
1150625097 17:66836318-66836340 ATCCTGGGGAACACAAGATGGGG + Intronic
1151498507 17:74473998-74474020 GGCCAGGGGAACACAGTCAGGGG + Intronic
1151552231 17:74828689-74828711 GCCCTGGGGGTCACAGCCCGGGG + Intronic
1152754905 17:82083149-82083171 TGCCTGGGGACCAGAGCCTGGGG + Intronic
1152780899 17:82227082-82227104 GTCCTGGGGCCCACACCCAGGGG + Intergenic
1153887847 18:9482911-9482933 GTCTTGTGGAACTAAGCCTGTGG + Intronic
1154194636 18:12256462-12256484 GTCCTGAGGAAAGCAGCCTGAGG + Intronic
1154321677 18:13359146-13359168 GTCCTTGTGCACAAAGCCTGAGG - Intronic
1161332140 19:3693443-3693465 CTCATGGGGATTACAGCCTGAGG - Intronic
1161405111 19:4087154-4087176 GACCTGGGGCACACCACCTGTGG - Intergenic
1161479970 19:4505522-4505544 CTCCTCGGGAGCACAGCGTGCGG + Intronic
1161592725 19:5136015-5136037 TTCTCAGGGAACACAGCCTGCGG - Intronic
1161620136 19:5293262-5293284 GGCCTGGGGAGCTCGGCCTGGGG + Intronic
1162297796 19:9825396-9825418 ATCCTGGGCAACACAGAGTGAGG - Intronic
1163267907 19:16232748-16232770 GCCCTGGGGAGCAGAGACTGTGG + Intronic
1163591382 19:18196018-18196040 GTCCAGGGCCACACAGCCTGGGG - Exonic
1166359470 19:42247083-42247105 GTCCTTTGGAGAACAGCCTGTGG - Intronic
1167089179 19:47331781-47331803 GCTCTGAGGAAGACAGCCTGGGG - Intergenic
1168434935 19:56309527-56309549 GCCCTGCGGAACACAGTTTGAGG + Intronic
925183781 2:1833412-1833434 GTCCCGGTGAACACAGACTGAGG - Intronic
925888225 2:8411773-8411795 ATTCTGGGGACCCCAGCCTGGGG - Intergenic
926053899 2:9762593-9762615 GTCCTGGTGGAGACAGGCTGAGG - Intergenic
926163577 2:10504591-10504613 GTCTTGAGGAACACACCCGGTGG + Intergenic
926196425 2:10766115-10766137 GTCTTGGGGACCAGAGCCTGCGG + Intronic
926633338 2:15157263-15157285 GTCCTAGGGAACACACTCTTGGG - Intergenic
927195032 2:20541060-20541082 GTCCTGCTCAACACAGTCTGGGG - Intergenic
931452778 2:62382379-62382401 GTGCTGGTGGAAACAGCCTGAGG + Intergenic
935733379 2:106085054-106085076 GTCCCGGGGAACCCATGCTGGGG + Intergenic
937236229 2:120433240-120433262 TTCCAGGGGCACGCAGCCTGTGG + Intergenic
937688260 2:124722736-124722758 GTCCTGGAGGACACAGGCTCAGG - Intronic
937917617 2:127106686-127106708 GCGCCGGGGAACGCAGCCTGGGG + Intronic
940295247 2:152116045-152116067 GTCCTGGGGAACTCAGACATGGG - Intergenic
944120969 2:196240407-196240429 GGCCTGTGGAACATAGGCTGTGG - Intronic
944277345 2:197853967-197853989 GTCTTTAGGAACACACCCTGAGG - Intronic
945134302 2:206609972-206609994 GTCCTTGGGGGCACAGGCTGGGG + Exonic
947984801 2:234438852-234438874 GTGCTGGAGAAGTCAGCCTGCGG + Intergenic
948536198 2:238649651-238649673 GGCCTGGGGTGCCCAGCCTGGGG - Intergenic
1169182130 20:3578890-3578912 GTGCTGGTGAACGCAGCCTGAGG + Intronic
1170281306 20:14651856-14651878 TACCTGGGGAACTCAGGCTGAGG + Intronic
1172994109 20:39057442-39057464 GCCCTGGGGAACTCATACTGGGG + Intergenic
1174171241 20:48619484-48619506 GTCCTGGGGCACTGAGGCTGGGG - Intergenic
1175326449 20:58132061-58132083 GCCCTGGGGAACACAGGATGTGG - Intergenic
1175697161 20:61111213-61111235 GTCCTGAGCAACACAACCTCGGG + Intergenic
1175811491 20:61860793-61860815 CCCTTGGGAAACACAGCCTGTGG - Intronic
1178249939 21:30993374-30993396 GTTCTGGGGAACACTGTCTAGGG + Intergenic
1178676450 21:34635411-34635433 ATCCTGGGAAACACAGGCAGGGG + Intergenic
1179243654 21:39612307-39612329 GTCCTGGGTCACACAGCCACAGG - Exonic
1179542525 21:42092957-42092979 CTCCTAGGGAAGACAGCCTTGGG - Intronic
1179716484 21:43291275-43291297 TTCCAGGGGGACACTGCCTGGGG - Intergenic
1181464554 22:23103863-23103885 GCACTGGGGAAGCCAGCCTGAGG - Intronic
1182119915 22:27779847-27779869 GGCCTGGAGAACAATGCCTGGGG + Intronic
1184034528 22:41912178-41912200 GTCCAAGGTCACACAGCCTGTGG - Intronic
1185070780 22:48654546-48654568 TGCCTGGGCAGCACAGCCTGGGG - Intronic
1185182319 22:49370437-49370459 GACCTCGGCAGCACAGCCTGGGG - Intergenic
1185316260 22:50180503-50180525 GCCCTGGGGCACACAGGCTTGGG + Intergenic
950808699 3:15631209-15631231 ATCCTGTGGAACAAAGCCTGAGG - Intronic
950904425 3:16524895-16524917 CTTCTAGGGAACACAACCTGTGG - Intergenic
950980979 3:17304142-17304164 GTCCTGTGGAAGACTGGCTGTGG - Intronic
952342742 3:32459454-32459476 GTCCTGGAGAACACAGCTGTAGG + Intronic
954258462 3:49422255-49422277 GTCCTGCGGAGCACCTCCTGTGG + Exonic
954578004 3:51687298-51687320 GTCTTGGGGAACAAAGCCAGGGG + Intronic
954745264 3:52784210-52784232 GCTCTGGGGAACACTCCCTGGGG - Intronic
955229990 3:57090223-57090245 GTCCTAGGGGAGAAAGCCTGTGG - Exonic
960310250 3:116109722-116109744 GTTCTTGAGAACACAGGCTGAGG + Intronic
961311600 3:126005535-126005557 CTCCTGGGGCACAGAGCCAGGGG - Intergenic
961442189 3:126959729-126959751 GTCCTGTGGTGGACAGCCTGAGG - Intronic
961455666 3:127022732-127022754 GTCCTGGGGAGCACAGAATATGG - Exonic
967323048 3:188212865-188212887 GACCTGGGGCTTACAGCCTGTGG + Intronic
967480683 3:189969575-189969597 GTCATAGGGACCACAGCTTGTGG - Intronic
967819224 3:193825807-193825829 GAGCTGGGTAGCACAGCCTGGGG - Intergenic
968549390 4:1214436-1214458 TTCCTGGTGAACACAGCCCGGGG - Exonic
968949658 4:3683986-3684008 GACCTGGAGAACACAGGCGGGGG - Intergenic
969584387 4:8083696-8083718 GTCCTGTGTGACACAGGCTGTGG + Intronic
969699565 4:8760751-8760773 GTCCAGGCCAACACAGGCTGTGG - Intergenic
969821879 4:9727028-9727050 GTCCTGGGGATTAAGGCCTGTGG + Intergenic
974381956 4:61152585-61152607 GTCATGGGGGAAAGAGCCTGTGG + Intergenic
976735316 4:88302892-88302914 GTCTTGTGGGAAACAGCCTGTGG + Intergenic
979051515 4:115940094-115940116 GTCCTGAGGAACACCACCTGAGG - Intergenic
981233629 4:142388911-142388933 GTCCTTGGAAACACAGGCTTAGG - Intronic
981699340 4:147591711-147591733 CTCGTGGGTAAAACAGCCTGGGG - Intergenic
983909838 4:173225720-173225742 TTCCTGGGTAACCCAACCTGTGG - Intronic
985035867 4:185839376-185839398 GTCCTGGGTAAAATAGCCTGAGG - Intronic
985310159 4:188588879-188588901 GTTCTGGGGAAGAGAGCTTGGGG - Intergenic
985777091 5:1850302-1850324 GTCCTGGGGATTACATGCTGAGG - Intergenic
987370229 5:17186424-17186446 GGCCTGGAGCACTCAGCCTGTGG - Intronic
992416090 5:76552756-76552778 GTTCTGTGGAACACAGTTTGGGG + Intronic
992979260 5:82150726-82150748 ACCCTTTGGAACACAGCCTGTGG - Intronic
993766893 5:91870896-91870918 GTGCTGGGAAACACAGCTGGAGG + Intergenic
997439852 5:133901417-133901439 GTCCTGGGGAAATCTGCCTGTGG + Intergenic
997475180 5:134138599-134138621 GTCTAGGGGAGCCCAGCCTGGGG - Intronic
998351946 5:141507798-141507820 GCCCTGGGGAACGGACCCTGGGG + Intronic
999456502 5:151720763-151720785 GTAGTGGGGACCACAACCTGTGG - Intergenic
999550062 5:152676980-152677002 CTCCTGGGGCAGACGGCCTGGGG - Intergenic
999773345 5:154792029-154792051 GTGATGGAGAACACAGGCTGGGG - Intronic
1001294542 5:170489750-170489772 ATCCTGGGGAATGAAGCCTGAGG + Intronic
1001998774 5:176183477-176183499 GCCCTGGGAGACACAGCCTCGGG + Intergenic
1002329918 5:178434322-178434344 GTCCTGGAGAACAGTGCCTCGGG - Intronic
1002650344 5:180687101-180687123 GCCCTGGGAGACACAGCCTCGGG + Intergenic
1002704668 5:181152311-181152333 TTCCTGGGGAAAATATCCTGAGG + Intergenic
1003075675 6:2981855-2981877 GCCCCAGGGAACACATCCTGAGG - Intergenic
1003985020 6:11426772-11426794 GTGCAGGGACACACAGCCTGGGG + Intergenic
1005147367 6:22706888-22706910 CTCCTGTGGAACACAGACTGTGG + Intergenic
1007231947 6:40354375-40354397 GTCCAGGGGAACATCACCTGGGG - Intergenic
1007717675 6:43866605-43866627 GTCCTGTGGAGCACAGAATGGGG + Intergenic
1007978954 6:46130423-46130445 GTGCTGGGGAAGGCAACCTGTGG + Intronic
1008651977 6:53573334-53573356 GTTCAAGGGATCACAGCCTGGGG - Intronic
1011748502 6:90432223-90432245 GCCCTGGGGCACCCAACCTGAGG - Intergenic
1013535556 6:111060225-111060247 GTCCTGGAGATCAAAGCCAGAGG - Intergenic
1018167788 6:161115852-161115874 ATCCTGGTGAACACAGGATGTGG + Intronic
1019623398 7:2003373-2003395 GCCCCTGGGGACACAGCCTGGGG + Intronic
1019708875 7:2509427-2509449 GGCCTGGGAAGCACAGCCTCCGG - Intergenic
1019710684 7:2516953-2516975 GTCCTGGGGAAGAGGGGCTGGGG - Intronic
1019993538 7:4708677-4708699 TTCCTGGGGCTCCCAGCCTGGGG + Intronic
1020316874 7:6911763-6911785 GTCCTGGGGATTAAGGCCTGTGG - Intergenic
1021740479 7:23680893-23680915 GTCCTGGAGAGGACCGCCTGAGG + Intronic
1023176838 7:37443835-37443857 GTCCTGGGAGCCACACCCTGTGG + Intronic
1023256637 7:38318925-38318947 TTCCTGGGGAAGACTGCCTGGGG - Intergenic
1023528555 7:41130204-41130226 GTGCTGAGGAACACAGGGTGAGG - Intergenic
1023834068 7:44058301-44058323 GGCCTGGGGGACCCACCCTGAGG + Intronic
1023902263 7:44490744-44490766 GGTCTGGGGAAAACAGCCCGGGG - Exonic
1024252617 7:47517897-47517919 GAGCTGGGTCACACAGCCTGAGG + Intronic
1026571559 7:71535865-71535887 GCCTTGGGGAACTCAGCCTCAGG - Intronic
1026953085 7:74360388-74360410 GTCCAGGGTGACACAGCCAGAGG - Intronic
1030817242 7:114053018-114053040 GTCCTGGAGCACAAAGCGTGAGG + Intronic
1033597822 7:142869158-142869180 AGCCTTGGGGACACAGCCTGGGG + Intronic
1034354874 7:150444131-150444153 GGCCAGGGAAACAGAGCCTGTGG - Intergenic
1035027768 7:155836951-155836973 GTCCTGAGCTACACAGCCAGAGG - Intergenic
1035093088 7:156330742-156330764 GTCCTGCGGGACTCAGCCTCAGG + Intergenic
1035288437 7:157821418-157821440 GTCCTGAGGAACCCAGCATTTGG + Intronic
1035338276 7:158143940-158143962 GTCCTGGGGAGCTCCGGCTGCGG - Intronic
1036223814 8:6942112-6942134 GTGCTGGGCAACTCAGCATGGGG - Intergenic
1037710445 8:21351255-21351277 GCTCTCGGGAGCACAGCCTGGGG - Intergenic
1040998359 8:53424444-53424466 GTCCTGGGAAACAAAGCTAGTGG - Intergenic
1041119436 8:54571251-54571273 GTCCTGGGGAAATCAGTCTATGG - Intergenic
1043552838 8:81394219-81394241 CTCCTGGGAAATACAGTCTGGGG + Intergenic
1044628248 8:94255483-94255505 GTCCTGGTGCACACAGCCAGAGG - Intronic
1045294100 8:100859205-100859227 CTCTTGGGGAAGACAGCCTGGGG + Intergenic
1048581086 8:135730322-135730344 AGCCTGGCTAACACAGCCTGAGG - Intergenic
1048665320 8:136654862-136654884 TTCCTGGAGATCACAGGCTGTGG - Intergenic
1049580033 8:143406994-143407016 GTCCTGGCACCCACAGCCTGAGG + Intergenic
1049938505 9:522570-522592 GGCCTGGAGAACAAACCCTGGGG - Intronic
1050084319 9:1948930-1948952 GTCCTGGGAATCACTGCCTTGGG + Intergenic
1051547264 9:18290702-18290724 GTAAAGGGGAACACTGCCTGTGG - Intergenic
1053211963 9:36237501-36237523 GTCCTTGGGATCCCAGCCTAGGG - Intronic
1056108777 9:83373773-83373795 GTCCTGGGGTACCCATCCTGAGG + Intronic
1056519273 9:87385074-87385096 ATCCTGGGAAACAAAGCCAGGGG + Intergenic
1056789932 9:89618659-89618681 CCTCTGGGGAACCCAGCCTGAGG + Intergenic
1057207725 9:93183775-93183797 GCCCTCGGGAGCCCAGCCTGGGG - Intergenic
1057317128 9:93976776-93976798 GTTCTGGGGGACAGAGCCTAAGG - Intergenic
1058428978 9:104901270-104901292 GTCCTGGGGATCTCAGCTTCTGG + Intronic
1060186812 9:121568617-121568639 GGCCAGGGGCAGACAGCCTGAGG + Intronic
1060209499 9:121701025-121701047 TTCCTGGGGAAGACAGCCGAAGG - Intronic
1060624358 9:125096699-125096721 CTTCTGGGGAACCCAACCTGAGG + Intronic
1061421207 9:130473650-130473672 GCTCAGGGGAACAGAGCCTGGGG + Intronic
1061899400 9:133665363-133665385 GTCCTGGGGGCCACAGCCCTGGG - Intronic
1062333063 9:136052987-136053009 TTCCTGGGGGTCACAGCCAGTGG - Intronic
1062452508 9:136621548-136621570 GTGCTGGGGAGGTCAGCCTGGGG - Intergenic
1186159278 X:6759727-6759749 GAGCTGGGGAACACGTCCTGAGG - Intergenic
1186481322 X:9898136-9898158 GTCCTGAGGAAGGCAGCTTGAGG + Intronic
1192439699 X:71165557-71165579 GCACTGGGGGACAGAGCCTGGGG - Intronic
1196596469 X:117551524-117551546 GTTCTTGGGAAGGCAGCCTGTGG + Intergenic
1197017667 X:121647171-121647193 GTGCTGGAGAAGACAGCTTGAGG + Intergenic
1199107539 X:143888373-143888395 TTCTTGGGGAACACAGGCTTTGG + Intergenic
1200070520 X:153526870-153526892 GTCCTTGGGAGTACAGGCTGGGG - Intronic