ID: 1102459084

View in Genome Browser
Species Human (GRCh38)
Location 12:113089203-113089225
Sequence CAGGGTGGCTGGAGTGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 989
Summary {0: 2, 1: 2, 2: 25, 3: 139, 4: 821}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102459073_1102459084 25 Left 1102459073 12:113089155-113089177 CCCTGGGGTGGGAGTGTGCCTGG 0: 1
1: 6
2: 30
3: 159
4: 641
Right 1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG 0: 2
1: 2
2: 25
3: 139
4: 821
1102459076_1102459084 7 Left 1102459076 12:113089173-113089195 CCTGGCATGCTTGAGAAAGAGCA 0: 1
1: 1
2: 5
3: 43
4: 276
Right 1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG 0: 2
1: 2
2: 25
3: 139
4: 821
1102459075_1102459084 24 Left 1102459075 12:113089156-113089178 CCTGGGGTGGGAGTGTGCCTGGC 0: 1
1: 3
2: 26
3: 117
4: 607
Right 1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG 0: 2
1: 2
2: 25
3: 139
4: 821

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102459084 Original CRISPR CAGGGTGGCTGGAGTGGAGT GGG Intronic
900423157 1:2564424-2564446 AGGGGTGGCAGGAGAGGAGTTGG - Intronic
900431697 1:2605823-2605845 GAGGGTGGCGGGGGTGGGGTGGG + Intronic
900615972 1:3565812-3565834 GAGCGTGGCTGGAGCAGAGTTGG - Intronic
900721059 1:4176070-4176092 CAGGCTGCCTGGGGTAGAGTTGG - Intergenic
900742032 1:4336178-4336200 CAGGGAGGCTGGGGAGGAGGAGG + Intergenic
901762189 1:11478717-11478739 CGGGCTGGCTGGAGAGGAGCGGG + Intergenic
901926082 1:12567112-12567134 CAGGGTGGCAGGAGGGGAGCAGG - Intergenic
901928739 1:12583538-12583560 ATGGGTGGATGGAGTGGGGTGGG - Intronic
902234631 1:15049471-15049493 CTGGGGGGCTGGGGTGGAGGGGG - Intronic
902539711 1:17145540-17145562 CAGCGTGGCTGGAGAGAAGTGGG - Intergenic
902961170 1:19963713-19963735 CAGAGTGGCTGGAGTGAAGCGGG - Intergenic
903060403 1:20664850-20664872 CAGGGGGGCGGGAGTGGGGTGGG - Intronic
903180010 1:21600486-21600508 CAAAGAGGCTGGAGTGGGGTGGG - Intronic
903293504 1:22329303-22329325 CTGAGTGGCTGGAGTAGAGTGGG - Intergenic
903320560 1:22540658-22540680 CAGGGTGGCTGGAGCAGAGTGGG + Intergenic
903351317 1:22718252-22718274 TAGGGAGGCTGAATTGGAGTGGG - Intronic
903662860 1:24989332-24989354 AAGGGTGGGAGGAGAGGAGTTGG + Intergenic
903997659 1:27317770-27317792 CACCCTGGCTGGAGTGCAGTGGG - Intergenic
904263845 1:29306620-29306642 CTGGGTGGCTGGAGAGGAGAGGG + Intronic
904552237 1:31328666-31328688 GGGTATGGCTGGAGTGGAGTGGG + Intronic
904601970 1:31678186-31678208 CAGGGTGGCGGGGGTGGGGAGGG + Intronic
904809936 1:33156935-33156957 CAGGGTGGTGGTAGTGGAGGGGG - Intronic
904824936 1:33268267-33268289 CAGAGTGGGTGGAGGGGACTTGG + Intronic
904910249 1:33929226-33929248 GAGGGTGGCCGGAGTAGAGGTGG - Intronic
904936210 1:34131533-34131555 CTAGGTCCCTGGAGTGGAGTTGG - Intronic
904940429 1:34162240-34162262 CAGGGAGGCTGGGGTGGGGAGGG + Intronic
905018364 1:34792680-34792702 CAGGGTGGCTGGATTTGAAGGGG - Intronic
905030746 1:34882861-34882883 CCATGTGGCTGGTGTGGAGTGGG - Intronic
905521759 1:38605777-38605799 CAGGGGGGCTGGAGAGGAGGTGG - Intergenic
905721489 1:40206719-40206741 CAAGGCGGCTGGAGAGTAGTGGG - Intronic
905750721 1:40461103-40461125 CACCCAGGCTGGAGTGGAGTGGG - Intronic
905771741 1:40642569-40642591 AAGGGTGGCTGGAAGGGAATAGG - Intronic
905815168 1:40944420-40944442 CAGAGTAGCGGGGGTGGAGTGGG - Intergenic
905825552 1:41023661-41023683 AAGGGAGGCTGGAGTGATGTGGG - Intergenic
905868753 1:41391165-41391187 CAGGGTGGCAGGGATGGAGCAGG + Intergenic
906191423 1:43901794-43901816 CAGGGTGGGTGGGGGTGAGTGGG + Intronic
906321243 1:44818249-44818271 CAGGATGGCAGCAGTGGAGGTGG + Intergenic
906488308 1:46248093-46248115 CAGACTGGGCGGAGTGGAGTGGG - Exonic
906527436 1:46503089-46503111 CAGGGTGGCTGGAGCACAGATGG - Intergenic
906811948 1:48836099-48836121 CAGGGTGGTGGCAGTGGAGATGG + Intronic
907221276 1:52908459-52908481 CACCGAGGCTGGAGTGCAGTTGG - Intronic
907526929 1:55059194-55059216 CAGAGTGGGTGGAGTGGAGCTGG + Intronic
907869196 1:58427514-58427536 CAGGGTGGCAGCAGTGCAGCTGG + Intronic
908240974 1:62188760-62188782 TAGGGTGACTGGGATGGAGTTGG + Intergenic
908393281 1:63702791-63702813 CAGGGGGGCTGGAGTGGGAGAGG + Intergenic
908496817 1:64702678-64702700 AAGGGTAGCTGGGGTGGGGTGGG - Intergenic
908789795 1:67770272-67770294 CAAGGTGGGTGGAATGGAGAGGG + Intronic
908828003 1:68151994-68152016 TAGGGTGGCAGCAGTGGAATTGG + Intronic
909180164 1:72413761-72413783 CATGGTGGCTGGACTATAGTGGG + Intergenic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
909768237 1:79385740-79385762 CAAGGTATCTGGAATGGAGTAGG + Intergenic
910092479 1:83481372-83481394 CTGCGTGGCTGGAGCAGAGTAGG - Intergenic
910757848 1:90710522-90710544 CCCGGGGGCTGGAGAGGAGTAGG + Intergenic
911057456 1:93720927-93720949 GGAGGTGGCTGGAGTGGAGCAGG + Intronic
911156701 1:94644040-94644062 TGGCGTGGCTGAAGTGGAGTGGG - Intergenic
911651784 1:100397182-100397204 CAGGGTTGCTGGAATGATGTGGG + Intronic
912365963 1:109134197-109134219 GAGGCTGGCAGGAGTGGATTTGG - Intronic
912679727 1:111721405-111721427 CATGGTGGGTGGAGGCGAGTTGG + Intronic
912679892 1:111722328-111722350 CAGGGTGGCCGGAGGGCAGGAGG + Exonic
912699491 1:111866303-111866325 CAGGCTGGATGGAGCGCAGTGGG + Intronic
913011505 1:114688166-114688188 CACGCAGGCTGGAGTGCAGTGGG + Intronic
914319460 1:146545078-146545100 CAGGGTGGCGGGGGTGGAGGTGG + Intergenic
914983675 1:152438727-152438749 GAGGGTGGATAGAGGGGAGTTGG + Intergenic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915462116 1:156076527-156076549 CAGGGTGGGCCCAGTGGAGTGGG + Exonic
915978916 1:160408219-160408241 CAGGGTGGGTGGAGCTGGGTGGG + Intronic
916484807 1:165249355-165249377 TGGGGTGGGTAGAGTGGAGTTGG - Intronic
916511482 1:165475560-165475582 CAGGGTGCCTGGCCTGCAGTAGG - Intergenic
916573695 1:166048970-166048992 CAGTGTGGCTGGAGTGGAATAGG - Intergenic
916983914 1:170169779-170169801 AAGGGTGGCTTGAGAGAAGTTGG + Intergenic
917029326 1:170671758-170671780 CAGGGTGGCAGGAGGGGAGTGGG + Intronic
917218441 1:172702265-172702287 CAGTTTGTCTGGAGTGGAGTGGG + Intergenic
917793416 1:178514317-178514339 CTGAGTGGCTGCCGTGGAGTGGG + Intronic
918068739 1:181119577-181119599 CAGGGTGGCTGCAGGGGATCTGG + Intergenic
918180388 1:182081920-182081942 CAGGATGGCTGGAATGTAGCAGG + Intergenic
918565507 1:185925818-185925840 CATGAAGGCTGGAGTGGACTGGG + Intronic
918649632 1:186945252-186945274 CCGTGTGGCTGAAGTGAAGTGGG + Intronic
919468609 1:197951636-197951658 CAGGATGACTGGGGTGGGGTTGG - Intergenic
920242849 1:204566204-204566226 CTTGGTGGCTGGTGGGGAGTTGG - Intergenic
920768693 1:208858952-208858974 CAGTGTGGTTGGAGTAAAGTGGG + Intergenic
921304570 1:213782883-213782905 CAGACAGGCTGGAGTGAAGTTGG + Intergenic
921819447 1:219600599-219600621 CAGCAAGGCTGGAGGGGAGTGGG + Intergenic
921985016 1:221303430-221303452 CAGGGTGAGTGGGGTGGGGTGGG + Intergenic
922162561 1:223089200-223089222 CAGGGTGGGTGGGTTGGAGGTGG - Intergenic
922205192 1:223440270-223440292 CAGGGAGGGTGGAGTAGAGATGG + Intergenic
922233456 1:223705635-223705657 CAGGGTGCTGGGAGAGGAGTTGG - Intronic
922350304 1:224729758-224729780 CTGTGTGGCTGGATTGGAGGTGG + Intronic
922521393 1:226255393-226255415 CGGGGTGGCTAGAGTGGGCTGGG - Intronic
922811366 1:228417036-228417058 CAGGGTGGGGGGAGTGGGATTGG + Intergenic
923042653 1:230330735-230330757 CAGGGTCCCTGGAGTGGGGAGGG + Intronic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923229497 1:231971550-231971572 CAGGGTGGCTGGAGAGGAAGGGG - Intronic
923271255 1:232357161-232357183 CGGGGTGGCTGCAGTGGAGGTGG + Intergenic
923326262 1:232882900-232882922 CAGAGTGGATGGTGTGGAGTGGG - Intergenic
923333352 1:232946177-232946199 CAGTGTGGCCGGAGCAGAGTAGG - Intergenic
923533805 1:234832565-234832587 CTGAGTGACTGGAGTGGAGCTGG - Intergenic
923546514 1:234927479-234927501 CAGGCTGGGTGGAGGGCAGTGGG - Intergenic
923691032 1:236192933-236192955 CACCCAGGCTGGAGTGGAGTGGG + Intronic
923786075 1:237070724-237070746 CATGCTGGCTGGGGTGGGGTGGG + Intronic
923978589 1:239294501-239294523 CAGGGTGGTGACAGTGGAGTAGG - Intergenic
923978957 1:239298413-239298435 CAGGGGGACTGGAGTGGGGAGGG - Intergenic
924463634 1:244281516-244281538 CAGGATGGGTGGAGTGCAGTGGG - Intergenic
1063535145 10:6876142-6876164 CTGGGTGGCAGGGTTGGAGTGGG - Intergenic
1064144938 10:12819838-12819860 CAGCGTGGCAGGGATGGAGTGGG + Intronic
1064502124 10:15985013-15985035 CACGCAGGCTGGAGTGCAGTGGG + Intergenic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1065536820 10:26723063-26723085 TGGGGAGGGTGGAGTGGAGTGGG - Intronic
1067221366 10:44346555-44346577 TAGGGTGGCCTGAGCGGAGTAGG + Intergenic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067559933 10:47298241-47298263 CAGGCTGGCTTGAATGGAGCGGG + Intergenic
1067775968 10:49165174-49165196 AATGGTGGCTGGAGTCGAGAGGG + Intronic
1068276338 10:54803427-54803449 TAAGGTGGCTGGGGAGGAGTGGG + Intronic
1068603769 10:58982677-58982699 CAGGGAAGCTGGAGTGTATTAGG + Intergenic
1068880872 10:62047645-62047667 CAGGGTGGCTGGAAGGAGGTGGG + Intronic
1069605022 10:69733396-69733418 CAGTGTGGCTGGGGTGTAGTTGG + Intergenic
1069606634 10:69743049-69743071 CATGGTGGCAGGAGTGGGGAGGG - Intergenic
1069707155 10:70466030-70466052 CGGGGAGGCTGGAGGGGAGAGGG + Intergenic
1069957228 10:72059678-72059700 CAGGCGGGCTGGAGTGAAGGGGG + Exonic
1070319187 10:75342171-75342193 CAGGCTGGGTGGGGTGGGGTGGG + Intergenic
1070941415 10:80351488-80351510 CAGTGTGGATGGAGTGGTGGGGG - Intronic
1071151126 10:82635826-82635848 CAGGGAGGCTGCAGTGGACTAGG + Intronic
1071552696 10:86579233-86579255 GAGGGTGGCTAGAGTGGGCTTGG + Intergenic
1071558922 10:86630515-86630537 CTGGGGGTCTGGAGTGGTGTAGG - Intergenic
1071573606 10:86711118-86711140 AGGGGAGGCTGGAGAGGAGTTGG + Intronic
1072976800 10:100065825-100065847 TGGGGTGGGTGGAGTGGGGTGGG + Intronic
1073137131 10:101226296-101226318 GAGGGTGGCTGGATGTGAGTGGG - Exonic
1073362000 10:102907282-102907304 CACCGAGGCTGGAGTGCAGTGGG + Intergenic
1073911156 10:108346285-108346307 GAGGGTGGGTGGAGTGGAGCTGG + Intergenic
1074454067 10:113582156-113582178 CAGGGTGGCTTGAGTGGCTGGGG + Intronic
1074473040 10:113744578-113744600 CAGGGGGGCTGGGGTGGGGTAGG - Intergenic
1074776597 10:116771902-116771924 CAGCCTGCCTGGACTGGAGTTGG - Intergenic
1075107692 10:119552624-119552646 CAGGGTAACAGGAGTGCAGTGGG + Intergenic
1075449960 10:122544461-122544483 CAGGCTGCCAGGTGTGGAGTAGG + Intergenic
1075504295 10:123008800-123008822 CAGGGGGGCGGGAAGGGAGTCGG - Exonic
1075797995 10:125134839-125134861 CAGGGTAGGTGGAGTGGGGAGGG - Intronic
1076057465 10:127387216-127387238 CAGTGTGGCTGGAATGCAGAGGG - Intronic
1076078281 10:127554927-127554949 CAGGGTGTGTGGAGTGGGGCAGG + Intergenic
1076806695 10:132862432-132862454 CAGGGTGGGTGGGGCGGGGTGGG + Intronic
1076987678 11:251072-251094 CAGGGTGGTGGCAGTGGGGTGGG - Intronic
1077350938 11:2092924-2092946 CAGGGTGGCTGCAGAGGGGATGG - Intergenic
1077504217 11:2922674-2922696 CTGTGTGGGTTGAGTGGAGTGGG + Intronic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1077594398 11:3519243-3519265 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
1077603016 11:3586908-3586930 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1078211039 11:9269661-9269683 CAGGGTGGCTGGAGAGGGTTAGG + Intergenic
1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG + Intergenic
1078484361 11:11707854-11707876 CAGGGTCACTGGAGTGAAGGTGG + Intergenic
1078576016 11:12503405-12503427 TATGGTGATTGGAGTGGAGTGGG + Intronic
1078860117 11:15239091-15239113 GGCTGTGGCTGGAGTGGAGTGGG + Intronic
1078895074 11:15590837-15590859 CAGTGTGGCTGGAGTGGGTAGGG - Intergenic
1080319362 11:30988542-30988564 CTGGGAGGCTGGAGAAGAGTGGG - Intronic
1081695676 11:45107531-45107553 GAGGGTGGATGGGGTGCAGTGGG + Intronic
1083001379 11:59294618-59294640 CAGGCTGGCTGGAGTGTAGTGGG + Intergenic
1083256866 11:61501937-61501959 CAGGCTGGATGGAGTGCAATGGG + Intergenic
1083479415 11:62934056-62934078 CAGAGTGGCCAGAGTGGGGTGGG - Intergenic
1083486018 11:62983496-62983518 CTGGGTGGCCGGAGGGGAGTGGG + Intronic
1083597059 11:63922990-63923012 TATGGTGGCTGGAGTGGTGGAGG - Intergenic
1083638042 11:64130748-64130770 CAGGGTGGCGGGTGGGGAGGTGG - Intronic
1083698009 11:64455546-64455568 CGGGGTGTCTGTAGTGGAGAGGG + Intergenic
1083855903 11:65392981-65393003 CAAGGTGGCAGGAGCAGAGTGGG + Intronic
1084032704 11:66490467-66490489 GAGGGGAGCTGGAGTGAAGTTGG - Intronic
1084250248 11:67892520-67892542 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
1084258896 11:67961446-67961468 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1084270597 11:68027252-68027274 CAGCCTGGGTGGAGTGGGGTTGG - Intronic
1084434820 11:69132552-69132574 CAGGGAGGCTGGAATGGAGTTGG - Intergenic
1084730699 11:71071720-71071742 CAGAGTGGCTGGAGGGGCCTGGG + Intronic
1084813851 11:71633732-71633754 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1084822543 11:71702826-71702848 CAGAGTGGCTGAAATAGAGTAGG + Intergenic
1085472393 11:76766700-76766722 CAGGGAGGATGGAGAGGAGACGG - Intergenic
1085645595 11:78220300-78220322 CAAGGTGCCTGGAGTAGAGTTGG - Exonic
1085882255 11:80481353-80481375 TAGGGTGACTGGAGGGGAGCTGG + Intergenic
1086472425 11:87129579-87129601 CACCCAGGCTGGAGTGGAGTGGG + Intronic
1087078167 11:94144690-94144712 GAGGCTGGGTGGAGTGGAGAAGG - Intronic
1087317051 11:96615119-96615141 CAGGGAGACGGGAGTGGAGCTGG - Intergenic
1087585468 11:100114937-100114959 AATGGTGGGTGGAGTGGAGTGGG - Intronic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1087762057 11:102111471-102111493 GAGGTTGGCGGGAGTGGAGGAGG + Intronic
1087825035 11:102755367-102755389 CAATGTGGCTGGAGCAGAGTGGG + Intergenic
1087953080 11:104249352-104249374 GAGGCTGGGTGGGGTGGAGTAGG + Intergenic
1088585574 11:111357613-111357635 CAGGGTGGCCGGGGTGGGCTGGG + Exonic
1089652919 11:119926379-119926401 CAGGGTGGATGGAGTAGGGCTGG - Intergenic
1089658090 11:119966446-119966468 GAGGATAGCTGGAGTGGAGTGGG + Intergenic
1089662685 11:119995914-119995936 CATGGGGGATGGAGTGGAGGGGG - Intergenic
1089778769 11:120858177-120858199 CAGTGTGGCTGGGGCGGGGTTGG + Intronic
1089973194 11:122710857-122710879 CAGGGTGGTGGGGGTGGAGATGG + Intronic
1090877835 11:130806797-130806819 CAGGGTGGGAGGAGGGGAATGGG - Intergenic
1091030272 11:132180763-132180785 AAGGCTGGGTGGAGTGGAGGTGG - Intronic
1091281408 11:134383736-134383758 CAGGCTGGCTGGAGTTGCGCGGG + Exonic
1091302601 11:134516911-134516933 CAGGGAGCTTGGAGTGGAGAGGG + Intergenic
1091548140 12:1518311-1518333 CATGGTGGCTGTGGTGGAGGTGG - Intergenic
1091574647 12:1721878-1721900 CAGTGTGGCTGGAATGTAATGGG + Intronic
1091744360 12:2981774-2981796 CAGGGGTGCTGGAGGGTAGTGGG + Intronic
1091752805 12:3033166-3033188 CAGGGAGGCTGGACTGGAGACGG - Intronic
1091817794 12:3453110-3453132 CAGGTAGGCTGGAGAGGAGAGGG + Intronic
1092162580 12:6324184-6324206 CAGGGTTGCTGGAGAGGCTTTGG + Intronic
1092420571 12:8328032-8328054 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
1092430222 12:8402454-8402476 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1093216174 12:16363866-16363888 CAGGATGGCTGTAGAGGGGTCGG - Exonic
1094084385 12:26573761-26573783 CAGTGTGGATGGAGCAGAGTTGG + Intronic
1095453719 12:42360064-42360086 CAGGCTGGATGGAGTGCAATGGG - Intronic
1095577439 12:43757015-43757037 CAGAGTAGCTGGAGTATAGTGGG - Intronic
1095826800 12:46538238-46538260 CAGGATGGCTGATGAGGAGTTGG + Intergenic
1096480063 12:51934216-51934238 CAGAGTGGCTGGAGGGGTGTGGG - Intergenic
1096648823 12:53052222-53052244 CAGGGTGGGTGGAGGTGAGGAGG - Intronic
1096878394 12:54647993-54648015 CAGAGTGGTTGGAGCAGAGTGGG + Intronic
1097086421 12:56471707-56471729 CATGGTGGCTGGAGGGTAGGTGG + Exonic
1097156637 12:57016613-57016635 CAGGGTGGCTGGAGGGGAGGCGG + Intronic
1097348343 12:58519940-58519962 CAGGGTGTGTGGATTGGATTTGG - Intergenic
1097637214 12:62137653-62137675 CAGGGTGGTTGGAGTGGAGGTGG - Intronic
1098009662 12:66037119-66037141 CAGGGTGGAGGGATAGGAGTAGG + Intergenic
1098236718 12:68424689-68424711 CAGGGTGGCAGCAGTAGAGGAGG + Intergenic
1098818087 12:75193755-75193777 CAGGGTGGGTGGATAGGAGCAGG - Intronic
1099338516 12:81396497-81396519 CAGTGTGGCTGGGGTGGATTTGG + Intronic
1100100243 12:91094739-91094761 CAGTGTGTTTGGAGAGGAGTGGG + Intergenic
1100268139 12:92998233-92998255 CTGGCAGGCTGGAGTGCAGTGGG + Intergenic
1100445689 12:94657474-94657496 TAGGGTGGCTGGAATGGTGGGGG + Intergenic
1100815034 12:98378678-98378700 CAGTGTGGGTGAAGTGAAGTGGG - Intergenic
1100904515 12:99282300-99282322 CAGTGTGGCTGGAGCAAAGTGGG + Intronic
1101059908 12:100959949-100959971 CAGGATGGCAGAAGTGGAGGAGG + Intronic
1101373489 12:104151464-104151486 CAGGGGAGGTGGGGTGGAGTGGG - Intergenic
1101440902 12:104703705-104703727 CAGTGAGCCTGGAATGGAGTGGG - Intronic
1101646881 12:106639365-106639387 CAGAGTAGCAGGAGTGGAGTGGG - Exonic
1101718904 12:107334307-107334329 CAGGGTGGTAGCAGTGGAGGTGG + Intronic
1101735494 12:107459941-107459963 CAGGGGGGCAGGGGTGGGGTTGG + Intronic
1102189195 12:110973289-110973311 GAGGGTGGCGGGTGGGGAGTGGG + Intergenic
1102233730 12:111281223-111281245 CCCAGTGGCTGGAGTGGAGTTGG - Intronic
1102311097 12:111844887-111844909 CAAGGTGGCTGGAATGCAGTGGG + Intronic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1102467852 12:113140885-113140907 CTGGGTGGCTGGAGTGATCTTGG + Intergenic
1102516085 12:113447819-113447841 CAGGGTGGCTGCAGGGAAGAGGG + Intergenic
1102701595 12:114844053-114844075 CAAGTAGGCTGGAGTGCAGTGGG + Intergenic
1102843181 12:116148075-116148097 GAGGGGGGCGGGAGTGGAGGGGG + Intronic
1102978804 12:117225565-117225587 CTGGGTGGCAGGGGTGGGGTGGG + Intronic
1103399303 12:120632081-120632103 CACGGTGGCTGGAATGTGGTGGG + Intergenic
1103963156 12:124621973-124621995 CAGAGTGGCTGGACTGGGGGTGG - Intergenic
1104061997 12:125276554-125276576 CTGAATGGCTGGAGTGGAGTTGG + Intronic
1104197762 12:126557185-126557207 CACCCTGGCTGGAGTGCAGTGGG - Intergenic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1104732706 12:131116833-131116855 CAGGGTGGCTGCACTAGAGCAGG + Intronic
1104771632 12:131367665-131367687 TAGGGCGGGTGGAGTGGGGTCGG + Intergenic
1104971504 12:132532841-132532863 CAGGGAGGCTGGAGGTGGGTGGG + Intronic
1104986474 12:132600432-132600454 CAGCGTGACGGGACTGGAGTGGG - Intergenic
1105277987 13:18947360-18947382 CAGAGTGGCTGGGGTGCAGGAGG - Intergenic
1105496988 13:20939031-20939053 CAGGGTGGAGTGAGTGCAGTGGG - Intergenic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1106098633 13:26673958-26673980 CGGGGAGGCTGGAGAGGTGTGGG + Intronic
1106413596 13:29527791-29527813 CAGGGTGGCTGGTGTGAGGGTGG - Intronic
1106644353 13:31616599-31616621 CAGGCAGGCTGGAGTAAAGTGGG - Intergenic
1106644392 13:31616808-31616830 CAGGTTGGTTGGAGTGGGGGTGG + Intergenic
1107707641 13:43123164-43123186 TAGGGGGGCTGGAGCAGAGTGGG - Intergenic
1107843210 13:44481641-44481663 CAGGGTGGGTGGAGTTAGGTGGG - Intronic
1108461265 13:50669831-50669853 CAGGTGGGCTGGAGTGGTGTGGG - Intronic
1108727711 13:53200741-53200763 CACGGTGGCCGAAGTGGAGCTGG + Intergenic
1109114011 13:58357803-58357825 AAGGGTGGAGGGAGTGGAGATGG - Intergenic
1110289165 13:73784591-73784613 CAGAGATGCTGGAGTGGAGGAGG - Intronic
1110425035 13:75357481-75357503 CAGTGTGGCTGGAGTTGGGGAGG - Intronic
1110599015 13:77350287-77350309 CAGGCAGGCTGGAGTGCAATGGG - Intergenic
1110884642 13:80617897-80617919 CACGCAGGCTGGAGTGCAGTGGG - Intergenic
1110904400 13:80867358-80867380 AAGGCTGGCTTGAGGGGAGTAGG - Intergenic
1112128925 13:96499739-96499761 CAGTGTGGCTGAAGCTGAGTGGG + Intronic
1112130287 13:96516100-96516122 CAGCCAGGCTGGAGTGCAGTGGG + Intronic
1112378708 13:98868142-98868164 CAGGGTGACTAGAATAGAGTAGG - Intronic
1113351687 13:109535735-109535757 GAGGGTGGCTGAAGCAGAGTGGG + Intergenic
1113924588 13:113934406-113934428 CAGGATGGATGGAGATGAGTCGG + Intergenic
1114247756 14:20930501-20930523 CCAGGTGGCTGGACTGGAGAAGG - Intergenic
1114450322 14:22821283-22821305 CAGTGAAGCTGGAGTGGAGTGGG - Intronic
1114547321 14:23512536-23512558 AGGGGTGGCTGGGGTGGGGTGGG - Intergenic
1115678673 14:35711705-35711727 CAGGGTGGTTGGAGTTCAGGTGG - Intronic
1115704109 14:35980842-35980864 CGGGGTGGCAGGAGTGGGGAGGG - Intergenic
1116877204 14:50123837-50123859 CAGGGTGGCAGCAGTGGAGATGG + Intronic
1117133987 14:52714823-52714845 CAGCCAGGCTGGAGTGCAGTGGG - Intronic
1117160992 14:52989500-52989522 AAGGGTTGTTGGAGGGGAGTGGG - Intergenic
1118026253 14:61772135-61772157 CACCGTGGCTGGAGCGCAGTAGG + Intronic
1118145284 14:63128181-63128203 ATGGGTGGCTGGAGAGGAGCTGG + Intergenic
1118351701 14:64976810-64976832 CAGTGTGGCTGGGGTGGGGATGG - Intronic
1118584764 14:67341573-67341595 CAGGGTGGCTGGCCTGGCGGGGG - Intronic
1119068077 14:71550970-71550992 CAGTGTGGCTGGAGAGGAAAGGG - Intronic
1119068163 14:71551748-71551770 CAGTGTGGCTGGAGGGGAAAGGG - Intronic
1119664015 14:76471514-76471536 CAGGGAGGCTGGAGCAGAGTGGG - Intronic
1120106600 14:80502355-80502377 CAGGATGGCTGCTGTGCAGTGGG + Intronic
1120673112 14:87387262-87387284 CAAGGAGGCTGGAGTGGCGACGG + Intergenic
1120795865 14:88632252-88632274 CAGGGTGGCAGGAGTGAATGTGG - Intronic
1120823618 14:88935452-88935474 CAGAGTGGCTGGAGAGGAGAAGG - Intergenic
1121133504 14:91472502-91472524 CAGGCTGGATGGAGTGCAGTGGG + Intronic
1121230672 14:92355277-92355299 GAGTGTGGCTGGAGCGGGGTGGG + Intronic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1121288456 14:92755097-92755119 CATTGTGGCTGGAGTGGAGCAGG - Intergenic
1121485351 14:94310409-94310431 CAGGCTGGCAGGGGTGGAGATGG - Intronic
1121498221 14:94412505-94412527 CAGTATAGCTGGAGTGGAATGGG - Intergenic
1121525153 14:94614356-94614378 CAGGCTGGGTGGAGGGCAGTGGG + Exonic
1122005156 14:98697392-98697414 CAGAGAGGCAGGAGTGGAGGTGG + Intergenic
1122010444 14:98742011-98742033 AAGGGTGGCAGGAGTGTGGTTGG - Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122267583 14:100553935-100553957 CAGGGTGACTTCAGTGGAGCAGG + Intronic
1122847152 14:104506281-104506303 CAGGGAGGCAGGAGAGGAGGAGG - Intronic
1122859834 14:104577581-104577603 GAAGGTGGCCGGGGTGGAGTAGG - Intronic
1122988058 14:105221700-105221722 CAGGCTGGCTGCAGTGGGGAGGG + Exonic
1123185259 14:106510613-106510635 CAGGATGGCTGTAGTGGAGGAGG + Intergenic
1124014967 15:25866172-25866194 CGGGGTAGCTGGAGCTGAGTGGG + Intergenic
1124545851 15:30626135-30626157 CCGGGTGTCTGCAGTGGAGCTGG + Intronic
1124805538 15:32878226-32878248 CCGTGTGGCTGGAGTTTAGTGGG + Intronic
1125090907 15:35791598-35791620 TAGGGTTGGGGGAGTGGAGTTGG + Intergenic
1125343180 15:38694443-38694465 CTGGTGGGCTGGAGTAGAGTAGG + Intergenic
1125807483 15:42506278-42506300 CAGGCAGGCTGGAGTGTAGTGGG + Intronic
1125887246 15:43238139-43238161 CAGGGTGGCTGAAGGGCGGTGGG - Intronic
1126108641 15:45162947-45162969 CAGGGGTGCTGGAATGCAGTGGG + Intronic
1126132838 15:45359818-45359840 CCAGGTGGAGGGAGTGGAGTGGG - Intergenic
1126636486 15:50785155-50785177 CATCGAGGCTGGAGTGCAGTGGG - Intergenic
1126750021 15:51867096-51867118 CAGTGTGACTGGAATGGAGAGGG + Intronic
1127172907 15:56322194-56322216 CAGTGTGGATAGAGAGGAGTAGG + Intronic
1127403008 15:58610471-58610493 CAGGGTCTGTGCAGTGGAGTAGG - Exonic
1127537151 15:59900649-59900671 CCTGGTGGCTGGTGTGCAGTTGG - Intergenic
1127961852 15:63896013-63896035 CAGGGAGGCTGGCCTGGAGCAGG - Intergenic
1128252951 15:66176403-66176425 TAGGGAGGCTGGGGTGGAGGGGG + Intronic
1128285641 15:66434851-66434873 CCGGGTGGCTGGAGTGAAGTGGG + Intronic
1128506489 15:68276814-68276836 CAGTGTGGCTGCAGCAGAGTGGG - Intergenic
1128686149 15:69687167-69687189 CAGGGGTGCTGGGGTGGTGTGGG + Intergenic
1128768243 15:70264136-70264158 GCGGGTAGCAGGAGTGGAGTAGG - Intergenic
1128831304 15:70771881-70771903 CAGTGTGGCTGGAGCATAGTGGG + Intergenic
1129262932 15:74378955-74378977 CAGGCCAGCTGGAATGGAGTGGG + Intergenic
1129712341 15:77826695-77826717 CAGGCTGGCTGGAGGTGGGTGGG + Intergenic
1130337270 15:82967208-82967230 CACCCAGGCTGGAGTGGAGTGGG - Intronic
1130767098 15:86881673-86881695 CACGCAGGCTGGAGTGCAGTGGG + Intronic
1130891656 15:88138560-88138582 CAGTGTGGCTGAAGAGGAGGAGG - Intronic
1130923378 15:88367264-88367286 CAGGCTGGCTGGCGTGAAGCAGG + Intergenic
1130995332 15:88900352-88900374 AGGGGTGGTTGGCGTGGAGTTGG - Intronic
1131272770 15:90957072-90957094 CAGGGTGGCCAGAATGGAGGCGG - Intronic
1132265913 15:100470515-100470537 CAGAGTGACTGTAGTGGAGTGGG + Intronic
1132614352 16:832800-832822 CAGGGTGGATGGGGCGGAGCGGG - Intergenic
1132765839 16:1533807-1533829 CAGGGTGGCCGGTGTGGAGCGGG - Exonic
1132845769 16:2000163-2000185 CGGGGTTGCTGCAGTGGAGCAGG + Exonic
1133137270 16:3720760-3720782 CAGGGCTGCTGGAGTGGTCTGGG - Intergenic
1133232013 16:4371472-4371494 CAGGATGGCGGGAGTGGGGCTGG - Intronic
1133235939 16:4387466-4387488 CCATGTGGCTGGTGTGGAGTAGG + Intronic
1133297168 16:4760227-4760249 CAGGGAAGCTGAAGTGAAGTAGG + Intronic
1133359287 16:5161086-5161108 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
1133632187 16:7631623-7631645 CTGGGTGCCTGGAGTGGGGGTGG + Intronic
1133715274 16:8441392-8441414 GGGGGTGGTTGGAGAGGAGTTGG + Intergenic
1133747977 16:8701907-8701929 CAGTGTGGCTGGAGCAGAGCAGG + Intronic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134739205 16:16527590-16527612 CAGGGCAGCTGAAGTGGAGTGGG - Intergenic
1134928295 16:18184561-18184583 CAGGGCAGCTGAAGTGGAGTGGG + Intergenic
1135323886 16:21513798-21513820 CAGGGTCCCTGGAGTGAGGTGGG - Intergenic
1135668969 16:24359056-24359078 CACGGTGGGTGGCGGGGAGTGGG - Intronic
1135747264 16:25027796-25027818 CACCCAGGCTGGAGTGGAGTGGG + Intergenic
1136035283 16:27534645-27534667 CAGGGTGGCAGCTGTGGGGTAGG - Intronic
1136142809 16:28298185-28298207 GAGGGTGGCTGGGGAGGAGAGGG - Intronic
1136335371 16:29607066-29607088 CAGGGTCCCTGGAGTGAGGTGGG - Intergenic
1136511039 16:30738492-30738514 AAGGGCTGCTGGGGTGGAGTGGG - Exonic
1136542477 16:30935807-30935829 CGGGGTGGCTGGAGTCCAGGAGG + Intronic
1137501507 16:49014985-49015007 CAGTGTGGCCGGAGCAGAGTGGG + Intergenic
1137537964 16:49341883-49341905 CTGTGTGGCTGGAGTTCAGTGGG + Intergenic
1137860485 16:51841735-51841757 CAAGGTGGCTGGTGGGGTGTCGG + Intergenic
1137875179 16:51989873-51989895 CAGGGTGGCTGGGGTGTGCTGGG + Intergenic
1138382441 16:56612131-56612153 CACCCTGGCTGGAGTGCAGTGGG + Intergenic
1138566822 16:57839497-57839519 CACCGAGGCTGGAGTGCAGTGGG - Intronic
1138677687 16:58663917-58663939 GAGTGTGGCTGGAGCGGAGAGGG + Intergenic
1139278456 16:65749525-65749547 CAGGGCAGCTGGAGTCGAGTTGG + Intergenic
1139590486 16:67930364-67930386 CAGGGTGGGAGGACTGGGGTGGG - Intronic
1139623565 16:68166357-68166379 CTGGGTGGCTGGAGTGGTTAGGG + Intronic
1139964474 16:70737898-70737920 GAGGGAGGCCGGAGTGGAGCAGG - Intronic
1140014063 16:71165003-71165025 CAGGGTGGCGGGGGTGGAGGTGG - Intronic
1140080593 16:71743560-71743582 CAGCCAGGCTGGAGTGCAGTGGG - Intronic
1140420584 16:74815756-74815778 CAGGGTGGCCGCAGTGGAAGTGG + Intergenic
1140457503 16:75113722-75113744 CAGGTATGCTGGGGTGGAGTGGG - Exonic
1141287963 16:82690204-82690226 GTGGGTGGCTGGGGTGGGGTTGG + Intronic
1141916182 16:87098820-87098842 CAGAGTGGCTGGAGTTGGGCCGG + Intronic
1142342319 16:89531801-89531823 CACGCAGGCTGGAGTGCAGTGGG - Intronic
1142405126 16:89884273-89884295 CAGGGTGGCTGCAGTGTGGCAGG + Intronic
1142809495 17:2388648-2388670 CAGGGAGTCTGGAGGGGAGTGGG - Intronic
1143580419 17:7822344-7822366 CTGCGTGGCTGGAGTGGAGTGGG - Intronic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1143695792 17:8616240-8616262 CACCCAGGCTGGAGTGGAGTGGG - Intronic
1143709147 17:8721900-8721922 CAGGGTAGCTGGAATGAAGAGGG - Intergenic
1143771490 17:9171795-9171817 CTTGGTGTCTGGAGAGGAGTTGG + Intronic
1143861894 17:9897268-9897290 CGGGGTGGCTGGAGGGTAGAAGG - Exonic
1143903090 17:10189292-10189314 CAGGGTGGTGGAAGTGGAGATGG - Intronic
1144465827 17:15496442-15496464 CAGTGGGGCAGGGGTGGAGTGGG - Intronic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1144827725 17:18115772-18115794 CCAGGTGGCTGGAGGGCAGTGGG - Intronic
1145147895 17:20495882-20495904 AGGGGTGGGTGGAGTGGGGTGGG - Intergenic
1145392023 17:22462416-22462438 GAGGGTTGCTGGAGTGAAGAAGG - Intergenic
1145403935 17:22569715-22569737 CATGGTGGCAGGGGTGGTGTCGG - Intergenic
1145414506 17:22703789-22703811 CAGTGCGGCTGGGGTTGAGTTGG + Intergenic
1145987603 17:29057639-29057661 CAGGGTGGGTGGAGGGGTGAGGG + Intergenic
1146017684 17:29246996-29247018 TAGGGTGGCTGGAGAAGAGTGGG + Intronic
1146035385 17:29401693-29401715 TTGGGAGGCTGGAGTGCAGTGGG + Intronic
1146273116 17:31497533-31497555 CAGGATGGCTGGGCTGCAGTGGG + Intronic
1146367090 17:32237607-32237629 CTGGGTGGTAGGAGTGGAGATGG - Intronic
1146523811 17:33548736-33548758 CAGCATGGCTAGAGTGGAATGGG - Intronic
1146621383 17:34401251-34401273 CAGGGAGGATGGGGCGGAGTGGG - Intergenic
1147332002 17:39704848-39704870 CAGGGTGGCTGGGCTGGGTTGGG - Intronic
1147359571 17:39922505-39922527 CAGGGTGGCAGGGGAGGGGTAGG - Exonic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147584126 17:41643252-41643274 CTGTGTGGCTGGGGTGGAGTGGG + Intergenic
1147647350 17:42041690-42041712 CAGGGTGACTGGTTGGGAGTTGG - Intronic
1147946869 17:44085275-44085297 CAGGGTGGCTGCAGTGGCCATGG - Intronic
1148050242 17:44766595-44766617 CTGGGTGGCTGGGGAGGTGTGGG - Intronic
1148580561 17:48740585-48740607 CAGGGTGGGAGGAATGGGGTGGG - Intergenic
1148603201 17:48909077-48909099 GAGGGTGGCCGGAATGGAGACGG - Intronic
1148835298 17:50462778-50462800 CAAGAGGGCTGGAGTGGAGAGGG - Intronic
1148871672 17:50662118-50662140 CAGGGTGGCTGGATGGAAGTGGG + Intronic
1149306084 17:55347726-55347748 CTGGGGGGCTGGAGAGGAGTGGG - Intergenic
1149316301 17:55442109-55442131 CACGCAGGCTGGAGTGCAGTTGG + Intergenic
1150149718 17:62799250-62799272 CGGGGTGGTAGGAGTGGAGGTGG - Intronic
1150284653 17:63948083-63948105 CAGGGTGGCTGGGGTCCAGCAGG + Intronic
1150292217 17:63988469-63988491 CAGAGTGGCCTGAGTGGAGTTGG - Intergenic
1150583317 17:66495059-66495081 CACCGAGGCTGGAGTGCAGTGGG - Intronic
1151295120 17:73179626-73179648 CAGGGTGGATGGAGCAGAGCCGG + Intergenic
1151339918 17:73464604-73464626 CCAGGTAGCTGAAGTGGAGTGGG - Intronic
1151487554 17:74410744-74410766 CAGGGTGGCTGGGGTAGAGTGGG + Intergenic
1151653168 17:75482460-75482482 CAGGCTGGATGCAGTGGCGTGGG - Intronic
1151787195 17:76280797-76280819 CAGGGTGGCTGGGATGGGGCCGG - Intronic
1151968228 17:77443291-77443313 CAGGGTGGTTGGATTGGATGTGG + Intronic
1152132793 17:78487116-78487138 CTGGGTGGCTCGTGTGGAGGTGG + Intronic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1152669476 17:81593821-81593843 CAGGGTAGCTGGAGAGCAGCTGG - Intronic
1153238025 18:3006957-3006979 CACTGAGGCTGGAGTGCAGTGGG - Intronic
1153280708 18:3411738-3411760 CAGCGTGGCTGGGGCGGAGTAGG - Intronic
1153475787 18:5497139-5497161 CAGGGTAGCTGGAATGCAGGGGG + Intronic
1153493767 18:5676610-5676632 CAGGATGGGTGGAGTGGAAATGG + Intergenic
1153576899 18:6531323-6531345 CACCGAGGCTGGAGTGCAGTGGG - Intronic
1154192313 18:12241097-12241119 CTGGGTGACTGGAGTGCCGTGGG - Intergenic
1154935939 18:21056792-21056814 CAGTGTGGCTGGAGAGGATTAGG - Intronic
1155267037 18:24104325-24104347 CAGTGGGGCAGGGGTGGAGTGGG - Intronic
1155416791 18:25606990-25607012 CTGGGTGGCGGGGGTGCAGTGGG + Intergenic
1155775993 18:29762356-29762378 CAATGTGGCTGGAGTGAACTGGG - Intergenic
1155996060 18:32332635-32332657 CAGGGAGGCTGAAGGAGAGTGGG - Intronic
1156314849 18:35959638-35959660 CATGCAGGCTGGAGTGCAGTGGG - Intergenic
1156463810 18:37336262-37336284 CACGCAGGCTGGAGTGCAGTGGG + Intronic
1157125146 18:44949856-44949878 AAGGGTGGGTGGAGTGGAGAGGG - Intronic
1157784698 18:50471057-50471079 CAGGGTAGCTGGAGTGAGGATGG - Intergenic
1157807915 18:50672147-50672169 CAGGGTGCAGGGAGTGGAGAAGG + Intronic
1157827085 18:50822377-50822399 CAGCCAGGCTGGAGTGCAGTGGG + Intronic
1158253439 18:55516782-55516804 GAGTGTGGCTGGTGTAGAGTGGG + Intronic
1158475253 18:57774059-57774081 CAGGGTGGCTGTAGATGAGAGGG - Intronic
1159303408 18:66607904-66607926 CACCCTGGCTGGAGTGCAGTGGG + Intergenic
1160043762 18:75368607-75368629 CAAGGTGGCTGCAGTGGTGCTGG - Intergenic
1161114303 19:2488342-2488364 CCGGGTGGAGGGAGTGGGGTGGG - Intergenic
1161204605 19:3034461-3034483 CAGGGTGGCTGGAGGGGGTTGGG - Intronic
1161226388 19:3148489-3148511 CAGGAGGCCTGGCGTGGAGTTGG + Intronic
1161285230 19:3464930-3464952 CAGGGTGGGGGTCGTGGAGTGGG + Intronic
1161354488 19:3811247-3811269 CAGGGGGGCAGGGGTGGAGCAGG - Intronic
1161407354 19:4097991-4098013 CAGTCTGGCTGGAGAGGAGGAGG + Intronic
1161445856 19:4318778-4318800 CACGGTGGCTGGGGTGGACTAGG + Intronic
1161638813 19:5406803-5406825 CAGTGTGGCTGGAGCAGAATGGG - Intergenic
1161649419 19:5475118-5475140 CAGTGTGGCTGGAGTGAGCTGGG + Intergenic
1161654824 19:5507738-5507760 ATGGGTGGCTGGGGTGGAGGGGG + Intergenic
1161689184 19:5720953-5720975 CTGGGAGGATGGGGTGGAGTAGG - Intronic
1161820339 19:6526893-6526915 CACCGAGGCTGGAGTGCAGTGGG - Intergenic
1161940745 19:7402052-7402074 CAGGCTGGGGGTAGTGGAGTGGG + Intronic
1162087845 19:8259362-8259384 CTGTGTGGCTGGAGCAGAGTGGG + Intronic
1162294414 19:9803263-9803285 CAAGGTGACTGGGGTGCAGTTGG - Intergenic
1162330881 19:10028756-10028778 AAGGGTGGTTGGAGTGGAACTGG + Intergenic
1162646056 19:12051483-12051505 CACCATGGCTGGAGTGCAGTGGG + Intronic
1163497905 19:17657248-17657270 CAGCGTGGCCGGAATGGAGGAGG - Intronic
1165460896 19:35943809-35943831 CAGGGAGGCTAGAGCGGAGCTGG + Intronic
1165467489 19:35983656-35983678 CAGGGTGGCTGCAGTGCACTGGG - Intergenic
1165803519 19:38566907-38566929 CTAGGTGGATGGAGTGGAGGAGG + Exonic
1165891235 19:39113502-39113524 CAGTGTGGCTGCAGCAGAGTGGG - Intergenic
1165921906 19:39304296-39304318 CAGTGTGTCTGGACTGAAGTGGG - Intergenic
1165923111 19:39310923-39310945 AGGGGTGGGTAGAGTGGAGTTGG - Intronic
1165951858 19:39478405-39478427 CACCCTGGCTGGAGTGCAGTTGG - Intergenic
1165995338 19:39839941-39839963 CAGGGTGGCTGGAGGACACTTGG + Intronic
1166066366 19:40361566-40361588 CAGTGTGTCTGCAGTGAAGTGGG - Intronic
1166195618 19:41203792-41203814 CAGGGGGGTAGGAGTGGAGGAGG - Intronic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166268138 19:41697353-41697375 CAGAGTGGCTGGAGCAGAGAGGG - Intronic
1166280359 19:41788480-41788502 CAAAGTGGCAGGAGTGGAGGGGG - Intergenic
1166328896 19:42067543-42067565 GAGAGAGGCAGGAGTGGAGTGGG + Intronic
1166796421 19:45428845-45428867 CAGGGGGGCCCGAGTGGAGGGGG + Intronic
1166878263 19:45911481-45911503 CAGGGAGTCTGGACTGAAGTAGG - Intergenic
1167079135 19:47267317-47267339 CAGGCTGGATGGAGTGCAGTGGG + Intronic
1167216685 19:48170137-48170159 CGGGGTGTCTGCAGAGGAGTGGG - Intronic
1167254754 19:48420385-48420407 CGCGCTGGCTGGAGTGCAGTGGG - Intronic
1168355412 19:55696917-55696939 CAGGGTGTCTGGAGGGTTGTCGG + Intronic
1168522266 19:57061743-57061765 CATCCTGGCTGGAGTGCAGTGGG - Intergenic
925094229 2:1182629-1182651 CAAGGTGCCTGCAGTGAAGTAGG + Intronic
925349998 2:3194330-3194352 CAGGGTTGCTGGGATGGAGGAGG - Intronic
925985727 2:9213310-9213332 CAGGGTGTGTGGGGAGGAGTGGG + Intronic
926111741 2:10188174-10188196 CCAGGTGGCTGGGGTGCAGTGGG + Intronic
926223030 2:10948715-10948737 TGGGGTGCCTGGTGTGGAGTTGG + Intergenic
926447810 2:12965556-12965578 CAGGGTAGCTGGAGGGAAGATGG - Intergenic
927571887 2:24167211-24167233 CAGCGTGGGTGGAGAGGAGCTGG + Intronic
927940394 2:27099804-27099826 CAGGCTGGATGGAGGGGAGAAGG - Exonic
927982352 2:27381894-27381916 CAGGGTGGTAGGAGAGGAATGGG + Intronic
928173113 2:29016129-29016151 CTGGAAGGCTGGAGTTGAGTGGG - Intronic
928273033 2:29874237-29874259 CTGGGTGGCGGGGGTGGGGTGGG - Intronic
928452979 2:31395290-31395312 CAGGATGGCTGGAGGGGGCTGGG + Intronic
929034840 2:37680728-37680750 CAGGGTCACTGGGGTGGAATTGG - Intronic
929053453 2:37856818-37856840 CTTGGTGGCTGGGGTGGAGGAGG - Intergenic
929099769 2:38300689-38300711 CACTGAGGCTGGAGTGCAGTGGG + Intronic
929171104 2:38934392-38934414 CAGGGTGGCTTGAATGCAGAGGG - Intronic
929527802 2:42722066-42722088 CAGGGTGGCTTGTGTGTAGTTGG + Intronic
929545765 2:42854520-42854542 CTGGGTGGCTGGAGTAGGCTAGG + Intergenic
929736449 2:44555199-44555221 CATGGAGGATGGATTGGAGTAGG + Intronic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930633960 2:53785013-53785035 CAGTGTGGCTGGAGTGTAAGAGG - Intronic
931226860 2:60339321-60339343 CAGTGTGGCTGGAATGGTGAGGG - Intergenic
932176172 2:69604784-69604806 CAGAGAGGCTGGGGTGCAGTTGG - Intronic
932182290 2:69658357-69658379 CACCGAGGCTGGAGTGCAGTGGG - Intronic
932187913 2:69714496-69714518 CAGGCTGGCTGGACTGGGGCAGG - Intronic
933699454 2:85244148-85244170 CAGAGTGGCTGGAGCAGAGTGGG + Intronic
933846030 2:86327972-86327994 CAGGGTGGCAGTGGTGGAGGTGG + Intronic
933892086 2:86781400-86781422 CTTGGTGGCAGGTGTGGAGTAGG + Intergenic
933928359 2:87122238-87122260 CACCCAGGCTGGAGTGGAGTGGG - Intergenic
933931659 2:87158280-87158302 CACCCAGGCTGGAGTGGAGTGGG + Intergenic
935164153 2:100555033-100555055 CAGGGTGAGAGGAGTGGAGGCGG - Intergenic
935237752 2:101152207-101152229 CAAGGTGGCTGGCCTGGAGCAGG + Intronic
935466666 2:103406353-103406375 GAGGGAGGCTAGTGTGGAGTGGG - Intergenic
935719997 2:105971652-105971674 GAGGGTGGCGGGAATGTAGTTGG + Intergenic
935760581 2:106316888-106316910 CAGGGTGCCTGGAATATAGTAGG + Intergenic
935793454 2:106615522-106615544 CAGAGTGGCAGGAGTGGATTTGG + Intergenic
936361459 2:111807154-111807176 CACCCAGGCTGGAGTGGAGTGGG - Intronic
936479193 2:112869277-112869299 ATGGGTGGCTGGAGTGAACTGGG - Intergenic
936522491 2:113220035-113220057 CAGGATGGATGGAGTGGTGGGGG - Intronic
937046502 2:118854836-118854858 GGGGGTGAATGGAGTGGAGTTGG - Intergenic
937108423 2:119341388-119341410 CAGGGTGATTGGAGGTGAGTGGG - Intronic
937466169 2:122134967-122134989 CATAGTGGCTGGAGCTGAGTGGG + Intergenic
937987792 2:127646253-127646275 CAGGCTGGGTGGGGTGGACTGGG + Intronic
938338514 2:130520094-130520116 CAGCCAGGCTGGAGTGCAGTGGG - Intergenic
938351325 2:130600656-130600678 CAGCCAGGCTGGAGTGCAGTGGG + Intergenic
938798842 2:134741296-134741318 CAGGGTGGCTGGAGTATGGTGGG + Intergenic
939252473 2:139699978-139700000 CACGCAGGCTGGAGTGCAGTGGG + Intergenic
939389201 2:141544704-141544726 CACTGAGGCTGGAGTGCAGTGGG + Intronic
939818100 2:146921437-146921459 CAGGGTGGGTGGATGGGAGGAGG + Intergenic
939956586 2:148532516-148532538 CATGGTGCCTGGACTGGAGTAGG - Intergenic
941294197 2:163715507-163715529 CAGAGCGGCTGGAGTGAAGCAGG - Intronic
941422528 2:165300671-165300693 CTGAGTGGCTGGAGCAGAGTGGG + Intronic
941696118 2:168552667-168552689 CAGGCTGGCAAGAGTGGAGGAGG + Intronic
941732523 2:168934238-168934260 CTGGGTGGGTGTAGTGGAGTGGG + Intronic
941771457 2:169350044-169350066 CAGGGTGGCAGAAGTGAAGATGG + Intronic
941874796 2:170421521-170421543 CAGGGTGGCTGGAGAGGGCTGGG - Intronic
942206992 2:173629097-173629119 CAGTGTGGCTGGATATGAGTGGG + Intergenic
942555927 2:177172299-177172321 CATGGGGGCTGGGGTGGGGTGGG - Intergenic
943337772 2:186639599-186639621 GGGGGTGGCTAGAGAGGAGTGGG + Intronic
943473793 2:188329519-188329541 CTGGGTGGCTGAAATGAAGTGGG + Intronic
944973987 2:205026297-205026319 CAGGGTGGCTGCAGTGTAGTGGG + Intronic
945012250 2:205478032-205478054 AAGGTTGGATGAAGTGGAGTGGG - Intronic
945136944 2:206639624-206639646 AAGGGTGGCAGCAGTGGAGAGGG - Intergenic
946183865 2:217965801-217965823 CAGGGTGGCTGGTGTGGACCAGG + Intronic
947275101 2:228381894-228381916 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
947446951 2:230171563-230171585 CAGCGTGGCAGCAGTGGAGCGGG - Intronic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
947591633 2:231389163-231389185 CAGGGTTGCTGGATTGAGGTTGG + Intergenic
947612196 2:231531134-231531156 CAGGGAGGCAGGTGAGGAGTGGG - Intergenic
947865787 2:233397194-233397216 CAGGGTGGCTGGGGGGGGGGGGG + Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948334677 2:237198583-237198605 TGGGGGGTCTGGAGTGGAGTTGG + Intergenic
948458421 2:238117946-238117968 GAGGGTGGATGGAGGGGAGGTGG + Intronic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
948656717 2:239480727-239480749 TAAGGTGGCGGGTGTGGAGTGGG - Intergenic
948660500 2:239503586-239503608 CGGGATGGCAGGAGTGGAGCTGG + Intergenic
948719154 2:239886109-239886131 CACGCAGGCTGGAGTGCAGTGGG - Intergenic
948807118 2:240457806-240457828 CAGGGTGGCTGGAATGCAGCAGG - Intronic
948826401 2:240575306-240575328 CAGGGTGGCAGAAGGGGAGGTGG - Intronic
1168962796 20:1880463-1880485 CAGTGTGGCTGAAGCAGAGTGGG + Intergenic
1169005526 20:2204144-2204166 CAGTGTGGCTGGAATGAAGTGGG - Intergenic
1169079390 20:2786713-2786735 CATGGTGGCTGGGGTGGTGGAGG - Intergenic
1169088835 20:2844836-2844858 CAGTGTGGCTGGAGTGCTGTAGG + Intronic
1170405549 20:16032252-16032274 GAGGGTGGAGGGAGTGGAGTGGG + Intronic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1170795943 20:19546768-19546790 CAGGGTGACTGCAGTGGTCTAGG - Intronic
1170845540 20:19958955-19958977 CATGGTGGCATGAGTGAAGTGGG + Intronic
1171050056 20:21849455-21849477 CTGTGTGGCTAGAGTGGATTGGG + Intergenic
1171952863 20:31437055-31437077 CAGCGTGGCTGAAGAGTAGTGGG + Intergenic
1172243086 20:33426408-33426430 CACCCTGGCTGGAGTGCAGTGGG - Intronic
1172367247 20:34359449-34359471 CACCCTGGCTGGAGTGCAGTGGG - Intergenic
1172368282 20:34366165-34366187 CAGGGAGTGTGGAGTGGAATGGG + Intronic
1172635194 20:36405605-36405627 CAGGGAGGCTGGAGCGGGCTGGG + Intronic
1172767555 20:37358842-37358864 CAGTGGGGCTGGGGTGGAGACGG - Intronic
1172837227 20:37880934-37880956 CAGGAGGGCTGGAGTGGGGTGGG - Intergenic
1173008094 20:39156597-39156619 CAGAGTGGCTGGAGTTGAACAGG + Intergenic
1173282722 20:41643719-41643741 CTGCGTGCCTGGAGTGGTGTAGG - Intergenic
1173613487 20:44387780-44387802 AAGGTTGGCTGGGGTGGAGATGG + Intronic
1173747088 20:45445971-45445993 CAGTGTGGCTGGGGCTGAGTGGG + Intergenic
1173861684 20:46287917-46287939 CAGTGAGGTTGGAGAGGAGTGGG + Intronic
1173897528 20:46562300-46562322 TGGGGTGGCTGCAGTGGAGTTGG - Intronic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1174308524 20:49632236-49632258 CAGCGTGGCTGGAGTAGAGGGGG - Intergenic
1174392202 20:50224605-50224627 CAGGGGTGGTGCAGTGGAGTGGG - Intergenic
1174403845 20:50291292-50291314 CAGAGTGGCTGGTGGGGAGGTGG + Intergenic
1174568789 20:51486304-51486326 CCCTGTGGCTGGACTGGAGTTGG - Intronic
1174918444 20:54677353-54677375 CAGGGTGGCTGTAGAGGAAGGGG + Intergenic
1174974796 20:55319738-55319760 CAGGGTGGTAGGAGTGGTGGAGG + Intergenic
1175278680 20:57788368-57788390 CAGCGTGGCTGGAGGGCAGCAGG - Intergenic
1175530723 20:59672855-59672877 CAGGGTGGCTCCTGTGGAGGTGG + Intronic
1175985810 20:62763725-62763747 CAGAGTGGCTGGAGAGGAGAAGG + Intergenic
1176122463 20:63460274-63460296 CAGGGGAGCTGGGGTGGAGAGGG + Intronic
1177187711 21:17816752-17816774 CAGGGTTGCTGTAGTGGTGATGG - Intronic
1178043817 21:28671593-28671615 CAGTGTGGTAGGAGTGGGGTGGG + Intergenic
1178097805 21:29234551-29234573 AGGGGTGGCTGGAGAAGAGTTGG - Intronic
1178553966 21:33569742-33569764 GAGGATGGCTGGAGTGGGGTGGG + Intronic
1178764765 21:35439969-35439991 CAGGGGAGCTGGAGTGTGGTAGG - Intronic
1178903569 21:36616958-36616980 CAGCGAGGCTGGAGTGGGGGGGG + Intergenic
1179144419 21:38754709-38754731 GAGGGTGCCTACAGTGGAGTTGG - Intergenic
1179320999 21:40291186-40291208 CAGGGTGACTGCAGTGGAGGAGG - Intronic
1179413497 21:41179741-41179763 GAGGGTGCCTGGTGTGGGGTGGG + Intronic
1179887644 21:44321199-44321221 CACGGTGGGTGGAGGGGAGGTGG + Intronic
1180594369 22:16963706-16963728 CAAGGTGCCTGGGGTGGAGCTGG - Exonic
1181051082 22:20238611-20238633 CAGGGCCGCAGGGGTGGAGTCGG + Intergenic
1181171188 22:21011220-21011242 CCGTGTGGCTGGAGTGGAAGAGG + Intronic
1181178157 22:21049299-21049321 CCGTGTGGCTGGAGTGGAAGAGG - Intronic
1181589791 22:23876974-23876996 CAGGCTGGGTGTCGTGGAGTGGG + Intronic
1182087394 22:27570738-27570760 CAGCGTGGCTGGAGTGGAGTGGG - Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1182659781 22:31917143-31917165 CAGCCTGGCTGGAGGGGATTAGG - Intergenic
1182686172 22:32122802-32122824 CATGGTGGGTGGAGGGGGGTGGG + Intergenic
1182756897 22:32687642-32687664 GAGGGAGGCGGGAGTGGAGCAGG - Intronic
1183165528 22:36144539-36144561 CAGAGAGGCTGGAATGGAGTTGG - Intronic
1183171931 22:36194707-36194729 CAGAGAGGCTGGAATGGAGTTGG - Intronic
1183292736 22:37012628-37012650 CAGGGTGGCAGGAGTGGGAGGGG + Intronic
1183319685 22:37157372-37157394 CTGGGGGGCTGGCGTGGAGGTGG - Intronic
1183503031 22:38192582-38192604 CAGGGTGACTGGGGAGGAGGTGG + Intronic
1183672839 22:39283281-39283303 CAGGCTGGATGGAGTGGGGGTGG - Intergenic
1183699794 22:39444795-39444817 AATGGTGGCTGGGGTGGAGATGG - Intergenic
1183706801 22:39479296-39479318 CAGGCAGGCTGGAGTACAGTGGG - Intronic
1183757681 22:39785278-39785300 CAGAGTGGCTGATGTGGAATGGG - Intronic
1183757824 22:39786441-39786463 CAGAGTGGCTGACGTGGAATGGG + Intronic
1184108395 22:42381696-42381718 TGGGGTGGCTTGAGTGGAGTAGG - Exonic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184378359 22:44129413-44129435 CAGGGTGGAGGAAGAGGAGTCGG - Intronic
1184400930 22:44274053-44274075 CAGGGTGGGTGGGGGGGAGGGGG - Intronic
1184745410 22:46452950-46452972 CAGGGAGGATAGAGTTGAGTGGG + Intronic
1185011875 22:48319105-48319127 CTGAATGGCTGGAGTGGAGGTGG - Intergenic
1185015345 22:48339538-48339560 CTGGGTTGCTGGAGTGCAGGCGG - Intergenic
1185180738 22:49359778-49359800 CACGCAGGCTGGAGTGCAGTGGG - Intergenic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
1185307065 22:50125114-50125136 CAGGGAGGGTGGACAGGAGTGGG + Intronic
1185316344 22:50180848-50180870 CATGGGGGCTGGAGTGGGGTTGG + Intergenic
1185326095 22:50226551-50226573 CAGGGTGGGGGGTGTGGAGTGGG + Intronic
1185330436 22:50249829-50249851 CAGGCTGGCTGCAGGGGGGTGGG - Intronic
949518890 3:4831732-4831754 CTGGCTGGCTGGAGAGGCGTGGG + Intronic
950129852 3:10534491-10534513 CAGAGTAGCTGGAATGTAGTAGG - Intronic
950284760 3:11735906-11735928 CAGCGTGGCTGCAGTGGGGTTGG + Intergenic
950647994 3:14389167-14389189 CAGGGTGGCTGGGGGCGACTTGG - Intergenic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
951031077 3:17882301-17882323 CACTGAGGCTGGAGTGCAGTGGG + Intronic
951707578 3:25558749-25558771 TAGGGTAGCTGGTGGGGAGTAGG - Intronic
952849930 3:37719545-37719567 CAGGGTGGGTGGAGGGGACATGG - Intronic
953154198 3:40354030-40354052 CAGGGTGGGAGGAGTAGAGGTGG - Intergenic
953169761 3:40496438-40496460 CACCCAGGCTGGAGTGGAGTGGG + Intergenic
953399761 3:42602465-42602487 CAGTGTGGCTGGAGTAGAAGAGG + Intronic
954229242 3:49203572-49203594 CAGGCTGGTGGCAGTGGAGTAGG + Intronic
954287613 3:49629979-49630001 CAGGGTGGGCGGCGTGGAGAAGG + Intronic
954391859 3:50271739-50271761 CTGGGTGGCTGGAGGGGGTTGGG + Intronic
954712307 3:52511271-52511293 TAGGGTGGCAGGGGTGGAGGTGG + Intronic
954778255 3:53039449-53039471 TAGGGTGGGAGGAGGGGAGTTGG + Intronic
954965235 3:54604656-54604678 CAGGGTGAGAGCAGTGGAGTGGG - Intronic
955833744 3:63031333-63031355 CAGGGTGGCTAGAGGGGATGGGG + Intergenic
956171661 3:66438058-66438080 TTGGGTGGCTGGTGTGGAGTGGG + Intronic
956245084 3:67173951-67173973 CCTGGTGGCAGGAGTGCAGTGGG + Intergenic
956303955 3:67804173-67804195 CTGGGTAGCTGGAGTGGCATAGG + Intergenic
957064533 3:75510608-75510630 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
957338185 3:78859138-78859160 CAGGGTGACAGTAGTGGAGGTGG + Intronic
959056695 3:101574340-101574362 CAGGGTGGGGGGAGTGGGGTGGG + Intronic
960430546 3:117563310-117563332 CAGTCTGGCTGGAGTGCAGTAGG + Intergenic
960676314 3:120198802-120198824 CTGTGTGGCTGGAGTGGAGTGGG - Intronic
960834941 3:121896518-121896540 GAGGGTGGGTGGAGGAGAGTAGG - Intronic
961280237 3:125760754-125760776 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
961288821 3:125828792-125828814 CAGAGTGGCTGAAATAGAGTAGG + Intergenic
961569985 3:127790806-127790828 CAGGCTGGCTGGACTTCAGTAGG - Intronic
961663121 3:128480918-128480940 CGGGCTGGCAGGAGTGGTGTCGG + Exonic
961772963 3:129263612-129263634 CAGGTTGGGTGGAGGGGACTCGG + Intronic
961874169 3:130008793-130008815 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
961898249 3:130187234-130187256 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
961993147 3:131213736-131213758 CAGATTGGCAGGACTGGAGTAGG - Intronic
962486182 3:135844866-135844888 CAGGGTGGCAGCAGTGGAAGTGG + Intergenic
962714600 3:138115537-138115559 CAGGTTGGCGGCACTGGAGTGGG - Exonic
962989775 3:140567194-140567216 CATGGTGGGTGGAGTGGGGGTGG + Exonic
963727354 3:148937379-148937401 CTGGGTGGGTGGAGTGGGGTGGG - Intergenic
963728229 3:148945834-148945856 CAGTGTGGCTAGAGTGGGGCTGG - Intergenic
963922991 3:150923933-150923955 AAGGGTGACTGCAGAGGAGTAGG + Intronic
963948876 3:151176953-151176975 CACGGTGCCTGGTGTAGAGTAGG - Intronic
964416347 3:156452211-156452233 AAGGGAAGCTGAAGTGGAGTGGG - Intronic
964550108 3:157876177-157876199 CAGAGTAGCTGGACTGGAGTGGG - Intergenic
965540321 3:169865345-169865367 CAGCTAGGCTGGAGTGGGGTGGG + Intronic
966519377 3:180855948-180855970 CACTGAGGCTGGAGTGCAGTGGG - Intronic
966865841 3:184258877-184258899 CAGGCTGGCTGGTGTGCAGAGGG - Intronic
966891429 3:184410147-184410169 CACTGTGGCTGGAGTGCAGTGGG - Intronic
967459776 3:189732252-189732274 CAGGGGTGGTGGAGGGGAGTTGG - Intronic
967815663 3:193796168-193796190 CAGCGTGGCTGGAGTAAAGAGGG - Intergenic
967877223 3:194275695-194275717 CAGAGTGGCAGGGGTGGGGTGGG + Intergenic
968117060 3:196098623-196098645 CACGGAGGCTGGAGTGCTGTGGG - Intergenic
968426797 4:529058-529080 AGGGATGGCTGGAGTGGAGGTGG + Intronic
968529977 4:1086590-1086612 GAGGGTGGCAGGAGAGGGGTGGG + Intronic
968554048 4:1238393-1238415 CACAGTGGGTGGCGTGGAGTGGG - Intronic
968862637 4:3184809-3184831 CAGACTGGCTGGAGAGGAGGAGG + Intronic
968870299 4:3238733-3238755 CTGGGTGGCGGGGGTGGGGTGGG - Intronic
969017434 4:4113276-4113298 CAGCCTGGCTGGAGGAGAGTGGG + Intergenic
969335115 4:6503232-6503254 AGGTGTGGCTGGAGTGGGGTGGG - Intronic
969340357 4:6536629-6536651 CAGGGTGGGTGCAGTGGAGAAGG + Intronic
969376727 4:6768130-6768152 CAGGGTGGGGGGAGGGGAGCTGG - Intergenic
969411279 4:7029967-7029989 CAGGGTGGCAGGAGTGCAGCGGG + Intronic
969736512 4:8995029-8995051 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
969988052 4:11231883-11231905 CAGGGTGTCTGAAGTGCAGTGGG - Intergenic
970173014 4:13308050-13308072 CAGTGTGGCTAGAGTGCGGTGGG - Intergenic
970380378 4:15501373-15501395 CAGGATGGTTGGGGTGGAGTGGG - Intronic
971268831 4:25118282-25118304 CAGTTTGGCTGGAATGGAGCAGG + Intergenic
972445582 4:39140186-39140208 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
972750137 4:41980404-41980426 CAGCTGGGCTGGAGTGCAGTGGG + Intergenic
973832616 4:54776916-54776938 GAGTGTGGCTGGAATAGAGTGGG + Intergenic
975302777 4:72810745-72810767 CAGGGTGGTTTGAGTAGGGTAGG - Intergenic
975342758 4:73259288-73259310 CGGGGAGGCTGGAGAGGAGCCGG + Intergenic
976035877 4:80820514-80820536 CAGTGTTGCTGGAGCGTAGTGGG + Intronic
976274082 4:83258312-83258334 CAGGGTGGCAGCTGTGGAGGTGG + Intergenic
976723882 4:88196971-88196993 CAGGATGGCTGGAGGGGTTTGGG - Intronic
976763613 4:88576417-88576439 CAGCATGGCTGGAGCAGAGTGGG - Intronic
976928219 4:90529253-90529275 CACTGGGGCTGGAGTGCAGTGGG + Intronic
977596311 4:98885486-98885508 CACCCTGGCTGGAGTGCAGTGGG + Intronic
977859829 4:101943468-101943490 CATGGTGGGTGGATTGGTGTGGG + Intronic
977891073 4:102312280-102312302 AAATGAGGCTGGAGTGGAGTGGG - Intronic
978193663 4:105945632-105945654 CAGGGTGGTAGCACTGGAGTTGG - Intronic
978436000 4:108685089-108685111 CAGGTTGGTTGGGGTGGGGTGGG - Intergenic
978571178 4:110139725-110139747 GAGGTTGGCTGAAGTGGACTTGG - Intronic
978871925 4:113589111-113589133 CAGTGTGGCTGGGGCTGAGTGGG + Intronic
979268506 4:118731986-118732008 CAGTGTGGCTGAAGTGGGATGGG + Intronic
979443009 4:120774657-120774679 CAGTGTGGCTGGGGTTGTGTTGG - Intronic
980032495 4:127846328-127846350 CTGTGTGGCTGGGGTGGAGGAGG - Intergenic
980322998 4:131303250-131303272 CTGGGTAGCTGGAGTGATGTAGG - Intergenic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
981335210 4:143561773-143561795 CACCATGGCTGGAGTGTAGTGGG + Intergenic
981369336 4:143940871-143940893 CAGGGTTGTGGGGGTGGAGTGGG + Intergenic
981817875 4:148851754-148851776 TAGGGATGGTGGAGTGGAGTAGG + Intergenic
982178813 4:152731228-152731250 CAAGATGGCTGCAGTGGAGCGGG + Intronic
982353747 4:154444525-154444547 CAGGGTGGTAGAAGTGGAGGTGG - Intronic
984852406 4:184165439-184165461 CACCGTGGCTGGAGGGGAGCAGG - Intronic
985972673 5:3390823-3390845 CAGTGTGCATGGAGTGCAGTGGG - Intergenic
986466802 5:8034181-8034203 CAGGGAGGCTGCAGCGGGGTTGG + Intergenic
987181013 5:15368483-15368505 CAGGGTGGCCAGTGTGGAGGTGG - Intergenic
987301765 5:16603851-16603873 CAGGGTGGCGGGTGGGGGGTGGG - Intronic
987472504 5:18350649-18350671 CAGGGAGGCTGGAATGGGGCTGG + Intergenic
988482395 5:31640685-31640707 CAGGTTGGCAGGTGTGAAGTGGG + Intronic
989453618 5:41615843-41615865 CAGGGTATCTGAAGTGTAGTGGG - Intergenic
989459857 5:41684829-41684851 CAGGGTGGTGGGAGAGGGGTTGG - Intergenic
990196063 5:53317778-53317800 CAGGGCGGCTTTAGTGCAGTTGG + Intergenic
990365414 5:55065697-55065719 CACAGTGGGTGGAGGGGAGTAGG - Intergenic
990399455 5:55423464-55423486 CAGTGTGGCTGGAGCAGAATGGG + Intronic
990527824 5:56645706-56645728 CAGGGTTGGTGGGGTGGGGTGGG - Intergenic
990670399 5:58123139-58123161 CAGGGCAGCTGCAGTAGAGTTGG - Intergenic
990733702 5:58837219-58837241 CACCCAGGCTGGAGTGGAGTGGG + Intronic
991633564 5:68680771-68680793 CAGGCTGGGAGGAGTGGAGTGGG + Intergenic
991934595 5:71789412-71789434 CAGGGTGGTAGCAGTGGAGATGG + Intergenic
992853223 5:80832576-80832598 CACCGAGGCTGGAGTGCAGTGGG - Intronic
992879969 5:81098055-81098077 CAGCATGGCAGGAGTGGAGTTGG + Intronic
992992973 5:82304138-82304160 GAGGATGGAGGGAGTGGAGTGGG - Intronic
993092304 5:83441409-83441431 CTGGGTGGCTGGAGTCAAGATGG - Intergenic
993495096 5:88599974-88599996 CAGGGAAGGTGGAGAGGAGTGGG + Intergenic
993706473 5:91177455-91177477 CAGGGTGGCTGGAGTGGTAAGGG - Intergenic
995074108 5:107961061-107961083 CAGGCTGGCTGGAAAGAAGTGGG + Intronic
997197711 5:131990797-131990819 CTGTGTGGCAGGGGTGGAGTGGG - Intronic
997198005 5:131992444-131992466 CAGAGTGGCTGCACCGGAGTAGG - Intronic
997450691 5:133980686-133980708 CAGGGTGGGAGGGGTGGGGTTGG - Intronic
997453396 5:134001222-134001244 CAGCCTGGCAGGAGTGGAGTTGG - Intronic
998295611 5:140966668-140966690 CAGGGTGGCACGAGCGGAGGCGG + Exonic
998391491 5:141789735-141789757 CAGAGTGGCTGGTGTGGACTTGG - Intergenic
998915864 5:147010846-147010868 CAGGGTGGCAGCTGTAGAGTAGG - Intronic
998921336 5:147071506-147071528 CAGTGTGTCTGAAGTTGAGTAGG - Intronic
999097076 5:148989225-148989247 CATGGTGGCTGGAATGTAATAGG - Intronic
999270895 5:150295824-150295846 CAGGATGGGTGGGGTGGGGTGGG - Intergenic
999400363 5:151259393-151259415 AAGGCTGGCTGGAGAGGAGTGGG + Intronic
999538883 5:152549977-152549999 CAGTGTGGCTGGAGTAAAATGGG - Intergenic
999970836 5:156860760-156860782 GATGGTGGCTGGAGGAGAGTCGG - Intergenic
1000379805 5:160618731-160618753 AAGGTTGGCTGGTGTGGGGTGGG + Intronic
1001214786 5:169845457-169845479 CAGGGTGCCTGGCGTGCAGTGGG + Intronic
1001814899 5:174660383-174660405 CAGGGAGGGTGGAGAGGAGGAGG - Intergenic
1001915768 5:175558698-175558720 CAGGCTGGATGGAGTGCAGTGGG - Intergenic
1001975245 5:175993497-175993519 CAGTGTGGCTTGAGTGGAGTGGG - Intronic
1002242186 5:177850273-177850295 CAGTGTGGCTTGAGTGGAGTGGG + Intergenic
1002798442 6:496452-496474 TGGGCTGGCTGGAGTGGAGTCGG + Intronic
1002816231 6:683203-683225 CAGTCTTGCTGGAATGGAGTTGG - Intronic
1003171184 6:3723228-3723250 CAGGGTGGCTGGGGGGCACTAGG + Exonic
1003447523 6:6198589-6198611 CAAGGTGCCTGGTGTGTAGTGGG - Intronic
1004003128 6:11614124-11614146 CAGGGCAGCTGGAGTGCTGTGGG + Intergenic
1004585373 6:16994630-16994652 CAGTGGGGCTCAAGTGGAGTGGG + Intergenic
1004817633 6:19329880-19329902 CAGTGTGGCTGAAGTAGAGTGGG + Intergenic
1005269489 6:24148055-24148077 AAAGGTGGCTGGATTGGATTAGG + Intronic
1006042445 6:31267612-31267634 CAGGTGGGCTTGAGGGGAGTGGG - Intergenic
1006052033 6:31352701-31352723 CAGGTGGGCTTGAGGGGAGTGGG - Intronic
1006132070 6:31875710-31875732 CAGGGAGGCTGAGGTGGGGTGGG + Intronic
1006384208 6:33720153-33720175 AAGGGTGACAGGAGTGGAGAAGG - Intergenic
1006513250 6:34532873-34532895 CCGGCAGCCTGGAGTGGAGTGGG - Exonic
1006811117 6:36821237-36821259 CCGTGTGACTGGAGTGGAGTGGG + Intronic
1006929388 6:37678592-37678614 CAATGTGGCTGGAGTGGGGAGGG - Intronic
1007060295 6:38933696-38933718 CAGGGTGGCAGGAGTTGATGGGG - Intronic
1007222937 6:40293418-40293440 CAGGGTGGCTGCAGTGGCTGGGG + Intergenic
1007240219 6:40419507-40419529 CAGGTTGGCTGGAGTTGAACTGG - Intronic
1007452885 6:41953599-41953621 CAGAGAGGCTGGAGTGGTGAAGG - Intronic
1007533356 6:42563098-42563120 CACGCAGGCTGGAGTGCAGTGGG + Intergenic
1007762395 6:44140693-44140715 CACAGTGGCTGGCATGGAGTAGG - Intronic
1007821724 6:44565289-44565311 CAGGGTGGAGGGAGTAGACTTGG - Intergenic
1007825884 6:44600320-44600342 CAGGGTGGATGCAGTGTAGGAGG - Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1009566204 6:65313991-65314013 CAGCAAGGCTGGAGGGGAGTGGG - Intronic
1009960900 6:70519570-70519592 CAGGGTGGCTGCAGTGGCTATGG - Intronic
1010189165 6:73176754-73176776 CAGGCTGGCTTGAGGGGAGATGG + Intronic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011728135 6:90231490-90231512 CAGGGTCACTGGATTGGAGTTGG - Intronic
1011809815 6:91118042-91118064 AAGGGTGGGTGGAATCGAGTAGG - Intergenic
1012276379 6:97279743-97279765 CACCCTGGCTGGAGTGCAGTGGG - Intronic
1012412213 6:98971419-98971441 CAGTGTGAGTGGAGTGGAGCAGG + Intergenic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1014007870 6:116442202-116442224 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
1015092620 6:129376590-129376612 CAGTATGGCTGGAGTGCAGATGG - Intronic
1015540111 6:134305317-134305339 CAGGCTGGCTGGAGTGCAGTGGG - Intronic
1015816898 6:137220005-137220027 CAATGTGGCTGCAGTGGAATAGG - Intergenic
1016047848 6:139498629-139498651 CAGGGTGGATGAAGTGGCTTTGG + Intergenic
1016347020 6:143124747-143124769 CAGGGTGGCAGGACAGGAGTGGG + Intronic
1016920625 6:149289591-149289613 CCCAGTGGCTGGAGTGGACTGGG - Intronic
1017022209 6:150149364-150149386 CAGGCTAGCTAGAGTGCAGTGGG + Intronic
1017112039 6:150941260-150941282 CAGGGTGGCTGGAGCCCCGTGGG + Intronic
1017467471 6:154707787-154707809 CAGTCTGGCTGAAGTGGAGGAGG + Intergenic
1017889608 6:158627673-158627695 CAGCGTGGCTGGAGATGAGCAGG + Intronic
1018049949 6:160000327-160000349 CATGGTGACAGGAGAGGAGTGGG + Intronic
1018391695 6:163346068-163346090 CAGGGCTGCTGGAGGGGAATGGG - Intergenic
1018753515 6:166828324-166828346 GAAGGTGGCGGGTGTGGAGTTGG - Intronic
1018926585 6:168211064-168211086 CAGTGTGGCTGCATTGGAGATGG + Intergenic
1018940959 6:168308633-168308655 CAGGGTGGCTGGAGTACAGACGG - Exonic
1018991100 6:168675121-168675143 CAGGGAGGCTGGGGTGGGGGAGG - Intergenic
1019345191 7:526331-526353 CAGGGCAGCTGGAAGGGAGTGGG + Intergenic
1019419582 7:944835-944857 CAGGGTGGGTAGAGTGGGGATGG - Intronic
1019485289 7:1286354-1286376 CAACGTGGCCGGAGTGGAGTGGG + Intergenic
1019506062 7:1392095-1392117 CAGGGCGGGTGGAGTTGAGAAGG - Intergenic
1019523744 7:1471694-1471716 CTGGGTGGCTGGGGTGGGGTGGG - Intronic
1019576391 7:1739670-1739692 CTGGGATGCTGGAGTGGAGAGGG + Intronic
1019812470 7:3174808-3174830 CAGGGTGGGGAGGGTGGAGTGGG - Intergenic
1020042241 7:5012913-5012935 CAGGCTGGCTGGACTGGGGCAGG - Intronic
1021340422 7:19457325-19457347 CTGGGTAGCTGGCGTGGTGTGGG + Intergenic
1022067738 7:26877326-26877348 CAAGCTGGCTGGAGAGGAATTGG - Intronic
1022088905 7:27095348-27095370 CTTGGTGGCTGGCGTGGAGAGGG + Exonic
1022394067 7:29969997-29970019 CAGGGTGGTGGCAGTGGAGGTGG - Intronic
1022410698 7:30136305-30136327 CGGGGTGGGAGGGGTGGAGTAGG + Intronic
1023114163 7:36844274-36844296 CATGCAGGCTGGAGTGCAGTGGG - Intergenic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1023313238 7:38909073-38909095 TGGGGAGGGTGGAGTGGAGTGGG - Intronic
1023371105 7:39512959-39512981 GAGGACTGCTGGAGTGGAGTTGG - Intergenic
1023566986 7:41533131-41533153 GATGGTGGCTGGCCTGGAGTTGG + Intergenic
1023759714 7:43453263-43453285 CAGGGTGGGAGCAGTGGAGGTGG + Intronic
1024810583 7:53207092-53207114 CAGGCTGGATGGAGTGCAATGGG + Intergenic
1025035674 7:55591334-55591356 CAGGGAGGCAGCAGTGGGGTGGG - Intergenic
1025076578 7:55949103-55949125 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1026184529 7:68072122-68072144 CAGCCAGACTGGAGTGGAGTGGG + Intergenic
1026984379 7:74545844-74545866 CAGGGCGGCTGGAGGGGGGCCGG - Intronic
1027233396 7:76284509-76284531 CACGGTGGCTGGACAGGAGGTGG - Intronic
1027309341 7:76937867-76937889 CTGCGTGGCTGGAGCAGAGTAGG - Intergenic
1027624084 7:80526956-80526978 CTGGGTGTCTGGGGTAGAGTGGG + Intronic
1029482800 7:100823366-100823388 CAGTGTGGCTGGAGCACAGTGGG + Intronic
1029580738 7:101435414-101435436 CTGGGAGGCTGGACTGGACTGGG + Intronic
1029796098 7:102896082-102896104 CAGAGTGGCTGGAGTAGAGTTGG + Intronic
1029959554 7:104675298-104675320 CAGAGAGGCTGGAGCAGAGTGGG + Intronic
1030052490 7:105551067-105551089 CACCGAGGCTAGAGTGGAGTGGG + Intronic
1030991667 7:116308488-116308510 CAGGGTAGTTGGAATGGAGTTGG + Intronic
1031895623 7:127345597-127345619 CAGTGTGGCTGCATTCGAGTGGG + Intergenic
1032026702 7:128448368-128448390 GTGGGAGGCGGGAGTGGAGTGGG - Intergenic
1032229546 7:130062694-130062716 CAGCCAGGCTGGAGTGCAGTGGG + Intergenic
1032411603 7:131697571-131697593 CAGTGTGGCTGAAGTGGAGTAGG + Intergenic
1032451422 7:132035137-132035159 CAGGCAGGCTTGCGTGGAGTGGG - Intergenic
1032490107 7:132318141-132318163 CAGGGGGACTGGAGCGGAGAGGG + Intronic
1032882071 7:136100476-136100498 CATGGTGGGTGGGGTTGAGTGGG + Intergenic
1034931269 7:155165826-155165848 CACAGTGGCTGGAGTCGAGGGGG + Intergenic
1035158635 7:156934783-156934805 GAGGGTGGCTGGTGTGAAGGTGG - Intergenic
1035334834 7:158121184-158121206 CAGGGAGGCTGGGGTGCAGGGGG - Intronic
1035920101 8:3667488-3667510 CAGGGTGGCTGGAGCCAACTAGG + Intronic
1036084653 8:5600253-5600275 CACAATGGCTGGAATGGAGTAGG - Intergenic
1036213760 8:6863141-6863163 TAGGGAGGCTGGTGGGGAGTGGG + Intergenic
1036306373 8:7605639-7605661 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036357219 8:8053624-8053646 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036419930 8:8586045-8586067 CAGGGTGGTAGCAGTGGAGGTGG - Intergenic
1036663784 8:10726013-10726035 CTTGGAGGTTGGAGTGGAGTGGG + Exonic
1036831141 8:12020844-12020866 CAGCCTGGCTGGAGGAGAGTGGG + Intergenic
1036901350 8:12671629-12671651 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1037517618 8:19648763-19648785 CACGCAGGCTGGAGTGCAGTTGG - Intronic
1037696542 8:21228769-21228791 CAGGAGGGCTGGGGTGGAGTGGG + Intergenic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1037835841 8:22214293-22214315 GATGGTGGCTGGAGAGGAGGAGG + Intergenic
1038740390 8:30211864-30211886 CAAGGTGGCGGGAGTGGGGCGGG + Intergenic
1038807631 8:30809894-30809916 CAGTCAGGCTGGAGTGCAGTGGG - Intronic
1038906498 8:31909892-31909914 AAGAGTGGCTAGAGTGGATTAGG - Intronic
1039204903 8:35141388-35141410 CAGGGTGACGGCTGTGGAGTAGG - Intergenic
1039375211 8:37026106-37026128 CAGGGAGGGTGGATTGAAGTAGG - Intergenic
1039727656 8:40237292-40237314 CAGCCAGGCTGGAGTGCAGTGGG + Intergenic
1039893599 8:41700801-41700823 CACCCTGGCTGGAGTGCAGTGGG + Intronic
1040329363 8:46378125-46378147 CAGGGCCGCTGGGGTGGCGTTGG + Intergenic
1040489512 8:47906590-47906612 CACTGTGTCTGGAGTGCAGTGGG - Intronic
1040562195 8:48532929-48532951 AAGCCTGGCTGGAGCGGAGTGGG - Intergenic
1041214119 8:55583007-55583029 TGAGGTGGCTGGAGTGGAGAAGG - Intergenic
1042068709 8:64906810-64906832 CAGGGAGGCTGGGGTGGTCTGGG + Intergenic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1042542024 8:69916852-69916874 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1042668615 8:71234900-71234922 GGGGGTGGCTGGGGAGGAGTTGG - Intronic
1042705709 8:71664134-71664156 CAGTGTGGCTGGAGGAGGGTGGG - Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043370015 8:79580136-79580158 CAGGGAGGCTGCAGTGGAGCAGG + Intergenic
1043836361 8:85051644-85051666 CAAGCTTCCTGGAGTGGAGTGGG - Intergenic
1043856356 8:85269742-85269764 CAGCCAGGCTGGTGTGGAGTCGG + Intronic
1044624472 8:94223188-94223210 CGGGGTGGCTAGTGTGGTGTGGG + Intergenic
1044699936 8:94956714-94956736 CAGGATGGCAGCAGTGGAGGGGG + Intronic
1044804105 8:95987360-95987382 CAAGGTGGCTGGAGTGGAATGGG + Intergenic
1045031224 8:98138321-98138343 CAGGGTGGCTGAAGTGTAGAAGG - Intronic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1045249628 8:100472686-100472708 CAGGGTGGATGGAGTTGAGTGGG - Intergenic
1045274573 8:100691471-100691493 CAGGCAGGCTGGAGTGCAGTGGG - Intronic
1046054692 8:109065431-109065453 CAGCCAGGCTGGAGTGCAGTGGG + Intergenic
1046084416 8:109415036-109415058 CACCGTGGCTGGAGTGCTGTGGG + Intronic
1046233835 8:111394319-111394341 CACCCTGGCTGGAGTGCAGTGGG - Intergenic
1046280556 8:112023949-112023971 TAGGAGGCCTGGAGTGGAGTAGG - Intergenic
1046887837 8:119387611-119387633 CATGGTGGCAGGAGTGGGGCAGG - Intergenic
1047210397 8:122835698-122835720 CAGGGTGGCAAGAATGGAGAAGG + Intronic
1047213280 8:122856973-122856995 CAGGGTGGCTGGAGCCGAGAAGG - Intronic
1047718912 8:127620526-127620548 TAGGGTGGCTGAGGTGGAGCGGG + Intergenic
1047818859 8:128495959-128495981 CAGGGTATCTGGAGTGTAGGAGG - Intergenic
1048192339 8:132301335-132301357 CATGGTGGCTGGAGTGGACAGGG - Intronic
1048334186 8:133490816-133490838 CATCGTGGCTGGACTGGAGAGGG + Intronic
1048972046 8:139650605-139650627 CAGGGACCCTGGAGTGGAGAGGG - Intronic
1049192109 8:141294262-141294284 CAGGGTGGCTGGACAGAAGCAGG + Intronic
1049262323 8:141646373-141646395 AAGGGTGGCTGGGGCGGAGGGGG - Intergenic
1049582767 8:143420389-143420411 CAGAGGGGCTGGACTGGAGTCGG - Intronic
1049611862 8:143559582-143559604 CAGGGAGGCTGGATGGGAGAGGG + Intronic
1050029207 9:1367464-1367486 CAGGGCGGCGGGAGTGGGGGTGG + Intergenic
1050297263 9:4218240-4218262 CATGGTGGTTGCAGTGGAGATGG - Intronic
1051033114 9:12707545-12707567 AACTGTGGCTGGAGTAGAGTGGG + Intronic
1051106620 9:13587844-13587866 CAGGGTGGGAGGAGCGGAGGAGG - Intergenic
1051144796 9:14015658-14015680 CTGTGTGGCTGGGGTGGAGCTGG - Intergenic
1051287860 9:15514225-15514247 CACCCTGGCTGGAGTGCAGTGGG - Intergenic
1052758180 9:32563380-32563402 CAGGATGGCTGGAGTACAGTGGG + Intronic
1053025144 9:34723321-34723343 CAGGTTGTCTGGAGTGTAGCCGG + Exonic
1053062452 9:35043029-35043051 CAGGATGGCTGGGGTGGGGCTGG - Exonic
1053189518 9:36050452-36050474 TAGGGTGGCAGCAGTGGAGATGG - Intronic
1053417843 9:37957952-37957974 CAGAGTGACTGGAAGGGAGTTGG + Intronic
1056408264 9:86297966-86297988 CAGTGTGGCAGGAGTGGAACAGG - Intronic
1057275314 9:93673199-93673221 CAGAGTGGCTGGGGTGCAGGAGG + Intronic
1057363694 9:94398852-94398874 CACTGAGGCTGGAGTGCAGTGGG + Intronic
1057659641 9:96989235-96989257 CACTGAGGCTGGAGTGCAGTGGG - Intronic
1057834788 9:98435650-98435672 CAGTGTGGCTGGAATAAAGTGGG - Intronic
1058491098 9:105500409-105500431 CAGGATGGCTGGAGTGGGCTGGG + Intronic
1059603243 9:115804276-115804298 CACCCTGGCTGGAGTGAAGTGGG - Intergenic
1059711257 9:116869604-116869626 CACGGTTGCTGGAGTGTGGTAGG - Intronic
1059820780 9:117969809-117969831 CAGTGTGCCTGAAGTGGAGAGGG - Intergenic
1060228800 9:121812388-121812410 CAGGGTAGCTGGAGAGGACTTGG + Intergenic
1060463666 9:123883000-123883022 CATTGTGGCTGGAGTTCAGTGGG - Intronic
1060960364 9:127676474-127676496 CAGAGTGGCTGGAGGGGAATCGG + Intronic
1061006644 9:127931813-127931835 CAGAGTGGCTGGAGTGAAGAGGG + Intergenic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061802113 9:133118382-133118404 CAGGTGGGCTGGAGTGAAGAGGG - Intronic
1062057034 9:134474126-134474148 CAGGGTGACTGCAGCAGAGTGGG + Intergenic
1062207387 9:135344716-135344738 CAGGGTGGCTGCAGGGCTGTGGG + Intronic
1062215798 9:135389211-135389233 CAGGGTGGCTGGAGCTCAGGAGG - Intergenic
1062271433 9:135711529-135711551 CAGGGTGCCTGGCGTGCAGCTGG + Intronic
1062287809 9:135780877-135780899 CAGGGATGCTGCCGTGGAGTCGG + Intronic
1062404684 9:136389820-136389842 GAGGGTGGCTGGAGTGAAGCTGG + Intronic
1062488405 9:136792273-136792295 CGGGGTGACGAGAGTGGAGTCGG + Exonic
1186267466 X:7847766-7847788 CAGCCAGGCTGGAGTGCAGTGGG - Intergenic
1186878104 X:13837448-13837470 CGGGCTGCCTGGAGTTGAGTGGG - Intronic
1187941525 X:24387329-24387351 AAGGGTGACTGCAGTGGAGAGGG + Intergenic
1189248559 X:39582040-39582062 CAGGGTGGGGGCAGTGGAGCAGG + Intergenic
1189741425 X:44120872-44120894 CAGGGTGGTTACAGAGGAGTAGG - Intergenic
1190402033 X:50046732-50046754 GAGGGTGGCTTGAGTAGTGTAGG + Intronic
1190419245 X:50211638-50211660 AAAGGAGGCTGGAGTGCAGTTGG - Intronic
1190766128 X:53477244-53477266 GTGCGTGGCTGAAGTGGAGTGGG + Intergenic
1191759682 X:64632926-64632948 TAGGGTGGGGGGAGTGGAGAGGG - Intergenic
1192244391 X:69360669-69360691 CAGGGTGGTGGCAGTGGAGATGG + Intergenic
1192410264 X:70927641-70927663 CAGGGTGGCATGAGTTGACTGGG + Intronic
1192537691 X:71942252-71942274 CAGGGTGCCTGGGGAGGGGTTGG - Intergenic
1193127934 X:77889410-77889432 CAGGCTGGCTGGAGTGCAGTGGG + Intronic
1193734242 X:85137536-85137558 GAGGTGGGGTGGAGTGGAGTGGG - Intergenic
1193980513 X:88176311-88176333 CAGGGTGGCTGCATGTGAGTGGG - Intergenic
1194887914 X:99340865-99340887 GAGGGTGGCTGGAGGGGAGGTGG - Intergenic
1195009812 X:100723882-100723904 CAGGGTGGCTGGCCTGGCGGGGG - Intronic
1195941207 X:110169394-110169416 CAGTGAGGCTGGAGGAGAGTGGG - Intronic
1196618066 X:117790551-117790573 TAGGGTGGGGGGAGAGGAGTAGG - Intergenic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1196704992 X:118709825-118709847 CTGAGTGACTGGAGTGGAGTGGG - Intergenic
1196973282 X:121132553-121132575 CAGGTTGGCTGGTTTGGAGGCGG + Intergenic
1197633195 X:128885723-128885745 CAGGGTGGTGGGAGAGGGGTAGG + Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1197903121 X:131394491-131394513 CTAGGTGTCTGGATTGGAGTGGG - Intronic
1197968586 X:132091792-132091814 CAGCCAGGCTGGAGTGCAGTGGG - Intronic
1198094904 X:133370010-133370032 CAAGGTAGATGGAGTGGAGGTGG + Intronic
1198463226 X:136882692-136882714 CAGGGTGGCGGCAGTGGACACGG + Intergenic
1199429842 X:147746332-147746354 CAGTGTGGCTGAAGGGGAGGAGG - Intergenic
1199824029 X:151479573-151479595 CAGGGTGGTAGCACTGGAGTTGG + Intergenic
1200041785 X:153375964-153375986 CCAGGTGGCTGGAGAGGAGGTGG + Intergenic
1200110211 X:153737120-153737142 CAGCGGGGCTGGGGTGGAGAGGG - Intronic
1200125249 X:153810410-153810432 CAGGGAGGCTGGTTTGCAGTTGG + Intronic
1201101350 Y:10677668-10677690 CACACTGGCTGGAGTGCAGTGGG + Intergenic
1201463836 Y:14257813-14257835 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1201519567 Y:14858505-14858527 CAGCCAGGCTGGAGTAGAGTAGG - Intergenic