ID: 1102461153

View in Genome Browser
Species Human (GRCh38)
Location 12:113100293-113100315
Sequence ACCCCCAAAAAAAGAAGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 283}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102461153_1102461156 6 Left 1102461153 12:113100293-113100315 CCTTAGCTTCTTTTTTTGGGGGT 0: 1
1: 0
2: 0
3: 26
4: 283
Right 1102461156 12:113100322-113100344 AGAGTCTTGCTGTGTTGCCCAGG 0: 425
1: 9704
2: 42176
3: 103572
4: 180336
1102461153_1102461157 7 Left 1102461153 12:113100293-113100315 CCTTAGCTTCTTTTTTTGGGGGT 0: 1
1: 0
2: 0
3: 26
4: 283
Right 1102461157 12:113100323-113100345 GAGTCTTGCTGTGTTGCCCAGGG 0: 16
1: 271
2: 930
3: 2114
4: 3451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102461153 Original CRISPR ACCCCCAAAAAAAGAAGCTA AGG (reversed) Intronic
900133978 1:1106125-1106147 ACCTACAAAAAAGGAAGCAAAGG + Intronic
900832324 1:4973972-4973994 CCCCCCAAAGCAAGAAGCTCAGG + Intergenic
903578969 1:24357052-24357074 CCCCCCAAAAAAAAAATCCATGG + Exonic
905406116 1:37733517-37733539 ACCCTCAAAAAGAGGAGCAAGGG - Intronic
907055719 1:51365998-51366020 ATTCCCAAAAACAGAAGCAAAGG + Exonic
907157575 1:52348553-52348575 ACTCCCATTAAAAGAAGCCAGGG - Intronic
907417945 1:54327298-54327320 ACCCCCCAAAAAAACAGGTAAGG + Intronic
910776983 1:90886641-90886663 TCCCCCAAAAAAAAAATCTACGG + Intergenic
910792078 1:91062008-91062030 AACCTCAAATAAAGAAGTTAAGG + Intergenic
910878328 1:91899152-91899174 ACCCCCAAAATAAGAATGTGAGG + Intronic
912015582 1:105030536-105030558 AAGCCAAAAATAAGAAGCTATGG + Intergenic
912746968 1:112253053-112253075 ACCCCCAAAAGGAAAAGGTATGG + Intergenic
912864068 1:113241190-113241212 ACCCCTAAAAAAAAAAACCAGGG - Intergenic
914967783 1:152276771-152276793 ACCCCCCAAAAAAGACCCAAAGG + Intergenic
915687511 1:157649340-157649362 TCCCCCAGACACAGAAGCTAAGG - Intergenic
917037235 1:170762106-170762128 ACCCCGACAAAAACAAGCAATGG + Intergenic
923421283 1:233817806-233817828 GCCCCCAAACAAAGAGGCTGAGG + Intergenic
1063571419 10:7217535-7217557 GACTCCAAAAAAAGATGCTAAGG + Intronic
1063728949 10:8673384-8673406 ACCACCCAAATAAGATGCTAAGG - Intergenic
1063986690 10:11512102-11512124 TGCCCCCAAAAAATAAGCTAGGG + Intronic
1064233296 10:13549003-13549025 CCCCCCTAAAAAAAAACCTAAGG - Intergenic
1064477957 10:15711768-15711790 CCCCCCAAAAAAAGAAAGAAAGG + Intronic
1070852481 10:79577472-79577494 ACCCCCAAAATAAAATACTAGGG + Intergenic
1072206478 10:93209738-93209760 CCCCCCAAAAAAAAAACCTGGGG + Intergenic
1072953068 10:99865060-99865082 AACCCCACAAAAACAAGCAATGG - Intergenic
1073031976 10:100533829-100533851 CCCCCCAAAAAAAGCATATAAGG - Intronic
1073788912 10:106920076-106920098 ACTTCCCAAAAAAGAAGCTTTGG + Intronic
1073873017 10:107887968-107887990 ACCCCCAAAATATGATGATAGGG + Intergenic
1074261579 10:111858982-111859004 ATCTCCAAAAAAAGGAACTAGGG - Intergenic
1074513802 10:114145716-114145738 ACGCCAAGAAAAAGAAGCAATGG - Exonic
1076018901 10:127053870-127053892 TCCCCCAAAAAAACAAGCAGAGG - Intronic
1078484866 11:11712558-11712580 AACCTGAAAAAAAGAAGCAATGG - Intergenic
1078599626 11:12718576-12718598 TCACCCAAAAAAAAAAGCAACGG - Intronic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1081405781 11:42695974-42695996 ACCCCAAAGAAAAGAAGTTATGG + Intergenic
1083119392 11:60496315-60496337 ACCTCAAAAAAAGGAATCTAAGG + Intronic
1083538755 11:63496013-63496035 CCCCACAAAAAAAGATGCCATGG - Intergenic
1084604628 11:70165348-70165370 TCCTCCAAAAAAAGACGCTCAGG - Intronic
1084722120 11:70913621-70913643 ACCACTAAAAATATAAGCTAAGG + Intronic
1085330604 11:75646796-75646818 ATCTCAAAAAAAAGAAGCAATGG + Intronic
1085625100 11:78065813-78065835 ACCCCCAAACACAGAGCCTATGG + Intronic
1087008520 11:93492112-93492134 TTCCCCCAATAAAGAAGCTAGGG + Intronic
1087151076 11:94860398-94860420 ACACCTACAAAAAGAAGGTAAGG - Intronic
1089150951 11:116363852-116363874 ACCCCCGCAAAAAAAAGCAAAGG - Intergenic
1091571739 12:1692232-1692254 CCCCCCAAAAAATAATGCTATGG - Intronic
1091676255 12:2492780-2492802 ACCACCAGAAAAAGAAAATATGG + Intronic
1092766551 12:11858356-11858378 ACCCAAAATAAAAGAACCTAAGG - Intronic
1094381363 12:29847037-29847059 ACACACAAAAAAGGTAGCTATGG - Intergenic
1095046083 12:37507734-37507756 ACCCCCAAAAAATGGAGCAAGGG - Intergenic
1096096084 12:48936645-48936667 GCCCCCAAAAAAACAAGGTGAGG + Exonic
1096669212 12:53188396-53188418 CTCCCCAAAAAAAGAAGAAAAGG - Exonic
1099409379 12:82305847-82305869 AACCTCAGAAAAAGAAGCAATGG + Intronic
1099832323 12:87859618-87859640 ACCCCCAAAAAAAGACTTTGAGG + Intergenic
1100456039 12:94752582-94752604 ACCCACCAAAAAGGATGCTAAGG + Intergenic
1101892470 12:108730336-108730358 ACTCCCAAAAAAGGATGCCAGGG + Intronic
1102461153 12:113100293-113100315 ACCCCCAAAAAAAGAAGCTAAGG - Intronic
1103384423 12:120520952-120520974 ATCCCCTAAAAAAGAAGAAAAGG + Intronic
1104017270 12:124969430-124969452 AACCCCAAACCCAGAAGCTAAGG + Intronic
1104261152 12:127183357-127183379 CCCCCCAAAAAAAAAAGAGATGG - Intergenic
1106511436 13:30416748-30416770 AACACCAAAAAAAGAAGTAAAGG - Intergenic
1106672747 13:31924094-31924116 ACCAACAGAAAAATAAGCTAAGG - Intergenic
1108182810 13:47857659-47857681 ATTTCCAAAAAAAGAAGCTCAGG - Intergenic
1108349093 13:49574108-49574130 ACCCCCAAAAAAAGAAATTTGGG - Intronic
1109040040 13:57321493-57321515 ACTTCCATAAGAAGAAGCTAAGG + Intergenic
1110318163 13:74134209-74134231 ACCCCCAAACAAAAGAGCTCCGG + Intergenic
1111683357 13:91471035-91471057 ACCCCCCAAACAAGAACCGATGG + Intronic
1112522068 13:100105120-100105142 GGCCCAAAAAAAAGAATCTAAGG - Intronic
1112574687 13:100625065-100625087 TCCCCCAAAAAAGGCAGCTTTGG - Intronic
1112630643 13:101158062-101158084 ACACCCAAAAGAAGAAGATGTGG - Intronic
1112764600 13:102727543-102727565 ACCCCAAAAGAAAGAAGGGAGGG + Intergenic
1113346590 13:109483742-109483764 ACCCACAAAAAAAGAAGTAGGGG + Intergenic
1113436870 13:110299295-110299317 ACCTCCAAAAACAGAAGCTCTGG + Intronic
1115422322 14:33210429-33210451 GCCCCCAAAAATAGAAGTTGAGG + Intronic
1115538856 14:34400085-34400107 ACCACTAAAAAAGGAAACTATGG + Intronic
1116824676 14:49660922-49660944 ACCCCCCAAAAAAGAAGGGTTGG - Intronic
1118276794 14:64392689-64392711 ACCCCAATATACAGAAGCTAAGG - Intronic
1121308884 14:92924064-92924086 CCCACCAAAAAGAGAGGCTAGGG - Intronic
1122475893 14:102008783-102008805 TCCCCCAAAAAAAGAAACCCAGG + Intronic
1127159130 15:56162581-56162603 AGCCCCAAAAAAATAAGTTCTGG - Intronic
1127455308 15:59151445-59151467 CCCCCCAAAAAAACCAACTAAGG + Intronic
1128638628 15:69319304-69319326 AACCCCAAAAACTGAAGCCATGG + Intronic
1128894302 15:71358253-71358275 ACCATCAAAAAAAGAGGCCAGGG - Intronic
1130990029 15:88870716-88870738 ACCCCCAAAATAAAAAGCCAGGG + Intronic
1131690784 15:94824990-94825012 ACCCCCAGAACAAGAGGCCAAGG - Intergenic
1132165036 15:99578523-99578545 TCCCCCAAAACAAGGAGCCAGGG - Intronic
1134077367 16:11301217-11301239 ACAAACAAAAAAACAAGCTAAGG + Intronic
1134146550 16:11769313-11769335 ACTTCCAGAAAAATAAGCTAAGG + Intronic
1134837289 16:17371937-17371959 CCCCCCAAAAAAAGTTGCTATGG + Intronic
1135207813 16:20497766-20497788 ACTTCCAAAAAAAGAAGGGAAGG + Intergenic
1135211086 16:20525934-20525956 ACTTCCAAAAAAAGAAGGGAAGG - Intergenic
1138697688 16:58830794-58830816 ACTCCCAAAAAAGGAAGTTTGGG - Intergenic
1139164450 16:64549489-64549511 AGGCCAAAAAAAAGAAGCCAAGG + Intergenic
1140769136 16:78187618-78187640 GTCCCCAAAAAAAGACGCAAAGG + Intronic
1141872406 16:86796612-86796634 ACCCACTAAAAAATAAGCTAGGG - Intergenic
1142498736 17:320637-320659 CCCCCCAAAAAAAAAAGAAAAGG + Intronic
1142896065 17:2979940-2979962 ACCTCAAAAAAAAGAAGAAAAGG - Intronic
1144251601 17:13422167-13422189 GCCCCCCAAAAAAGAATTTAGGG + Intergenic
1145055701 17:19702753-19702775 ACCCCCACAAGAAAAAGCTTTGG + Intronic
1146652870 17:34617195-34617217 TCTCCCAAAGAAAGAAGCTGAGG + Intronic
1146757305 17:35444400-35444422 TCCCACAAAAGAAGAAGCAAAGG - Intronic
1149382931 17:56111617-56111639 ACCCCCAAAATAAGCATCTTAGG + Intronic
1151055705 17:71028685-71028707 TACCACATAAAAAGAAGCTATGG + Intergenic
1151206237 17:72509728-72509750 ACCCTCGAAAGAAAAAGCTATGG + Intergenic
1153004064 18:481700-481722 ACCTCCAAAAAAAAAAGAGAGGG + Intronic
1153055582 18:942862-942884 CCCCCTAAAAATAGAAGCAAAGG + Intergenic
1153615013 18:6926236-6926258 AACGCCAGAAAAAGAAGCCATGG + Intergenic
1153703078 18:7716235-7716257 AACCCAAGAAAAAGAAGCAATGG + Intronic
1153855881 18:9146122-9146144 AACCCCTAAAAAAGAAATTAAGG - Intronic
1153888739 18:9492669-9492691 CCCCCCAAAAAAGGCAGCAATGG - Intronic
1156141102 18:34112366-34112388 CCCCCCAAAAAAAAAAGATATGG + Intronic
1156645201 18:39152799-39152821 ACCTAAAAAAATAGAAGCTAAGG + Intergenic
1158289952 18:55929249-55929271 ACCCTCAAAGAAAGAAGTAATGG - Intergenic
1159519467 18:69499518-69499540 ACTCCCCAAAACACAAGCTAAGG + Intronic
1160167881 18:76529927-76529949 CCCCCCAAAAAAAGAAGTAGCGG - Intergenic
1160779749 19:872517-872539 AGCCCCACAAAAAGAAGAGAGGG + Intronic
1161094808 19:2384133-2384155 ACCCACAGAAAAGGAAGCTGGGG - Intergenic
1162409442 19:10496497-10496519 ACCCCCAAAAAAAAAAAAAAGGG + Intronic
1163475550 19:17523887-17523909 CCCCCCAAAAAAGAAAGCGAGGG - Intronic
1165972562 19:39644530-39644552 ACCCACAAAAAAATCAGCCAGGG + Intergenic
929458583 2:42084611-42084633 AGCCCCAAAGAATGAAGCCACGG + Intergenic
930230377 2:48837192-48837214 ATCCCCAAAAATAGAAGAGAAGG - Intergenic
931693093 2:64851868-64851890 ATCCCCAAGCAAAGAAGCTAAGG - Intergenic
933086764 2:78063010-78063032 TCCCAGAAAAAAAGAAGCTGAGG + Intergenic
933551480 2:83782789-83782811 AACCACAAAGAAAGTAGCTATGG + Intergenic
933584503 2:84166036-84166058 AACCCCAGAAAAGGAAGCTATGG + Intergenic
933792683 2:85895670-85895692 ACCCCCAAAAAAAGAGCCCTAGG + Intergenic
935055780 2:99565347-99565369 CCCCCCAAAATAAGAGGGTAAGG - Intronic
935310294 2:101776582-101776604 CCCCCCAAAAAAAAACACTATGG + Intronic
939175718 2:138745474-138745496 CCCGCCAAAAAAAGAAGAAAAGG - Intronic
939329293 2:140737051-140737073 TCCCCCAAAAAAATAAACAAGGG + Intronic
939892456 2:147753540-147753562 ACCCTCATAAAATGAAGCTTAGG - Intergenic
940500783 2:154490976-154490998 ACCCCCCAAAAAAGAAAATTAGG - Intergenic
940685435 2:156844112-156844134 ATCTCAAGAAAAAGAAGCTATGG + Intergenic
940790206 2:158023778-158023800 ACCCTCTAAACAAGAAGCCATGG - Intronic
940820005 2:158342584-158342606 ACTGCCAAAAAATGAAGATATGG + Intronic
941356625 2:164501155-164501177 AGCCCTAAAATAAGAAACTAAGG - Intronic
941707647 2:168676978-168677000 AGCCCCAAAAAACAAAGCAATGG - Intronic
942505997 2:176642349-176642371 AACCCCAAAAGAGGAAGCTAAGG + Intergenic
943911206 2:193570264-193570286 ACCCACCAAAAAAGAAGCCCAGG - Intergenic
945409998 2:209496793-209496815 ACACACAAAAAAAGAATTTAAGG - Intronic
947663060 2:231884280-231884302 ACCACCCCAAAAAGAAGCTGTGG - Intergenic
948162739 2:235838191-235838213 CCCCCCAAAAAAAGAAAAGAGGG + Intronic
948324304 2:237100516-237100538 ACCCCCAAAAAATTGAGCTGTGG + Intergenic
1169090859 20:2860656-2860678 ACCCATAAAAACAGAAGCTGTGG + Intronic
1169683080 20:8238883-8238905 ACCCCGAGAAGCAGAAGCTAAGG + Intronic
1171540641 20:25951335-25951357 ACCCCCAAAAAAGGGAGCAAGGG - Intergenic
1171800431 20:29609003-29609025 ACCCCCAAAAAAGGGAGCAAGGG + Intergenic
1171843668 20:30247705-30247727 ACCCCCAAAAAAGGGAGCAAGGG - Intergenic
1172506757 20:35468365-35468387 CTCACCAAAAAAAGAAGGTAGGG - Intronic
1172738047 20:37143464-37143486 ACCCCCAAACTAAGAAGGCAAGG + Intronic
1174574835 20:51529812-51529834 ACCTCCATAAATAGAAGGTAGGG + Intronic
1177133589 21:17286602-17286624 ACCCCAACAAAAACAAGCAATGG + Intergenic
1177900387 21:26907252-26907274 ACCGACAAAAAAAGAAGAAAAGG + Intergenic
1177927707 21:27239700-27239722 ACTAACAAAAAAATAAGCTATGG - Intergenic
1178043849 21:28672097-28672119 ACTCCCAAAAAAAGAAACATAGG + Intergenic
1178274472 21:31224444-31224466 ACCTCCAAAACATGAAGCTCAGG + Intronic
1183183185 22:36275794-36275816 ACTCCCTAAAGAAAAAGCTAGGG + Intergenic
1183371873 22:37437363-37437385 ACCCCCGAAAAAAGAAGTCTTGG - Intergenic
1183570429 22:38649156-38649178 AGCCCCAAAGGAAGAAGCTCTGG - Intronic
949153344 3:797844-797866 AACAACAAAAAAAGAAGATATGG + Intergenic
949199560 3:1358646-1358668 AAACCCAAAAAAAGAGGATAAGG - Intronic
949995987 3:9617889-9617911 ACCCCCAAAGGAAGAAAATACGG + Intergenic
950117685 3:10462008-10462030 ACCCCAAAACAGAGAAGCCATGG - Intronic
950206388 3:11084389-11084411 ACCCCCAAAAAAGGAATGCATGG - Intergenic
951374436 3:21896179-21896201 AACCAGAAAAAAAGAAGCTTGGG + Intronic
952238806 3:31508563-31508585 ACCCAGAAAAAAAGATGCCAAGG + Intergenic
955806609 3:62742501-62742523 AACCCGACAAAAAGAAGCAATGG + Intronic
955853650 3:63249286-63249308 AACCCTAGAAAATGAAGCTATGG + Intronic
957441240 3:80250990-80251012 ACCCTAAAAAAAACAAGCAATGG + Intergenic
957982592 3:87528801-87528823 TTCCCAAAAAAAAGAAGATAAGG - Intergenic
959684460 3:109129625-109129647 ACCTCCAAAAAATGGAGCCAAGG + Intergenic
960190210 3:114695238-114695260 ACATGCAAGAAAAGAAGCTAGGG - Intronic
960899467 3:122540411-122540433 ACACCCAAAAGAAGAAACAATGG + Intronic
961229165 3:125286234-125286256 AGCCCCAAAAAAAGAAGTGGAGG + Intronic
961616713 3:128188389-128188411 ACCCCACAAAAAAGAAGCCCTGG - Intronic
961980133 3:131068537-131068559 ACACTAAAAAAAAGAAGCTTGGG - Intronic
963197500 3:142549025-142549047 ACACCAAAAAAAAGAAGCACAGG + Intronic
963790149 3:149575092-149575114 CCCCCCAAAAAAAAAAGATGGGG + Intronic
964950144 3:162280949-162280971 ACTCCCAAAAGAATCAGCTAGGG - Intergenic
965049250 3:163623153-163623175 ACCCCCAAATAAGGAAAGTAAGG + Intergenic
968285168 3:197504341-197504363 CCGCCCAAAAAAAGAAACTAAGG + Intergenic
968320622 3:197764844-197764866 CCCCCCAAAAAAAAAAAGTATGG - Intronic
969249586 4:5958199-5958221 CCCCCCAAAAAGAGAGTCTAGGG - Exonic
969852561 4:9971757-9971779 ACCCCTGAAAAATAAAGCTAAGG + Intronic
971491875 4:27221168-27221190 AATCCAAAAAAAAGAAGTTAAGG - Intergenic
971651152 4:29276492-29276514 ACCACCAAAAACAACAGCTAAGG + Intergenic
971801873 4:31303372-31303394 CACCCAAAAAAAAGAAGATAAGG + Intergenic
972680538 4:41302324-41302346 ACCCCAAAAAAAAAAAGCCCTGG - Intergenic
973970876 4:56212702-56212724 ACACACAAAAAAAGAAACAAAGG + Intronic
974070708 4:57121026-57121048 AACCCTAACAAAAGAAGCCAGGG - Intergenic
974134847 4:57802737-57802759 ACTCCCAAGAAAAAAAGCTCTGG + Intergenic
975032381 4:69637153-69637175 AGCCAGAAAAAAAGAAACTACGG + Intronic
975193174 4:71490484-71490506 ATCCCCCAAAAAGAAAGCTAGGG - Intronic
975828613 4:78345586-78345608 AAACACAAAAAAAGAAGATAAGG - Intronic
976313465 4:83635375-83635397 ACCCCACAAAAAAGGAGCAAAGG - Intergenic
976889967 4:90034605-90034627 ACCCTCACAAAAACAAGCAATGG + Intergenic
978413187 4:108447224-108447246 ACCCCGGGAAAAAGAAACTATGG - Intergenic
978838109 4:113177509-113177531 ACACCAAAAAAGAGAACCTAAGG + Intronic
979291380 4:118982450-118982472 ACCCCCAAAATATGAAGGAAAGG - Intronic
979463189 4:121006445-121006467 TCCCCCAAATAAACAAGGTAGGG + Intergenic
980643278 4:135607195-135607217 ATCCCCAAAGAAAGAAGTGATGG + Intergenic
983231921 4:165137620-165137642 ACACACAAAAAAAGAAACTTTGG - Intronic
983291678 4:165815092-165815114 ACCCCCCAAAAAAGAAAGAAAGG - Intergenic
983437924 4:167739641-167739663 CCCACCAAAAAAACAAGCTTTGG - Intergenic
984966130 4:185142268-185142290 ACTGCCTAAAAAACAAGCTAAGG + Intergenic
985081028 4:186264172-186264194 GCCCCAATAAAAAGAAGATAAGG - Intergenic
987024186 5:13907436-13907458 CCCCCCAAAAAAAGAACCTGGGG + Intronic
987714913 5:21555695-21555717 GCTCCCACCAAAAGAAGCTAGGG - Intergenic
988049398 5:26005952-26005974 ACCCCCAGGCAAAGAGGCTAAGG - Intergenic
991447105 5:66711838-66711860 CCCCCCAAAAAAAGATGCTTTGG + Intronic
992520855 5:77549527-77549549 ACCCCCAAAAAAACAAACCTAGG + Intronic
994997199 5:107079020-107079042 AGCCCCAAAAAAAGAGGAAAGGG + Intergenic
995168909 5:109082966-109082988 CCCCCCAAAAAAAGAAAAAAAGG + Intronic
995231667 5:109771875-109771897 CCCCCCAAAAAAAGAACAAAGGG - Intronic
995690568 5:114821891-114821913 ACAAACAAAAAAAGAAGCAAGGG - Intergenic
996488460 5:124064661-124064683 ACCACCAAAATAAGAAAATAAGG + Intergenic
996647266 5:125831272-125831294 ACCTCCAAAAACACATGCTATGG + Intergenic
996965359 5:129301403-129301425 ACCCTCACAAAAACAAGCAATGG - Intergenic
997105792 5:131018132-131018154 CCCCCCAAAACAAGAAACCAAGG - Intergenic
998217838 5:140250741-140250763 ACGCCCAACAGAAGAAGCAAAGG + Intronic
999443530 5:151620998-151621020 ACCCACAGAAAAAGAAGCAGAGG + Intergenic
1000209956 5:159099689-159099711 AACCCGAAAAAAAGAAGAAAGGG + Exonic
1000788787 5:165579457-165579479 ACCCCAAAAAGTAGAAACTAAGG - Intergenic
1001466286 5:171969275-171969297 CCCCCAAAAAAAAGAATGTATGG + Intronic
1001768816 5:174277016-174277038 ACCCCCAAATAATACAGCTATGG + Intergenic
1002905458 6:1445372-1445394 ACCCCTGAAAAAGGAAGCTCTGG + Intergenic
1003335943 6:5172324-5172346 AGGCCCAAAAAAAGGAGCTGAGG + Intronic
1004557374 6:16712578-16712600 ACACTCAAAAAAAGAACCAAAGG + Intronic
1006206139 6:32344845-32344867 AGCCCCAAAAAAAAAACCTAAGG - Intronic
1006314050 6:33279909-33279931 AGCACCAAAAAGAGAAGCCAGGG + Intronic
1007058970 6:38919038-38919060 ACCCCAACAAAAAGATACTAAGG + Intronic
1009001810 6:57726334-57726356 GCTCCCACCAAAAGAAGCTAGGG + Intergenic
1012187653 6:96240050-96240072 ACCCTCAAAAAGAGAGACTATGG + Intergenic
1012929869 6:105305838-105305860 CCCCCCAAAAAAAAAAGAAAAGG - Intronic
1014149483 6:118037423-118037445 AACCCCAAAAAAGGCAGGTAAGG - Intronic
1015179226 6:130344379-130344401 CCCCGTAAAAAAAGAAGCCAGGG - Intronic
1016289610 6:142514329-142514351 ACCCCCAAAAAACAAAACTTTGG - Intergenic
1017628688 6:156374582-156374604 CCCCACAAAAAAAGATGCAATGG + Intergenic
1019602551 7:1892579-1892601 ACCCACAATAAAAAAAGCTGTGG + Intronic
1020061250 7:5154236-5154258 TCCCCCAAAAATAGAAGCCATGG + Intergenic
1020914523 7:14175801-14175823 CCCCCAAAAAAAAGACACTAAGG - Intronic
1021035741 7:15795853-15795875 ACCCTGAAAAAAAGAGCCTAAGG + Intergenic
1021484151 7:21148490-21148512 CATCTCAAAAAAAGAAGCTATGG - Intergenic
1023159348 7:37282616-37282638 CCCCCCAAAAAAAGAAACAGGGG + Intronic
1025292073 7:57737577-57737599 ACCCCCAAAAAAGGGAGCAAGGG - Intergenic
1026664225 7:72328608-72328630 ACTCCCAAAATAAGATGGTAGGG + Intronic
1027581203 7:79997719-79997741 AGCCACAGAAAAAGAAGCTGTGG + Intergenic
1027695886 7:81409913-81409935 CCCCCCAAAAAATGAAACAAAGG + Intergenic
1028339369 7:89699425-89699447 GCCCCCAAAAAAACTGGCTATGG + Intergenic
1028857412 7:95607344-95607366 ACCCCCAAAAAATTAGTCTAAGG - Intergenic
1029851833 7:103469616-103469638 TCCCCCAAAAAAAGAAAATGTGG - Intergenic
1030049200 7:105522896-105522918 ACCCCCAAAAAAATTAGCCTGGG - Intergenic
1030326052 7:108219390-108219412 ATAACCAAAAAAAGAAACTATGG + Intronic
1030672535 7:112353032-112353054 ACCCCAAAGAAAAGAAGACAGGG + Intergenic
1032133116 7:129247900-129247922 ACCACCAAAAGTAGAATCTAAGG - Intronic
1032637049 7:133720484-133720506 ACCCCCAAAATAAGATCCTATGG - Intronic
1033140195 7:138819272-138819294 TCCCCCAAAAAGAGAAACAAAGG + Intronic
1033786507 7:144737582-144737604 ACCCCCAAAAATAGACATTAAGG - Intronic
1035178062 7:157067560-157067582 ACCCTCAAAAAAGAAAACTATGG - Intergenic
1036480808 8:9137858-9137880 ACCCCCAGCAAAAAAAGCCAGGG + Exonic
1037240448 8:16771419-16771441 ACCTCAGCAAAAAGAAGCTATGG + Intergenic
1037652214 8:20849086-20849108 ACCAACAAAAAAAGAAACAAAGG + Intergenic
1037972149 8:23180083-23180105 ATCTCAAAAAAAAAAAGCTATGG - Intergenic
1038105845 8:24432882-24432904 GGCCCCAAAATACGAAGCTAAGG - Intergenic
1038520516 8:28228317-28228339 ACCACCAAAAAAAGCAGCCCTGG + Intergenic
1038627249 8:29206120-29206142 CCCCACAAAAAAAGAGGCTGGGG + Intronic
1039557859 8:38489631-38489653 ATCTCAAAAAAAAGAGGCTATGG - Intergenic
1041045599 8:53883091-53883113 ACCCCCAAAAAAATTAGGTTTGG - Intronic
1041220620 8:55647974-55647996 ACACCCAACAAAAGAAACTCAGG - Intergenic
1041483801 8:58351883-58351905 ACCTCCCAAAACAGAAGGTATGG + Intergenic
1045265853 8:100618111-100618133 AGCACCAAAAAAGGAAGCTGTGG - Intronic
1045508093 8:102792889-102792911 ACCCCCAAAAAAAGATGTGTTGG + Intergenic
1045621037 8:103978789-103978811 CCCCCCAAAAAAATTAGCAATGG + Intronic
1045931521 8:107632760-107632782 ACCCCCATGAAGAGAAGTTAAGG + Intergenic
1046603668 8:116346505-116346527 AACCTGACAAAAAGAAGCTATGG - Intergenic
1048139476 8:131779261-131779283 CCCCCCAAAAAAAGAAAAAAAGG - Intergenic
1050098154 9:2089243-2089265 AACCCCAAAACATGGAGCTAAGG - Intronic
1050241686 9:3643022-3643044 ACCCATAAAAAAAGAAAATATGG - Intergenic
1050599817 9:7239078-7239100 ACCTCCAAAGATAGAAGCTAGGG + Intergenic
1051297587 9:15612996-15613018 ACCCCCAACAAAACAGTCTATGG - Intronic
1051847192 9:21465169-21465191 ACACCCAAAAAAAGAAGCACAGG - Intergenic
1052198914 9:25753528-25753550 ACCCCCAACAACTGAAGCTCAGG + Intergenic
1052623232 9:30942127-30942149 AACCCGACAAAAACAAGCTATGG + Intergenic
1052753192 9:32513452-32513474 ACCCTGACAAAAAGAAGCAATGG + Intronic
1053831325 9:42084598-42084620 ACCCCCTAAAAAAAAAGAGATGG + Intronic
1054164432 9:61708120-61708142 ACCCCCAAAAAAGGGAGCAAGGG + Intergenic
1054599222 9:67102840-67102862 ACCCCCTAAAAAAAAAGAGATGG - Intergenic
1054923454 9:70564727-70564749 ACCTCCAAAGAAATAATCTATGG + Intronic
1055462777 9:76534868-76534890 ACCCCCAAATTACTAAGCTAAGG + Intergenic
1055560618 9:77518023-77518045 AAGCCCAATAAAAGAAGCTTTGG + Intronic
1055846554 9:80571025-80571047 ACCCACAAAGAAAATAGCTATGG + Intergenic
1056685975 9:88759654-88759676 ACCCCCAAAAAAGGCCGCTGTGG - Intergenic
1057350245 9:94290752-94290774 ACCCCCAAAAATTGAAAGTAGGG - Intronic
1058005442 9:99908722-99908744 TTCTCCAAAAAAAGAAACTACGG - Intronic
1058588476 9:106535356-106535378 ACCCCCACCAAAATAAGCAAAGG + Intergenic
1060170326 9:121456088-121456110 ACCCCCCAAAAAAGAAGTGACGG + Intergenic
1185521762 X:745529-745551 ACTCCCAAAGAAAAAAGCGATGG - Intergenic
1187376036 X:18755572-18755594 GCCCCCAAAAAAAGAGTGTATGG + Intronic
1188806564 X:34597719-34597741 ACCAGCAAAAAAAAAAGCAATGG - Intergenic
1191044034 X:56116721-56116743 ACACACAAAAAAAGAAAATACGG - Intergenic
1191766163 X:64700519-64700541 AACCCCCAAAAAACAAGCAATGG - Intergenic
1192010891 X:67271285-67271307 AACCTCAAAAAAACAAGCAATGG + Intergenic
1193183904 X:78489648-78489670 AACCTCAAAAAAACAAGCAATGG - Intergenic
1194022069 X:88703221-88703243 AACCCCATAAAAACAAGCAATGG + Intergenic
1194402768 X:93458764-93458786 ATCCACAAAACAGGAAGCTAGGG + Intergenic
1195081438 X:101375281-101375303 ACTCCAGAAAGAAGAAGCTATGG - Exonic
1195764682 X:108283572-108283594 CCCCCCAAAAAAAAAACTTAGGG - Intronic
1197365395 X:125559474-125559496 TCCCAGACAAAAAGAAGCTAAGG + Intergenic
1199485368 X:148341188-148341210 ACCACCAAAAAAAGAATGTCAGG + Intergenic
1200437533 Y:3170381-3170403 CCCCCCAAAAAAAGAAAAAAAGG - Intergenic