ID: 1102460537

View in Genome Browser
Species Human (GRCh38)
Location 12:113097070-113097092
Sequence GGACCTGCCTGGTGGCAGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 327}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102460523_1102460537 28 Left 1102460523 12:113097019-113097041 CCAGGTTCAGGGCTGGGGAGGAG 0: 1
1: 0
2: 8
3: 56
4: 518
Right 1102460537 12:113097070-113097092 GGACCTGCCTGGTGGCAGCTGGG 0: 1
1: 0
2: 1
3: 34
4: 327
1102460522_1102460537 29 Left 1102460522 12:113097018-113097040 CCCAGGTTCAGGGCTGGGGAGGA 0: 1
1: 0
2: 5
3: 56
4: 371
Right 1102460537 12:113097070-113097092 GGACCTGCCTGGTGGCAGCTGGG 0: 1
1: 0
2: 1
3: 34
4: 327
1102460528_1102460537 5 Left 1102460528 12:113097042-113097064 CCTGCGGAAGGGGCCGCAGCCAT 0: 1
1: 0
2: 0
3: 21
4: 148
Right 1102460537 12:113097070-113097092 GGACCTGCCTGGTGGCAGCTGGG 0: 1
1: 0
2: 1
3: 34
4: 327
1102460532_1102460537 -8 Left 1102460532 12:113097055-113097077 CCGCAGCCATTCAGGGGACCTGC 0: 1
1: 0
2: 2
3: 23
4: 183
Right 1102460537 12:113097070-113097092 GGACCTGCCTGGTGGCAGCTGGG 0: 1
1: 0
2: 1
3: 34
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102460537 Original CRISPR GGACCTGCCTGGTGGCAGCT GGG Exonic
900131669 1:1089827-1089849 GGGACTGTCTGGGGGCAGCTGGG - Intronic
900333094 1:2146313-2146335 GGCCCTCCCTGGAGGCTGCTGGG + Intronic
900523389 1:3116837-3116859 GGGCCTGACTGGAGGCAGGTGGG - Intronic
900996107 1:6124472-6124494 GGCCCTTCCTGGTGGCTGCCTGG - Intronic
901000235 1:6145417-6145439 CCTGCTGCCTGGTGGCAGCTTGG - Intronic
901063735 1:6485392-6485414 GGCCCGGCCTGGAGGCTGCTAGG + Intronic
901082994 1:6593833-6593855 GGGCCTCCCCGGAGGCAGCTGGG + Intronic
902150020 1:14435501-14435523 GGACATCCCTGCGGGCAGCTGGG - Intergenic
902600148 1:17535444-17535466 GGAGCTGACTGGTGGGAGCGGGG + Intergenic
903052738 1:20613645-20613667 GGCCCTGCCTTGTGGCAGTGTGG + Intronic
903669390 1:25026505-25026527 GGGCTTTCCTGGGGGCAGCTTGG - Intergenic
910776416 1:90880833-90880855 TGACCTGCCTGGTGGCTTCCTGG - Intergenic
912432572 1:109636799-109636821 GGACCTGGCTGGTGGCAGTGTGG + Intergenic
915307239 1:154987615-154987637 GGACCTGCTTGGTGGCAGTGGGG + Intronic
918102839 1:181391496-181391518 AGTCCTGCCTGGGGGTAGCTGGG + Intergenic
919705866 1:200675064-200675086 CCACCTGCCTGCTGGAAGCTTGG - Intergenic
920380425 1:205531769-205531791 GGACCTGCCTAGTGCCAGTTTGG + Exonic
921285794 1:213608181-213608203 GCACCTGCCTGGTGGAGCCTGGG + Intergenic
922784948 1:228278145-228278167 GGTTCTACCTGGTGGCAGCGAGG + Intronic
922843865 1:228667340-228667362 GTAACTGCCTGGTGGCATCCAGG + Intergenic
924224663 1:241911214-241911236 AGATCTGCCTGGAGGCAGCTGGG - Intergenic
924653109 1:245948611-245948633 GATGCTGCCTGGTGGAAGCTGGG - Intronic
924957564 1:248944415-248944437 ACACCCGCCTGCTGGCAGCTGGG - Intergenic
1064841026 10:19592254-19592276 ACATCTGCCTGGTGGCAGGTGGG + Intronic
1065188729 10:23192417-23192439 GGCCCTGGCTGGGGGCAGCTAGG - Exonic
1065299906 10:24311855-24311877 GGACTTGGCAGGTGGCACCTGGG + Intronic
1065342367 10:24720085-24720107 GGACCTTACTGCTGGCAGCATGG - Intronic
1066084530 10:31963350-31963372 GGACCTGCCTGGGGCCAGACGGG + Intergenic
1067719680 10:48718598-48718620 TGACCTTCCTGGTGGGAACTAGG + Intronic
1067727085 10:48778606-48778628 GGAACGGTCTGGTGGCACCTGGG - Exonic
1070442718 10:76462701-76462723 GGACCTGTCTCTTGGCTGCTAGG + Intronic
1070577113 10:77687491-77687513 GGGCTGGCCTGGGGGCAGCTGGG + Intergenic
1070696388 10:78566948-78566970 AGACATGCCTGGAGGCATCTTGG - Intergenic
1070742795 10:78913623-78913645 GGGCCTCCCAGGAGGCAGCTGGG - Intergenic
1070946499 10:80396136-80396158 AGAACTGGCTGGTGGCAGCAGGG + Intergenic
1071136978 10:82464876-82464898 GCACTTGCCTGCTGGAAGCTGGG - Intronic
1075411891 10:122234233-122234255 GGTCCTTCCTGCTGGCAGCTGGG - Intronic
1075621327 10:123930073-123930095 GGACCAGGCTGGTGGCTGCGTGG - Intronic
1075651794 10:124132188-124132210 GAACCTTCCTGGGGGGAGCTGGG + Intergenic
1075792541 10:125095352-125095374 AGAGCAGCCTGGTGGTAGCTGGG - Intronic
1076280745 10:129244009-129244031 CCACCAGCCTGCTGGCAGCTTGG + Intergenic
1076511173 10:131014598-131014620 GGACCTGCCTGTTGTCTTCTGGG - Intergenic
1076746392 10:132516968-132516990 GGACTTGCCGCGTGGCACCTTGG + Intergenic
1076963410 10:133785933-133785955 ACACCCGCCTGCTGGCAGCTGGG - Intergenic
1079279155 11:19072558-19072580 GGACTTGCCAGATGGCAGCCAGG - Intergenic
1081754156 11:45532714-45532736 CGCCCTGCCTGTTGGCAGCTTGG - Intergenic
1083300499 11:61737548-61737570 GGAGCTGGCTGGTGGCAGGCTGG - Intronic
1083319860 11:61838963-61838985 GGTGGTGCCTGGTGGGAGCTTGG - Intronic
1083640185 11:64141250-64141272 GGCCGGGCCTGGTGCCAGCTTGG - Intronic
1084190785 11:67497816-67497838 GGGCCTGCCTGCTGGCAGAGGGG + Intronic
1085274802 11:75291614-75291636 GGAGCTACCTGTTGGCAGCTAGG - Intronic
1087169653 11:95037874-95037896 GGACCTGCCTCGCAGCAGCCAGG + Intergenic
1089443185 11:118532511-118532533 CCACCTGCCTGGTGGGTGCTGGG - Intronic
1090251416 11:125254399-125254421 GGATCTGCCTGAGGGCAGCAAGG + Intronic
1090258229 11:125300753-125300775 GGCCCTGCCTGTTGGGATCTGGG - Intronic
1090437175 11:126696539-126696561 GGACCTGCCTGGAGGCTGAAAGG - Intronic
1090657729 11:128858951-128858973 TGACCTGCCTGGTGGCATGGGGG - Intronic
1091657786 12:2358210-2358232 AGGCCAGCCTGGTGGCAGATGGG - Intronic
1092246499 12:6867184-6867206 GGAACTAGCTGGTGGCAACTTGG - Exonic
1094311443 12:29087614-29087636 GGAGTTTCATGGTGGCAGCTAGG - Intergenic
1094598237 12:31884796-31884818 TGTCCTGCCTGGTGGGAGCTGGG + Intergenic
1095738392 12:45582740-45582762 GGCCCTGACTGGAGGCATCTGGG + Intergenic
1098487547 12:71039388-71039410 GGCTCTGCCTGGGGACAGCTAGG - Intergenic
1099369467 12:81811987-81812009 GGAACTGCCTCTTGTCAGCTTGG - Intergenic
1100984710 12:100192920-100192942 AGGAGTGCCTGGTGGCAGCTAGG - Intergenic
1101460257 12:104884067-104884089 GGAACTGCGAGGTGGCAGCGAGG - Intronic
1102460537 12:113097070-113097092 GGACCTGCCTGGTGGCAGCTGGG + Exonic
1102651298 12:114444348-114444370 GGACCAACCTGGTCACAGCTGGG + Intergenic
1103555934 12:121766474-121766496 AGGCCTGCCTGGGGGCCGCTGGG - Intronic
1104490946 12:129192775-129192797 TGATGTGCCTGGTGGTAGCTGGG + Intronic
1104639197 12:130456577-130456599 TGACCTGCTGGGTGGCAGCGCGG - Exonic
1105603729 13:21909889-21909911 GGAGCTCCCTGGTGGCTGGTGGG + Intergenic
1106052346 13:26203557-26203579 GGAGCTGCCTGGGGGAAGCATGG - Intronic
1106076584 13:26465838-26465860 GGAGCTGGCTGGTGGCCTCTGGG + Intergenic
1106508403 13:30391879-30391901 GGAGCTACCTGGTAGCAGCCAGG + Intergenic
1107548939 13:41457649-41457671 GGTCCTGCGAGGTGGCAGCCGGG - Exonic
1108308569 13:49163358-49163380 CGAACTGCCAGGTGGCAGCGAGG - Intronic
1108359067 13:49652686-49652708 GGACCTGCTTGGAGGCTTCTGGG + Intergenic
1112038447 13:95519688-95519710 AGACTTGCCCTGTGGCAGCTTGG - Intronic
1112197355 13:97238784-97238806 TGGGCTGCCTGGTGGCACCTGGG + Intronic
1113216350 13:108045144-108045166 GGAGGGGCCTGGCGGCAGCTGGG + Intergenic
1113418954 13:110155094-110155116 TGCCCTGCCTGGTGACAGCAGGG - Intronic
1113650195 13:112028918-112028940 CCAGCTGCCTGGTGGGAGCTCGG + Intergenic
1113933750 13:113982322-113982344 GGACATGCTCAGTGGCAGCTGGG - Intronic
1113989839 13:114352769-114352791 ACACCCGCCTGCTGGCAGCTGGG - Intergenic
1114587074 14:23825106-23825128 GGAACTGACTGGTGGGAGCTGGG + Intergenic
1115018121 14:28641376-28641398 GGAACTGCAAGGTGGCAGCGAGG - Intergenic
1115399087 14:32938692-32938714 GGAGCAGCCCGGTGGCAGGTGGG - Intronic
1116849263 14:49892705-49892727 GAACAGGCCTGGAGGCAGCTCGG + Intergenic
1116866214 14:50033755-50033777 GGAGCCGGATGGTGGCAGCTTGG + Intergenic
1117204179 14:53424191-53424213 TGATCTGCCAGGTGGCAGCCTGG + Intergenic
1118753235 14:68821307-68821329 GGGCCAGCCTGGTGGCAGGCCGG + Intergenic
1118906494 14:70027409-70027431 AGACCAGCCTGGGGGCAGCGTGG + Intronic
1119543353 14:75455000-75455022 GGACCAGGCTGGAGGCAGCAGGG + Intronic
1119665806 14:76484290-76484312 GGGACTGCCTGGTGGCCCCTGGG + Intronic
1120259120 14:82160108-82160130 GCACCTGCCTGTTGGGTGCTTGG + Intergenic
1121311640 14:92938619-92938641 GAACCTGCCAGGTTGCAGCTGGG + Exonic
1121876651 14:97458997-97459019 CGACAGGCCTGGTGGCAGCGTGG + Intergenic
1122100634 14:99406883-99406905 GGGCCTCCCTGGTGGCAGTGAGG + Intronic
1122872286 14:104644589-104644611 GGGCCTGCCTGGGTGCTGCTTGG - Intergenic
1123084339 14:105710674-105710696 GGACCTGGCTGGGGTGAGCTAGG - Intergenic
1123174148 14:106401404-106401426 GGAGATGCCAGGGGGCAGCTGGG - Intergenic
1123182357 14:106482338-106482360 GGAGATGCCAGGGGGCAGCTGGG - Intergenic
1202848383 14_GL000225v1_random:843-865 GGAGCTCCATGGTGGCAGCTGGG + Intergenic
1202848778 14_GL000225v1_random:2379-2401 GGCACTCCATGGTGGCAGCTGGG - Intergenic
1202855057 14_GL000225v1_random:44587-44609 GGCCCTCCATGGTGGCAGCTGGG - Intergenic
1202857480 14_GL000225v1_random:59877-59899 GGCCCTCCATGGTGGCAGCTGGG - Intergenic
1202857887 14_GL000225v1_random:63131-63153 GGCCCTCCATGGTGGCAGCTGGG + Intergenic
1202859202 14_GL000225v1_random:71420-71442 GGAGCTCCATGGTGGCAGCTGGG + Intergenic
1202864361 14_GL000225v1_random:105306-105328 GGAGCTCCATGGTGGCAGCTGGG - Intergenic
1202944546 14_KI270726v1_random:14392-14414 GGAGATGCCAGGGGGCAGCTGGG + Intergenic
1123436336 15:20257227-20257249 GGCCCCGCCTGGTGGCACCAGGG - Intergenic
1124791492 15:32731353-32731375 GCTCCTGCCAGGAGGCAGCTGGG - Exonic
1124955228 15:34355915-34355937 GGCACTGCCTGGTGGCTGATAGG + Exonic
1126805491 15:52344554-52344576 GGGCTTGGCTGGTGGCAGTTAGG - Intronic
1127179441 15:56399377-56399399 CGAACTGCGAGGTGGCAGCTTGG + Intronic
1128354518 15:66915491-66915513 GGAGCTGCCAGTTGGCAGCAGGG - Intergenic
1128508998 15:68302166-68302188 GCACCGGCCTGGCTGCAGCTGGG - Exonic
1129467063 15:75730217-75730239 GCCTCTGTCTGGTGGCAGCTGGG - Intergenic
1129720166 15:77873503-77873525 GCCCCTGTCTGGTGACAGCTGGG + Intergenic
1129882706 15:79017689-79017711 GGATTTGGCTGGTGGCAGGTAGG - Intronic
1129941441 15:79500521-79500543 GCACATGCTTGGTGGCAGCATGG + Intergenic
1130669051 15:85894078-85894100 GGATCTGTCTGTTGGCAGGTGGG + Intergenic
1130693922 15:86111091-86111113 AGAATTGCCTGGAGGCAGCTGGG + Intergenic
1130911680 15:88275205-88275227 GGAGCTGCCTGGAAGCACCTGGG - Intergenic
1132062101 15:98700709-98700731 GCTGATGCCTGGTGGCAGCTGGG - Intronic
1132589945 16:722206-722228 GGGCCTGCCTGGTGGGTGCTAGG + Intronic
1132601534 16:775145-775167 TGGCCTGCCTGGTGGGCGCTGGG - Exonic
1132767663 16:1542585-1542607 GGACCTGCCTGGGGTCAGCCTGG + Intronic
1132776282 16:1596457-1596479 GGACATTCCAGGTGGCAGCCTGG - Intronic
1132841501 16:1980363-1980385 GCACCTGCCGGGTGGCAGCGCGG + Exonic
1133036436 16:3036549-3036571 GGAGCGGCCTGGGGGCGGCTGGG - Intronic
1134069204 16:11250226-11250248 GGACCTGCCTGGTGGATGCTGGG - Intronic
1134131116 16:11650912-11650934 TGACCTGCCTGGGGCCACCTAGG + Intergenic
1135016997 16:18931918-18931940 GGCCCTGCCTGCTACCAGCTGGG - Intergenic
1135068612 16:19332850-19332872 TGAGCTGACTGATGGCAGCTTGG + Intergenic
1135119604 16:19754164-19754186 GGAGCTGCAGGGTGGCAGTTTGG + Intronic
1135587307 16:23680733-23680755 GCACCTCCCTGGTGTCAGCATGG + Intronic
1135994206 16:27236080-27236102 GGACCTGGATGGTGGCCCCTGGG - Intronic
1136278753 16:29194723-29194745 GTTCCTGCCTGCTGGCGGCTGGG - Intergenic
1136367074 16:29813793-29813815 GGACCTGCCAACTGGGAGCTGGG - Exonic
1136521961 16:30802591-30802613 GGCTCTGCCTGGTGTAAGCTTGG - Intergenic
1136684137 16:31984167-31984189 GGACCTGCCTGCAGGGAGCAAGG + Intergenic
1137392259 16:48091554-48091576 GACCCTGCCAGGTGGCAGCAAGG - Intronic
1138071253 16:53995260-53995282 GCATCTCCCTGGTGGCAGTTGGG - Intronic
1138337189 16:56262351-56262373 GGACTTGCCTGGTGTCAGAAAGG + Intronic
1139434104 16:66926276-66926298 GCAGCTGCCTGGTGGGTGCTGGG - Intergenic
1141706021 16:85665145-85665167 GGTCCTGGGTGGTGGCAGGTGGG - Intronic
1142083144 16:88160804-88160826 GTTCCTGCCTGCTGGCGGCTGGG - Intergenic
1142409094 16:89907420-89907442 GGAGCTGCTAGGTGGGAGCTGGG - Intronic
1142409551 16:89908797-89908819 GGAGCTGCGAGGTGGGAGCTGGG - Intronic
1142409558 16:89908825-89908847 GGAGCTGCGAGGTGGGAGCTGGG - Intronic
1142876590 17:2854803-2854825 CGACCTGCCTGGTAGCTCCTTGG - Intronic
1143019664 17:3910604-3910626 GGACCGGCCAGGTGGCTGGTGGG + Intronic
1143970550 17:10792197-10792219 GGAGCTGCCTGGTGGCATTGTGG + Intergenic
1145018411 17:19413191-19413213 GTTCCTGCCTGGGGGAAGCTGGG + Intronic
1145031353 17:19507499-19507521 GGGCCTGGCTGGGGGCGGCTGGG - Intronic
1146642406 17:34551218-34551240 GGACCTGCCTGGAAGCACCATGG + Intergenic
1146956946 17:36941432-36941454 GAGCCTACCTGGAGGCAGCTGGG + Intronic
1148344558 17:46894748-46894770 GGTCCTGCCCGAGGGCAGCTGGG - Intergenic
1149533961 17:57417558-57417580 AGACCTGCCTTGTGGCTTCTTGG - Intronic
1151422844 17:74009762-74009784 GGGACTGCCTGGTGGCAGTGGGG + Intergenic
1151786019 17:76275483-76275505 GGCTCTGCATGGTGGCTGCTGGG - Intronic
1151982945 17:77525083-77525105 GACCCTGCCTGGTGGCACCCAGG + Intergenic
1152070177 17:78130473-78130495 GGACATCCCTGGAGGCAGCCAGG + Intronic
1152403351 17:80082726-80082748 GGACTTGGCTGGTAGCAGCACGG - Intronic
1152408439 17:80110343-80110365 GGCCCTGCCTGGAGGCCCCTGGG - Intergenic
1152610672 17:81313763-81313785 GGGCCTGCCTGGGGGCAGTCTGG - Exonic
1152620930 17:81364514-81364536 GGACCTGCACGGGGGCAGCCAGG + Intergenic
1152665332 17:81565382-81565404 GCACCTGCCAGGATGCAGCTGGG + Intronic
1152755232 17:82084429-82084451 GGACCTGCCTGGGAGCCCCTCGG - Intronic
1157920134 18:51706316-51706338 GGAACTGCAAGGTGGCAGCGAGG - Intergenic
1158695172 18:59697293-59697315 GGAGCTGCCAGGGGCCAGCTGGG - Exonic
1160513772 18:79467243-79467265 GGACCGCCCAGGTGGCTGCTTGG + Intronic
1160653537 19:247080-247102 ACACCCGCCTGCTGGCAGCTGGG + Intergenic
1161803201 19:6427069-6427091 GGGCATGCGTGGTGGCCGCTGGG + Intronic
1162495268 19:11019880-11019902 GGGCCTGCCTGGAGACAGTTAGG - Intronic
1162682726 19:12358843-12358865 GCATCTGCCTGGTGGCTGATTGG - Intronic
1164376317 19:27691247-27691269 AGACTTGCCTGGGGTCAGCTTGG + Intergenic
1164495520 19:28757254-28757276 TGAACTGCAAGGTGGCAGCTAGG + Intergenic
1164527710 19:29023987-29024009 GGACCTCCCTGGAGGCAGGTTGG - Intergenic
1165729543 19:38135927-38135949 CGGCCTGGCTGGTGGCAGCGAGG - Intronic
1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG + Intronic
1168294710 19:55373043-55373065 GGACTGGCCTGGGGCCAGCTGGG + Intergenic
1168720102 19:58550146-58550168 GGACCAGCCCGGTGGCACCCTGG + Exonic
1168728545 19:58606382-58606404 ACACCCGCCTGCTGGCAGCTGGG - Intergenic
926509271 2:13753198-13753220 GGAGCTTCCAGGTGGCAGATAGG - Intergenic
926980692 2:18564012-18564034 GGACCTACCTGGTTACAGCTAGG - Exonic
928637503 2:33262771-33262793 GGAAATGCCTGGAGACAGCTGGG - Exonic
928670603 2:33599483-33599505 GGACCGGCTGCGTGGCAGCTGGG + Intergenic
929827735 2:45322470-45322492 GGACCTGTGTGGTGACAGGTAGG - Intergenic
931233563 2:60394497-60394519 GGTCCTGTGTGGTGGAAGCTTGG + Intergenic
935737522 2:106118130-106118152 GGACCTGCCCAGTAGCAGCTTGG - Intronic
936529259 2:113264148-113264170 GGACCTTCCTAGTGGATGCTGGG - Intronic
936569959 2:113604317-113604339 ACACCCGCCTGCTGGCAGCTGGG + Intergenic
936992676 2:118382938-118382960 GGACCTGCACTGTGGCAGCTAGG + Intergenic
938726047 2:134109620-134109642 GGGCCGGCCTGCCGGCAGCTCGG + Intergenic
938975063 2:136469088-136469110 CGACCTGCAAGGTGGCAGCCTGG + Intergenic
939681095 2:145134054-145134076 AGAACTGCCTGGTGGCAGTGGGG + Intergenic
940016887 2:149115954-149115976 CGACCTGCCTGTAGGCATCTTGG + Intronic
942769112 2:179495103-179495125 GGACCTGCCTTGTGCCAGAAGGG + Intronic
943263683 2:185698224-185698246 TGAGCTGCCTGGTGTCAGTTTGG + Intergenic
947837745 2:233187832-233187854 GGCCCTGCCTGGAAGCAGCCAGG - Intronic
948427409 2:237896469-237896491 GGGTCTGCCTGGGGGCTGCTTGG - Intronic
948513018 2:238484706-238484728 GAACCAGCCTGATGGCACCTGGG + Intergenic
948797370 2:240411907-240411929 GCACCTGCCATGGGGCAGCTTGG + Intergenic
948847552 2:240690425-240690447 GGACCTGCCTGAGGGCACATAGG - Intergenic
948850874 2:240704687-240704709 AGAGCCGCCTGGGGGCAGCTCGG - Intergenic
949017226 2:241720313-241720335 GGACCTGCCTTGAGGCAGAGCGG - Intronic
949088803 2:242182024-242182046 ACACCCGCCTGCTGGCAGCTGGG - Intergenic
1169193557 20:3671998-3672020 GGGCCAGGCTGGGGGCAGCTCGG + Intronic
1170154415 20:13256477-13256499 GGACCTGCCTGGTGGGGGCAGGG - Intronic
1170787112 20:19477183-19477205 GGACCTGCCAGATGGCAACGAGG + Intronic
1171194703 20:23187781-23187803 AGGGCAGCCTGGTGGCAGCTGGG - Intergenic
1172911588 20:38413501-38413523 GGACCTGGCTGCTGGCTGCAAGG + Intergenic
1173187944 20:40855629-40855651 GGACCTGGCTGGTGGAGTCTGGG - Intergenic
1174481821 20:50836647-50836669 TGACCTGCCAGGTGAGAGCTTGG + Intronic
1174773462 20:53322676-53322698 GGCCCTCCCCAGTGGCAGCTTGG - Intronic
1175337569 20:58206161-58206183 GGTCCAGGCTGGTTGCAGCTGGG - Intergenic
1178519165 21:33272851-33272873 GGACATGCCTGTTGGATGCTAGG - Intronic
1178701574 21:34837743-34837765 ACACCTGCATGCTGGCAGCTTGG + Intronic
1179536926 21:42058924-42058946 GGCCCTGCCTGGGGGACGCTAGG - Intergenic
1180042864 21:45288726-45288748 GGAGCTGCCTGGAGGCTGCGGGG - Intergenic
1180264026 21:46698306-46698328 ACACCCGCCTGCTGGCAGCTGGG - Intergenic
1180836980 22:18934827-18934849 GGGCATGCTAGGTGGCAGCTGGG - Intronic
1181005038 22:20009288-20009310 GGGCCAGCCTAGTGGGAGCTGGG - Intronic
1181377350 22:22470223-22470245 GTGCCTCCCTGGAGGCAGCTGGG + Intergenic
1182426807 22:30277976-30277998 GACACTGCCTGATGGCAGCTGGG + Intergenic
1182500169 22:30740993-30741015 GGAACTGCCTGGTCGTGGCTTGG - Intronic
1183798496 22:40141394-40141416 AGACCAGCCTGGGGGCAGCATGG - Intronic
1184071846 22:42151717-42151739 GGTCTTCCCTGGAGGCAGCTGGG - Intergenic
1184988792 22:48153846-48153868 AGAGCTGCCTGGTGACAGATTGG - Intergenic
1185077454 22:48690968-48690990 GCATCTGCCTGGAAGCAGCTAGG + Intronic
1185385981 22:50531514-50531536 GGGCCTCCCTGGAGGCAGTTCGG + Intronic
1185430259 22:50806663-50806685 ACACCCGCCTGCTGGCAGCTGGG - Intergenic
1203287073 22_KI270734v1_random:160126-160148 GGGCATGCTAGGTGGCAGCTGGG - Intergenic
949288044 3:2429801-2429823 GGAACTGCAAGGTGGCAGCAAGG - Intronic
950176418 3:10877967-10877989 GGACTAGGCTGGTGGCAGCAGGG - Intronic
950457836 3:13103149-13103171 TGACCTGCCTGGGGCCAGCCGGG - Intergenic
951904321 3:27688895-27688917 GGACCTGCCTGGTGCCAGAGAGG + Intergenic
952327604 3:32335209-32335231 GGCACAGCCTGGTGTCAGCTTGG - Intronic
952526268 3:34213633-34213655 GCACCTGCCTGCTCTCAGCTGGG - Intergenic
954116235 3:48468354-48468376 AGAGCTCCCTGGGGGCAGCTAGG + Exonic
954410804 3:50370093-50370115 GCCCCGGCCTGGTGGGAGCTAGG + Intronic
954627988 3:52033141-52033163 GGCCTTGCCTGGAGCCAGCTAGG + Intergenic
954881483 3:53838653-53838675 GGCTCTGCCAGGTGGGAGCTTGG - Intronic
956540514 3:70332887-70332909 GAACTTACCTGGTGCCAGCTGGG - Intergenic
957780808 3:84815483-84815505 GGAACTGCAAGGTGGCAGCGAGG - Intergenic
957886704 3:86297443-86297465 AGAACTGCAAGGTGGCAGCTAGG + Intergenic
958870005 3:99547223-99547245 AAACCAGCCTGGTTGCAGCTTGG + Intergenic
960040769 3:113148183-113148205 GGACCAGCCTGGAGGCAGGGTGG - Intergenic
960621537 3:119641637-119641659 GGACCTGACTGGGCTCAGCTAGG - Intronic
961234891 3:125357548-125357570 GGAGCTGCGTGGTGGCGGGTGGG - Intronic
961235133 3:125359878-125359900 GGAGCTGCATGGTGGCGGGTGGG - Intronic
965086414 3:164104807-164104829 GGAACTGCCTGGTGGCCACTGGG - Intergenic
967996912 3:195173797-195173819 GGGACTCCCTGGTGGGAGCTGGG - Intronic
968481357 4:834537-834559 GGACCTGCCTGGATGCGGCGTGG + Intergenic
968620378 4:1601173-1601195 GGCCCTGCCCGTTGGCAGCCTGG - Intergenic
968647253 4:1747043-1747065 GGACATGCCTGTGGGCAGCGGGG - Intergenic
975002702 4:69244900-69244922 TGACCTGCCAGGCGGCAGCCTGG - Intergenic
975010808 4:69348887-69348909 TGACCTGCCAGGCGGCAGCCTGG - Intronic
975528742 4:75378618-75378640 GGACCTGCCAGGCAGCAGCCTGG + Intergenic
984497730 4:180519172-180519194 GGATGTGCCTGGAGCCAGCTTGG - Intergenic
984862833 4:184255492-184255514 AGGCCTGGCTGGGGGCAGCTGGG - Intergenic
985025446 4:185735166-185735188 GGAGCTGCCTGGGGGCTGGTGGG + Intronic
985658557 5:1144270-1144292 GCCCCTGCCTTGTGGGAGCTTGG - Intergenic
985794776 5:1953827-1953849 GGAACTGCGAGGTGGCAGCCTGG + Intergenic
986154310 5:5158501-5158523 GGACCTGCATGATGGCTGATTGG - Intronic
986424834 5:7620972-7620994 GGTGCTGCCTGGTGTCTGCTTGG + Intronic
990892207 5:60661792-60661814 GGAACTGCCTGCTGGCTGGTGGG - Intronic
994636580 5:102351708-102351730 GGACCTGCCAGGTAGCAGCCTGG + Intergenic
996978410 5:129461172-129461194 GGACCCGGCTGGCGGCAGCGGGG + Exonic
997657499 5:135566377-135566399 GGACCTGCGTGGAGGAAGCTGGG + Intergenic
999318605 5:150599977-150599999 GACCCTGCCTGGAGGGAGCTGGG + Intergenic
1001533630 5:172482677-172482699 GGACCTCTCTGGAGGCAGCATGG - Intergenic
1001700813 5:173705448-173705470 GGCCCTGCCTGCTGGCAAATGGG - Intergenic
1002098394 5:176845353-176845375 GGACCTATCTGGTGGCAGCACGG - Intronic
1002400790 5:178990739-178990761 GGACCCGCCTGGTAGGAGCAGGG + Exonic
1003174183 6:3743128-3743150 GGTCCTCCCTGGAGGAAGCTGGG - Intronic
1003380733 6:5622268-5622290 GGAGCTGACCGGTGGCAGGTCGG - Intronic
1003972145 6:11310117-11310139 GGTCCTGACTGGTCCCAGCTGGG - Intronic
1006676626 6:35769227-35769249 TCACCTGCCTGATGGCAGCAGGG + Intergenic
1006871800 6:37258090-37258112 GGGACTGCCTGGTGGCGGCAGGG + Intronic
1008282979 6:49618285-49618307 GGATGTGCCTGGTGGGAGATGGG - Intronic
1013375424 6:109509826-109509848 GGAGCTCCCTGGGTGCAGCTTGG + Intronic
1016135234 6:140532650-140532672 GGACCTGCCTGGGGCCAGAGAGG + Intergenic
1018181500 6:161227289-161227311 AGACCTACCTGGTGACACCTTGG + Intronic
1018486797 6:164248931-164248953 ATACATGCCTGGTGGCAGGTGGG + Intergenic
1018713531 6:166514497-166514519 GGCCCTGTAGGGTGGCAGCTGGG + Intronic
1018953477 6:168393316-168393338 TCACCTGCCTGGTGGGGGCTGGG + Intergenic
1019194454 6:170272967-170272989 GGACCAGCCCAGTGACAGCTGGG + Intergenic
1019484543 7:1283498-1283520 GGCCCTGCCTGGGGGCTGCCCGG + Intergenic
1022112437 7:27239778-27239800 GGGCCTGCCGTGTGGCAGGTGGG + Intergenic
1022532986 7:31078726-31078748 GTAACTGCCTGAGGGCAGCTAGG - Intronic
1023495915 7:40796904-40796926 GGACCTGCCTTGTCTCATCTCGG - Intronic
1024195304 7:47053077-47053099 GGACCTGCCTCGCAGCAGCCAGG + Intergenic
1026874723 7:73872532-73872554 GGAACTGCCTGGTGGTGGCCTGG + Intergenic
1026896013 7:74010464-74010486 AGTCCTGCCTTGTGGCTGCTGGG - Intergenic
1028154453 7:87414001-87414023 GTAACTGCCTGGTGGCAGGCTGG - Intronic
1029062280 7:97810758-97810780 GGAACTGCCAGGCGGCAGCCTGG + Intergenic
1029105841 7:98175011-98175033 GCACCTGCCTCGTGGCACGTGGG - Intronic
1029201929 7:98844906-98844928 GGACCAGGGTGGTGGCAGCAGGG + Intergenic
1029261063 7:99303206-99303228 GGCCCTGCCTGCTAGCAGCAAGG - Intergenic
1031306341 7:120131529-120131551 GGACCTGCCTGGTGCCAAGGGGG + Intergenic
1031434276 7:121713198-121713220 GGAACTGCCAGGTGGCAGCCTGG - Intergenic
1032464473 7:132135280-132135302 ATACCTGTCTGGTGGAAGCTTGG - Intronic
1032481257 7:132249026-132249048 GGTCCTGCCTAGAGGCAGGTAGG - Intronic
1032686501 7:134239472-134239494 CGACCTGCAAGGTGGCAGCGAGG + Intronic
1032725790 7:134589153-134589175 GGAACTGCCTGGTGGCCTGTGGG - Intergenic
1033134550 7:138773817-138773839 GGACCCGCCTGGAGGAAGCTGGG - Intronic
1034227797 7:149497116-149497138 GCAGCGGCCTGGTGGCACCTGGG - Intronic
1035162460 7:156961116-156961138 GGACTTGCCTGGCAGCAGGTGGG + Intronic
1035209622 7:157318174-157318196 GGGCCTGCCCAGTGGCTGCTGGG + Intergenic
1035312416 7:157977843-157977865 TGACAAGACTGGTGGCAGCTGGG + Intronic
1035389372 7:158495505-158495527 GCGCCTGCCTGCTGGCAGGTGGG + Intronic
1035513052 8:206816-206838 ACACCCGCCTGCTGGCAGCTGGG + Intergenic
1036201242 8:6773204-6773226 GGGGCTGCCTGGTGGCAGGACGG + Intergenic
1036653788 8:10662618-10662640 TGAGCTGCCTGGGGCCAGCTGGG - Intronic
1036728829 8:11243856-11243878 GGCCCTGCCTGATGGCACTTAGG + Intergenic
1037835324 8:22211997-22212019 GGCCCTGCCTGGTGGCAAGAGGG + Exonic
1039639630 8:39205345-39205367 GGAACTGCAAGGTGGCAGCGAGG - Intronic
1039850100 8:41357654-41357676 TGAACTGCCAGGTGGCAGCAAGG - Intergenic
1040290643 8:46122342-46122364 GGACAGCCCTGGTGGCATCTGGG + Intergenic
1040300431 8:46185148-46185170 GGACATACCTGGTGGCTTCTGGG + Intergenic
1041386554 8:57310244-57310266 GGAACTGCCTGTTGGGGGCTGGG + Intergenic
1042039329 8:64576252-64576274 GGGGCTGCCTGGTGGCGCCTGGG - Intergenic
1042871661 8:73405447-73405469 GGGCCTGGCTGGAGGCAGCATGG - Intergenic
1044371594 8:91418665-91418687 GGACCTCCCTGGTGTAACCTAGG - Intergenic
1048448598 8:134511754-134511776 GTACCAGCCTAGTGGCAGTTGGG - Intronic
1049223043 8:141436570-141436592 GGGCCTCCCTGCTTGCAGCTTGG + Intergenic
1051356275 9:16242133-16242155 GAACCTGCCTGGTAGTAGCCAGG - Intronic
1052280622 9:26729371-26729393 AGACCTGCCATGTGGCAGCTGGG - Intergenic
1053110236 9:35453517-35453539 GGACCTGCCTTGAGCCAGATGGG + Intergenic
1053346157 9:37379946-37379968 GGGCCTCACTGGAGGCAGCTGGG - Intergenic
1053511445 9:38691197-38691219 GGCCCAGCCAGGTGACAGCTAGG + Intergenic
1054798543 9:69325095-69325117 GGACCCGCCAGGCGGCAGGTGGG + Intronic
1056235232 9:84587850-84587872 CTACCTGCCTTGTGGCAGCTTGG + Intergenic
1056307578 9:85305246-85305268 TGGGCTGCCTGGTGGGAGCTGGG + Intergenic
1056535569 9:87524542-87524564 GGACCTGGCTGGTGTCTCCTGGG - Intronic
1057353952 9:94320442-94320464 GGGCCTGGGTGGTGGCAGGTGGG + Exonic
1057353967 9:94320487-94320509 GGGCCTGGGTGGTGGCAGGTGGG + Exonic
1057653798 9:96937148-96937170 GGGCCTGGGTGGTGGCAGGTGGG - Exonic
1058012002 9:99988953-99988975 GGAACTGCGAGGTGGCAGCCTGG + Intronic
1059448804 9:114357086-114357108 GGGCCTGGCTGTTGGGAGCTGGG - Intronic
1060124547 9:121029951-121029973 GGGCCAGGCTGGTGTCAGCTGGG - Intronic
1061006026 9:127928831-127928853 GGACCTGCCTGATGCAACCTGGG + Intronic
1062137827 9:134938996-134939018 GGGCCTGCGTGGTGGCCGCAGGG - Intergenic
1062209633 9:135356673-135356695 GGACCTGGATGCTGGCAGGTGGG + Intergenic
1062288944 9:135786071-135786093 GGGCCTGCGTGGGAGCAGCTGGG - Intronic
1062355538 9:136160337-136160359 GGACCGGACTGGAGGCAGGTGGG + Intergenic
1062433560 9:136536217-136536239 GGCCCTGTCTGCAGGCAGCTGGG - Intronic
1062620080 9:137416704-137416726 GGAACCGCCTGGTGCCACCTCGG - Intronic
1203739962 Un_GL000216v2:170711-170733 GGCACTCCATGGTGGCAGCTGGG + Intergenic
1187455770 X:19440090-19440112 GAGCCAGCCTGGTGGGAGCTGGG - Intronic
1189295656 X:39915718-39915740 GGCCCTGCCTCTTGCCAGCTGGG - Intergenic
1190886814 X:54537711-54537733 GCACCTGCCTGTTGCTAGCTGGG - Intronic
1191972574 X:66833169-66833191 GGACCTTCCTTGTGCCAGATGGG + Intergenic
1192536590 X:71933786-71933808 GAACCTGCCTGGGGATAGCTGGG - Intergenic
1195569006 X:106378553-106378575 GGACCTGCCTCCTGGCAACCAGG - Intergenic
1196234228 X:113260985-113261007 GGCCCTGCCTGGTGACAAATGGG + Intergenic
1196258103 X:113546808-113546830 GGAGCTGCCTGCTGCCATCTTGG - Intergenic
1197069513 X:122279249-122279271 GGATGTGCCTGGTTGCATCTTGG + Intergenic
1200091008 X:153635959-153635981 GAACCCACCTGGGGGCAGCTGGG + Intergenic